Development of an ELISA Method to Differentiate Animals Infected with Wild-Type African Swine Fever Viruses and Attenuated HLJ/18-7GD Vaccine Candidate
Abstract
:1. Introduction
2. Materials and Methods
2.1. Serum Samples
2.2. Antigen Preparation
2.2.1. Expression of p54 Protein
2.2.2. Expression of CD2v Protein
2.3. Development of p54-ELISA and CD2v-ELISA
2.4. Determination of the Cut-Off Value
2.5. Establishment and Standardization of Indirect ELISA
2.6. Serum Cross-Reactivity of Indirect ELISA to Other Pathogens
2.7. Calculations and Statistical Analysis
3. Results
3.1. The Expression, Purification, and Identification of the Recombinant Proteins
3.2. Optimization of Indirect ELISA
3.3. Determination of the Cut-Off Threshold Value
3.4. Validation of Cross-Reactivity and Sensitivity of p54 and CD2v Indirect ELISA
3.5. Performance Assessment of the Established Indirect ELISAs
3.6. Inter- and Intra-Assay Variation of p54 and CD2v Indirect ELISA
3.7. Assessing the Ability of the Established ELISA to Differentiate the Infection of the Naturally Occurring Lower Virulent ASFV Isolate in China
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Alonso, C.; Borca, M.; Dixon, L.; Revilla, Y.; Rodriguez, F.; Escribano, J.M.; Ictv Report, C. ICTV Virus Taxonomy Profile: Asfarviridae. J. Gen. Virol. 2018, 99, 613–614. [Google Scholar] [CrossRef] [PubMed]
- Dixon, L.K.; Chapman, D.A.; Netherton, C.L.; Upton, C. African swine fever virus replication and genomics. Virus Res. 2013, 173, 3–14. [Google Scholar] [CrossRef]
- Wang, N.; Zhao, D.; Wang, J.; Zhang, Y.; Wang, M.; Gao, Y.; Li, F.; Wang, J.; Bu, Z.; Rao, Z.; et al. Architecture of African swine fever virus and implications for viral assembly. Science 2019, 366, 640–644. [Google Scholar] [CrossRef]
- Yáñez, R.J.; Rodríguez, J.M.; Nogal, M.L.; Yuste, L.; Enríquez, C.; Rodriguez, J.F.; Viñuela, E. Analysis of the complete nucleotide sequence of African swine fever virus. Virology 1995, 208, 249–278. [Google Scholar] [CrossRef] [Green Version]
- Galindo, I.; Alonso, C. African Swine Fever Virus: A Review. Viruses 2017, 9, 103. [Google Scholar] [CrossRef] [Green Version]
- Quembo, C.J.; Jori, F.; Vosloo, W.; Heath, L. Genetic characterization of African swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype. Transbound. Emerg. Dis. 2018, 65, 420–431. [Google Scholar] [CrossRef] [Green Version]
- Netherton, C.L.; Connell, S.; Benfield, C.T.O.; Dixon, L.K. The Genetics of Life and Death: Virus-Host Interactions Underpinning Resistance to African Swine Fever, a Viral Hemorrhagic Disease. Front. Genet. 2019, 10, 402. [Google Scholar] [CrossRef] [Green Version]
- Sánchez-Vizcaíno, J.M.; Mur, L.; Gomez-Villamandos, J.C.; Carrasco, L. An update on the epidemiology and pathology of African swine fever. J. Comp. Pathol. 2015, 152, 9–21. [Google Scholar] [CrossRef]
- Wen, X.; He, X.; Zhang, X.; Zhang, X.; Liu, L.; Guan, Y.; Zhang, Y.; Bu, Z. Genome sequences derived from pig and dried blood pig feed samples provide important insights into the transmission of African swine fever virus in China in 2018. Emerg. Microbes Infect. 2019, 8, 303–306. [Google Scholar] [CrossRef] [PubMed]
- Ge, S.Q.; Li, J.M.; Fan, X.X.; Liu, F.X.; Li, L.; Wang, Q.H.; Ren, W.J.; Bao, J.Y.; Liu, C.J.; Wang, H.; et al. Molecular Characterization of African Swine Fever Virus, China, 2018. Emerg. Infect. Dis. 2018, 24, 2131–2133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, D.; Liu, R.; Zhang, X.; Li, F.; Wang, J.; Zhang, J.; Liu, X.; Wang, L.; Zhang, J.; Wu, X.; et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg. Microbes Infect. 2019, 8, 438–447. [Google Scholar] [CrossRef] [Green Version]
- Revilla, Y.; Pérez-Núñez, D.; Richt, J.A. African Swine Fever Virus Biology and Vaccine Approaches. Adv. Virus Res. 2018, 100, 41–74. [Google Scholar] [CrossRef] [PubMed]
- Borca, M.V.; Ramirez-Medina, E.; Silva, E.; Vuono, E.; Rai, A.; Pruitt, S.; Holinka, L.G.; Velazquez-Salinas, L.; Zhu, J.; Gladue, D.P. Development of a Highly Effective African Swine Fever Virus Vaccine by Deletion of the I177L Gene Results in Sterile Immunity against the Current Epidemic Eurasia Strain. J. Virol. 2020, 94, e02017-19. [Google Scholar] [CrossRef] [PubMed]
- Reis, A.L.; Goatley, L.C.; Jabbar, T.; Sanchez-Cordon, P.J.; Netherton, C.L.; Chapman, D.A.G.; Dixon, L.K. Deletion of the African Swine Fever Virus Gene DP148R Does Not Reduce Virus Replication in Culture but Reduces Virus Virulence in Pigs and Induces High Levels of Protection against Challenge. J. Virol. 2017, 91, e01428-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monteagudo, P.L.; Lacasta, A.; López, E.; Bosch, L.; Collado, J.; Pina-Pedrero, S.; Correa-Fiz, F.; Accensi, F.; Navas, M.J.; Vidal, E.; et al. BA71ΔCD2: A New Recombinant Live Attenuated African Swine Fever Virus with Cross-Protective Capabilities. J. Virol. 2017, 91, e01058-17. [Google Scholar] [CrossRef] [Green Version]
- O’Donnell, V.; Holinka, L.G.; Gladue, D.P.; Sanford, B.; Krug, P.W.; Lu, X.; Arzt, J.; Reese, B.; Carrillo, C.; Risatti, G.R.; et al. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus. J. Virol. 2015, 89, 6048–6056. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.; Zhao, D.; He, X.; Liu, R.; Wang, Z.; Zhang, X.; Li, F.; Shan, D.; Chen, H.; Zhang, J.; et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci. China Life Sci. 2020, 63, 623–634. [Google Scholar] [CrossRef]
- Cubillos, C.; Gomez-Sebastian, S.; Moreno, N.; Nunez, M.C.; Mulumba-Mfumu, L.K.; Quembo, C.J.; Heath, L.; Etter, E.M.C.; Jori, F.; Escribano, J.M.; et al. African swine fever virus serodiagnosis: A general review with a focus on the analyses of African serum samples. Virus Res. 2013, 173, 159–167. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Pinero, J.; Gallardo, C.; Elizalde, M.; Robles, A.; Gómez, C.; Bishop, R.; Heath, L.; Couacy-Hymann, E.; Fasina, F.O.; Pelayo, V.; et al. Molecular diagnosis of African Swine Fever by a new real-time PCR using universal probe library. Transbound. Emerg. Dis. 2013, 60, 48–58. [Google Scholar] [CrossRef] [Green Version]
- Gallardo, C.; Nieto, R.; Soler, A.; Pelayo, V.; Fernández-Pinero, J.; Markowska-Daniel, I.; Pridotkas, G.; Nurmoja, I.; Granta, R.; Simón, A.; et al. Assessment of African Swine Fever Diagnostic Techniques as a Response to the Epidemic Outbreaks in Eastern European Union Countries: How To Improve Surveillance and Control Programs. J. Clin. Microbiol. 2015, 53, 2555–2565. [Google Scholar] [CrossRef] [Green Version]
- Oura, C.A.; Edwards, L.; Batten, C.A. Virological diagnosis of African swine fever--comparative study of available tests. Virus Res. 2013, 173, 150–158. [Google Scholar] [CrossRef] [PubMed]
- Petrovan, V.; Murgia, M.V.; Wu, P.; Lowe, A.D.; Jia, W.; Rowland, R.R.R. Epitope mapping of African swine fever virus (ASFV) structural protein, p54. Virus Res. 2020, 279, 197871. [Google Scholar] [CrossRef] [PubMed]
- Gallardo, C.; Reis, A.L.; Kalema-Zikusoka, G.; Malta, J.; Soler, A.; Blanco, E.; Parkhouse, R.M.; Leitão, A. Recombinant antigen targets for serodiagnosis of African swine fever. Clin. Vaccine Immunol. CVI 2009, 16, 1012–1020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gomez-Puertas, P.; Rodriguez, F.; Oviedo, J.M.; Ramiro-Ibanez, F.; Ruiz-Gonzalvo, F.; Alonso, C.; Escribano, J.M. Neutralizing antibodies to different proteins of African swine fever virus inhibit both virus attachment and internalization. J. Virol. 1996, 70, 5689–5694. [Google Scholar] [CrossRef] [Green Version]
- Tsegay, G.; Tesfagaber, W.; Zhu, Y.; He, X.; Wang, W.; Zhang, Z.; Sun, E.; Zhang, J.; Guan, Y.; Li, F.; et al. Novel P22-monoclonal antibody based blocking ELISA for the detection of african swine fever virus antibodies in serum. Biosaf. Health 2022. [Google Scholar] [CrossRef]
- Oviedo, J.M.; Rodriguez, F.; Gómez-Puertas, P.; Brun, A.; Gómez, N.; Alonso, C.; Escribano, J.M. High level expression of the major antigenic African swine fever virus proteins p54 and p30 in baculovirus and their potential use as diagnostic reagents. J. Virol. Methods 1997, 64, 27–35. [Google Scholar] [CrossRef]
- Pérez-Núñez, D.; Sunwoo, S.Y.; Sánchez, E.G.; Haley, N.; García-Belmonte, R.; Nogal, M.; Morozov, I.; Madden, D.; Gaudreault, N.N.; Mur, L.; et al. Evaluation of a viral DNA-protein immunization strategy against African swine fever in domestic pigs. Vet. Immunol. Immunopathol. 2019, 208, 34–43. [Google Scholar] [CrossRef]
- Ruíz-Gonzalvo, F.; Coll, J.M. Characterization of a soluble hemagglutinin induced in African swine fever virus-infected cells. Virology 1993, 196, 769–777. [Google Scholar] [CrossRef]
- Rodríguez, J.M.; Yáñez, R.J.; Almazán, F.; Viñuela, E.; Rodriguez, J.F. African swine fever virus encodes a CD2 homolog responsible for the adhesion of erythrocytes to infected cells. J. Virol. 1993, 67, 5312–5320. [Google Scholar] [CrossRef] [Green Version]
- Ruiz-Gonzalvo, F.; Rodríguez, F.; Escribano, J.M. Functional and immunological properties of the baculovirus-expressed hemagglutinin of African swine fever virus. Virology 1996, 218, 285–289. [Google Scholar] [CrossRef] [Green Version]
- Sun, E.; Zhang, Z.; Wang, Z.; He, X.; Zhang, X.; Wang, L.; Wang, W.; Huang, L.; Xi, F.; Huangfu, H.; et al. Emergence and prevalence of naturally occurring lower virulent African swine fever viruses in domestic pigs in China in 2020. Sci. China Life Sci. 2021, 64, 752–765. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Xiao, L.; Peng, B.; Wang, Y.; Yang, Z.; Yao, X.; Hu, L.; Lin, X. Prokaryotic expression, purification and antigenicity analysis of African swine fever virus pK205R protein. Pol. J. Vet. Sci. 2016, 19, 41–48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, R.; Yang, J.Y.; Sun, Y.; Zhou, D.H.; Yang, Y.; Li, Y.M.; Cao, Y.; Xiao, Y.; Li, W.; Yu, J.; et al. Flagellin-PAc Fusion Protein Inhibits Progression of Established Caries. J. Dent. Res. 2015, 94, 955–960. [Google Scholar] [CrossRef] [PubMed]
- McEwen, J.; Levi, R.; Horwitz, R.J.; Arnon, R. Synthetic recombinant vaccine expressing influenza haemagglutinin epitope in Salmonella flagellin leads to partial protection in mice. Vaccine 1992, 10, 405–411. [Google Scholar] [CrossRef]
- Yang, J.; Zhong, M.; Zhang, Y.; Zhang, E.; Sun, Y.; Cao, Y.; Li, Y.; Zhou, D.; He, B.; Chen, Y.; et al. Antigen replacement of domains D2 and D3 in flagellin promotes mucosal IgA production and attenuates flagellin-induced inflammatory response after intranasal immunization. Hum. Vaccines Immunother. 2013, 9, 1084–1092. [Google Scholar] [CrossRef] [Green Version]
- Tesfagaber, W.; Wang, L.; Tsegay, G.; Hagoss, Y.T.; Zhang, Z.; Zhang, J.; Huangfu, H.; Xi, F.; Li, F.; Sun, E.; et al. Characterization of Anti-p54 Monoclonal Antibodies and Their Potential Use for African Swine Fever Virus Diagnosis. Pathogens 2021, 10, 178. [Google Scholar] [CrossRef]
- Wu, P.; Lowe, A.D.; Rodríguez, Y.Y.; Murgia, M.V.; Dodd, K.A.; Rowland, R.R.; Jia, W. Antigenic regions of African swine fever virus phosphoprotein P30. Transbound. Emerg. Dis. 2020, 67, 1942–1953. [Google Scholar] [CrossRef]
- Bergeron, H.C.; Glas, P.S.; Schumann, K.R. Diagnostic specificity of the African swine fever virus antibody detection enzyme-linked immunosorbent assay in feral and domestic pigs in the United States. Transbound. Emerg. Dis. 2017, 64, 1665–1668. [Google Scholar] [CrossRef]
- Heimerman, M.E.; Murgia, M.V.; Wu, P.; Lowe, A.D.; Jia, W.; Rowland, R.R. Linear epitopes in African swine fever virus p72 recognized by monoclonal antibodies prepared against baculovirus-expressed antigen. J. Vet. Diagn. Investig. 2018, 30, 406–412. [Google Scholar] [CrossRef]
- Goatley, L.C.; Dixon, L.K. Processing and localization of the african swine fever virus CD2v transmembrane protein. J. Virol. 2011, 85, 3294–3305. [Google Scholar] [CrossRef] [Green Version]
- Pérez-Núñez, D.; García-Urdiales, E.; Martínez-Bonet, M.; Nogal, M.L.; Barroso, S.; Revilla, Y.; Madrid, R. CD2v Interacts with Adaptor Protein AP-1 during African Swine Fever Infection. PLoS ONE 2015, 10, e0123714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallardo, C.; Fernández-Pinero, J.; Arias, M. African swine fever (ASF) diagnosis, an essential tool in the epidemiological investigation. Virus Res. 2019, 271, 197676. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Vizcaíno, J.M.; Mur, L. African swine fever diagnosis update. Dev. Biol. 2013, 135, 159–165. [Google Scholar] [CrossRef]
- Jorge, S.; Dellagostin, O.A. The development of veterinary vaccines: A review of traditional methods and modern biotechnology approaches. Biotechnol. Res. Innov. 2017, 1, 6–13. [Google Scholar] [CrossRef]
- Rathakrishnan, A.; Moffat, K.; Reis, A.L.; Dixon, L.K. Production of Recombinant African Swine Fever Viruses: Speeding Up the Process. Viruses 2020, 12, 615. [Google Scholar] [CrossRef]
- O’Donnell, V.; Risatti, G.R.; Holinka, L.G.; Krug, P.W.; Carlson, J.; Velazquez-Salinas, L.; Azzinaro, P.A.; Gladue, D.P.; Borca, M.V. Simultaneous Deletion of the 9GL and UK Genes from the African Swine Fever Virus Georgia 2007 Isolate Offers Increased Safety and Protection against Homologous Challenge. J. Virol. 2017, 91, e01760-16. [Google Scholar] [CrossRef] [Green Version]
- O’Donnell, V.; Holinka, L.G.; Krug, P.W.; Gladue, D.P.; Carlson, J.; Sanford, B.; Alfano, M.; Kramer, E.; Lu, Z.; Arzt, J.; et al. African Swine Fever Virus Georgia 2007 with a Deletion of Virulence-Associated Gene 9GL (B119L), when Administered at Low Doses, Leads to Virus Attenuation in Swine and Induces an Effective Protection against Homologous Challenge. J. Virol. 2015, 89, 8556–8566. [Google Scholar] [CrossRef] [Green Version]
- Sastre, P.; Gallardo, C.; Monedero, A.; Ruiz, T.; Arias, M.; Sanz, A.; Rueda, P. Development of a novel lateral flow assay for detection of African swine fever in blood. BMC Vet. Res. 2016, 12, 206. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.; Yu, W.; Xie, R.; Yang, S.; Chen, A. A strip of lateral flow gene assay using gold nanoparticles for point-of-care diagnosis of African swine fever virus in limited environment. Anal. Bioanal. Chem. 2021, 413, 4665–4672. [Google Scholar] [CrossRef]
- Pérez-Filgueira, D.M.; González-Camacho, F.; Gallardo, C.; Resino-Talaván, P.; Blanco, E.; Gómez-Casado, E.; Alonso, C.; Escribano, J.M. Optimization and validation of recombinant serological tests for African Swine Fever diagnosis based on detection of the p30 protein produced in Trichoplusia ni larvae. J. Clin. Microbiol. 2006, 44, 3114–3121. [Google Scholar] [CrossRef] [Green Version]
- Jacobson, R.H. Validation of serological assays for diagnosis of infectious diseases. Rev. Sci. et Tech. (Int. Off. Epizoot.) 1998, 17, 469–526. [Google Scholar] [CrossRef] [PubMed]
- Lv, C.; Zhao, Y.; Jiang, L.; Zhao, L.; Wu, C.; Hui, X.; Hu, X.; Shao, Z.; Xia, X.; Sun, X.; et al. Development of a Dual ELISA for the Detection of CD2v-Unexpressed Lower-Virulence Mutational ASFV. Life 2021, 11, 1214. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer | Sequence (5′–3′) | Amplicon Size (bp) |
---|---|---|---|
p54/E183L | pET-30a-p54F | AG GATATC ATG AGCAGCAGGAAGAAGAAGGCC | 399 |
pET-30a-p54R | CT CTCGAG CTACAGGCTGTTCTCCAGGTCCTTG | ||
CD2v/ EP402R | pAcHBM-CD2vF | GCGGATCCTACTGGGTGAGCTTCAACAAGACCATCATCCT | 561 |
pAcHBM-CD2vR | CGCGGCCGCTTCATGCCACTCAATCTTCTGAGCCTCGAAAATA |
Serum Samples | p54-ELISA | CD2v-ELISA | ||||||
---|---|---|---|---|---|---|---|---|
Intra-Assay | Inter-Assay | Intra-Assay | Inter-Assay | |||||
± SD | CV% | ± SD | CV% | ± SD | CV% | ± SD | CV% | |
P1 | 0.81 ± 0.02 | 2.96 | 0.94 ± 0.11 | 11.8 | 0.963 ± 0.028 | 2.89 | 0.74 ± 0.07 | 10.08 |
P2 | 0.94 ± 0.05 | 5.12 | 1.01 ± 0.07 | 7.3 | 0.937 ± 0.034 | 3.64 | 0.69 ± 0.05 | 6.87 |
P3 | 0.83 ± 0.02 | 2.46 | 0.94 ± 0.11 | 12.0 | 0.768 ± 0.025 | 3.19 | 0.66 ± 0.09 | 13.61 |
P4 | 0.83 ± 0.06 | 7.27 | 0.92 ± 0.10 | 10.9 | 0.707 ± 0.029 | 4.04 | 0.53 ± 0.06 | 10.94 |
P5 | 0.95 ± 0.05 | 5.92 | 0.96 ± 0.06 | 6.5 | 0.987 ± 0.057 | 5.73 | 0.79 ± 0.09 | 11.16 |
N1 | 0.05 ± 0.06 | 10.31 | 0.05 ± 0.03 | 5.2 | 0.049 ± 0.003 | 6.005 | 0.057 ± 0.005 | 8.95 |
N2 | 0.05 ± 0.03 | 5.34 | 0.05 ± 0.01 | 1.9 | 0.054 ± 0.003 | 5.041 | 0.054 ± 0.006 | 11.98 |
N3 | 0.05 ± 0.05 | 8.66 | 0.055 ± 0.04 | 7.9 | 0.050 ± 0.004 | 7.633 | 0.052 ± 0.004 | 6.93 |
N4 | 0.19 ± 0.01 | 5.85 | 0.194 ± 0.01 | 5.7 | 0.098 ± 0.002 | 1.830 | 0.089 ± 0.005 | 5.67 |
N5 | 0.07 ± 0.06 | 8.44 | 0.079 ± 0.08 | 10.5 | 0.076 ± 0.003 | 3.758 | 0.069 ± 0.004 | 5.88 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Fu, D.; Tesfagaber, W.; Li, F.; Chen, W.; Zhu, Y.; Sun, E.; Wang, W.; He, X.; Guo, Y.; et al. Development of an ELISA Method to Differentiate Animals Infected with Wild-Type African Swine Fever Viruses and Attenuated HLJ/18-7GD Vaccine Candidate. Viruses 2022, 14, 1731. https://doi.org/10.3390/v14081731
Wang L, Fu D, Tesfagaber W, Li F, Chen W, Zhu Y, Sun E, Wang W, He X, Guo Y, et al. Development of an ELISA Method to Differentiate Animals Infected with Wild-Type African Swine Fever Viruses and Attenuated HLJ/18-7GD Vaccine Candidate. Viruses. 2022; 14(8):1731. https://doi.org/10.3390/v14081731
Chicago/Turabian StyleWang, Lulu, Dan Fu, Weldu Tesfagaber, Fang Li, Weiye Chen, Yuanmao Zhu, Encheng Sun, Wan Wang, Xijun He, Yu Guo, and et al. 2022. "Development of an ELISA Method to Differentiate Animals Infected with Wild-Type African Swine Fever Viruses and Attenuated HLJ/18-7GD Vaccine Candidate" Viruses 14, no. 8: 1731. https://doi.org/10.3390/v14081731