1. Introduction
Host–virus interactions have been extensively studied with the goal of uncovering novel information that would help fight virus infections. In this regard, the study of restriction factors—host proteins that inhibit virus replication at specific steps of the virus life cycle—has gained momentum in recent years, since enhancing their activity represents a promising approach against virus pathogens. To reach this goal, we need to understand how viruses interact (and evolve) with such restriction factors. One of these molecules is SERINC5. SERINC5 was identified in 2015 independently by two groups as a restriction factor that blocks HIV entry and is counteracted by the virus protein Nef [
1,
2].
SERINC proteins, part of a family of multi-pass transmembrane proteins, are highly conserved among eukaryotes. However, the cellular and physiological functions of SERINCs are largely unknown. The consensus is that they participate in the incorporation of the serine amino acid into lipid membranes and that they are involved in the biosynthesis of sphingolipids and phosphatidylserine by adding serine into cellular membranes [
3]. Within the members of this family, SERINC5 and, to a lesser extent, SERINC3 were identified as restriction factors that block HIV infection at an early stage of the virus life cycle [
2,
4]. Specifically, SERINC3/5 become incorporated into budding HIV particles. Although their incorporation does not seem to affect progeny size, they significantly impair the ability of nascent virions to successfully infect a new target cell. This is due to the fact that SERINC3/5 selectively inactivate retroviral Env by: (i) altering the conformation of Env trimers, which makes them less fusogenic and more sensitive to neutralizing antibodies, and (ii) disrupting the distribution and cluster formation of Env, which inhibits the enlargement of the viral fusion pore [
2,
4,
5,
6,
7]. In addition to its impact on Env, a recent study has reported that virion-associated SERINC5 exerts a post-integration block that contributes to the infectivity defect observed on SERINC5-harboring virions [
8]. Conversely, HIV has evolved the virus protein Nef to counteract SERINC5. Nef is a multifunctional accessory protein that downregulates several membrane molecules by hijacking the cellular trafficking machinery, and these actions are critical for HIV pathogenesis [
9,
10,
11,
12,
13,
14,
15]. Using a similar mechanism, Nef prevents the incorporation of SERINC5 into nascent virions by promoting SERINC5 internalization from the plasma membrane through a Clathrin- and Adaptor Protein complex 2 (AP2)-dependent endolysosomal mechanism [
1,
16]. In addition to Nef, the Env protein of some HIV-1 strains has been reported to overcome restriction by SERINC5 without excluding it from viral particles. In this case, it seems that certain Env trimers are inherently more fusogenic, which would in turn circumvent SERINC5’s actions [
5].
Besides HIV, SERINC5 is also involved in the restriction of Simian Immunodeficiency Virus (SIV) and other retroviruses, such as Moloney Murine Leukemia Virus (MLV) and Equine Infectious Anemia Virus (EIAV). Similar to HIV, these retroviruses have evolved specific countermeasures against SERINC5, namely Nef, GlycoGag, and S2, respectively [
17,
18]. Recent studies have uncovered that SERINC5 can similarly affect virus entry for coronaviruses and influenza viruses [
19,
20]. Of note, SERINC5 has also been reported to inhibit other enveloped viruses, including Hepatitis B Virus (HBV) and Classical Swine Fever Virus (CSFV), although this restriction does not affect virus entry. In the case of HBV, SERINC5 interferes with the glycosylation of the HBV envelope glycoproteins, thereby suppressing virion production [
21]. In the case of CSFV, SERINC5 inhibits virus replication by enhancing MDA5-mediated type I interferon signaling, an important innate immune response against RNA viruses [
22]. These findings indicate that SERINC5 is a potent antiviral factor against many viruses. Therefore, a better understanding of the extent of the antiviral functions of SERINC5 is critical for the design of SERINC5-based therapeutic approaches aimed at treating virus infections.
Here, we uncovered a previously unappreciated role of SERINC5 in the restriction of non-self or ectopic DNA by limiting its transcription. While SERINC5 affects mRNA synthesis of lentiviral and plasmid DNA, it does not affect cellular genes nor the synthesis of foreign RNAs, like that of an RNA virus. Similar to its effect on virus entry, this activity of SERINC5 is counteracted by HIV and SIV Nef. Overall, these observations indicate that the roles of SERINC5 in host defense extend beyond viruses and that it can also protect from multiple DNA pathogens.
2. Materials and Methods
2.1. Cells and Culture Conditions
HEK293T and VeroE6 cells were purchased from ATCC (#CRL-11268 and #CRL-1586, respectively) and cultured in complete medium (Dulbecco’s Modified Eagle Medium (DMEM, ThermoFisher Scientific, Waltham, MA, USA #11885-084), supplemented with 10% Fetal Bovine Serum (FBS, ThermoFisher Scientific, #26140-079), 1% Penicillin–Streptomycin (ThermoFisher Scientific, #15070-063), and 1% L-glutamine (ThermoFisher Scientific, #25030-081)). JurkatTAg SERINC5 knockout cells were provided by Dr. Heinrich Gottlinger (University of Massachusetts Medical School). Parental JurkatTAg cells were engineered in the Evans’ laboratory to harbor an HA tag on the fourth extracellular loop of the endogenous SERINC5 protein. Cells were serially diluted after CRISPR editing for clonal selection and expansion, and the presence of the HA tag on both SERINC5 chromosome copies was verified. These cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 Medium (ThermoFisher Scientific, #11875-093), supplemented with 10% FBS, 1% Penicillin–Streptomycin, 1% L-glutamine, and 25 nM HEPES (ThermoFisher Scientific, #15630-080). HEK293T cells stably expressing GFP and HEK293T-ACE2 cells stably expressing empty vector (pQCXIP) or SERINC1 were grown in complete medium with 1 μg/mL of puromycin (ThermoFisher Scientific, #A1113803). HEK293T-ACE2-SERINC5 stable cells were cultured in complete medium with 100 μg/mL of Hygromycin B (Sigma-Aldrich, St. Louis, MO, USA #H0654).
2.2. Plasmid Constructs
SERINC constructs. The plasmid encoding human SERINC1 (pCMV6-SERINC1-Myc-Flag) harbors a Myc-Flag tag in its C-terminus and was purchased from OriGene, Rockville, MD, USA (#RC206001). SERINC1 was subcloned from that plasmid into the retroviral vector pQCXIP (Clontech, Mountain View, CA, USA #631516) for the generation of HEK293T-ACE2 cells stably expressing SERINC1. The retroviral vector encoding human SERINC5 (pQCXIH-SERINC5-HA) harbors an HA tag in its fourth extracellular loop and was engineered in the Evans’ lab (University of Wisconsin-Madison).
GFP construct. The pCGCG expression vector harboring EGFP was a gift from Dr. Jacek Skowronski, Case Western Reserve University, Cleveland, OH.
Lentiviral constructs. HIV-1 pNL4-3 (#ARP-114) and NL4-3Δnef (#ARP-12755) were obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID, NIH, Manassas, VA, USA from Dr. Malcolm Martin and Dr. Olivier Schwartz, respectively. SIVmac239 and its nef-deleted mutant were a gift from Dr. Ronald C. Desrosiers, University of Miami. The lentiviral vector harboring GFP, pGFP-C-Lenti, was purchased from OriGene (#TR30021).
Plasmids for the generation of viral-like particles (VLPs). To generate retroviral-like particles, the Addgene plasmid #14887 (Watertown, MA, USA), which encodes for the Moloney Murine Leukemia Virus (MLV) Gag-Pol polyprotein, was used. The plasmid was deposited by Dr. Tannishtha Reya [
23]. To generate lentiviral-like particles, the lentiviral packaging construct psPAX2 (NIH HIV Reagent Program, #ARP-11348) was used. The expression vector coding for the envelope glycoprotein of VSV, pMD2-G (Addgene plasmid #12259), was deposited by Dr. Didier Trono.
Transient transfection assays. Here, 106 HEK293T cells were seeded in 6-well plates. 24 h later, cells were co-transfected with 1500 ng of proviral DNA plasmids (SIV or HIV) and 500 ng of plasmids coding for SERINC1/5. In the case of titration assays, cells were transfected with 1500 ng of proviral DNA and 63–1000 ng of SERINC constructs. Differences in the total DNA amount were offset by adding an empty vector.
2.3. Lentiviruses, Retroviral-like Particles, and Lentiviral-like Particle Preparation
Lentiviruses and VLPs. Lentiviruses and virus-like particles were propagated at the Serra-Moreno biosafety level 2+ (BSL2+) lab following the approved standard operating procedures.
Lentivirus stock production. Here, 5 × 106 HEK293T cells were seeded in 10 cm2 dishes. 24 h later, cells were transfected with 5 μg of HIV-1 pNL4-3 or NL4-3Δnef. 48 h later, the supernatants were collected, and debris was removed by centrifugation for 10 min at 931× g. Next, the supernatants were aliquoted in 1 mL cryovials and stored at −80 °C.
Production of VLPs harboring genes of interest (pQCXIP, GFP, SERINC1, and SERINC5). In order to transduce cells with genes of interest, retroviral- or lentiviral-like particles were produced. For this, 5 × 106 HEK293T cells were seeded in 10 cm2 dishes. 24 h later, cells were transfected with 3.75 μg of a packaging plasmid (either MLV Gag-Pol for retroviral-like particles or psPAX2 for lentiviral-like particles), 1.25 μg of the VSV-G-expressing plasmid, and 5 μg of a retroviral or lentiviral plasmid encoding the gene of interest. 48 h later, the supernatant was collected, debris was removed by centrifugation for 10 min at 931× g, and the supernatant was aliquoted in 1 mL cryovials, which were later stored at −80 °C.
2.4. Virus Infection and Transduction Assays
HIV. All HIV infections and VLP transduction experiments were performed at the Serra-Moreno BSL2+ lab, following the approved standard operating procedures. 100 ng of p24 equivalents of HIV-1 NL4-3 or NL4-3Δnef were spinoculated into 106 JurkatTAg SERINC5-KO or SERINC5 HA cells at 1650× g at 4 °C for 1 h to synchronize the infections. Cells were then washed, resuspended in complete medium, seeded in 24-well plates, and incubated at 37 °C. 16 h post-infection, the supernatants were collected to assess virion production by ELISA, and cells were harvested for western blot and RT-qPCR analyses.
Transduction. To generate cells stably expressing genes of interest, 3 × 106 HEK293T or HEK293T-ACE2 cells were seeded in T25 flasks. 24 h later, cells were infected with 1 mL of stock pQCXIP, GFP, SERINC1, or SERINC5 VLPs for 2 h at 37 °C. One day post-transduction, cells were cultured in complete medium with 1 μg/mL of puromycin or 100 μg/mL of Hygromycin B. The stable cell lines were verified after 2 weeks of antibiotic selection by western blot and flow cytometry.
SARS-CoV-2. All SARS-CoV-2 infection experiments were performed at the URMC BSL3 laboratory following the approved standard operating procedures. Here, 106 HEK293T-ACE2 cells stably expressing an empty vector (pQCXIP), SERINC1, or SERINC5 were seeded in 6-well plates. 24 h later, cells were infected with SARS-CoV-2 Hong Kong (BEI, #NR-52282, Manassas, VA, USA) at MOI (Multiplicity Of Infection) of 1. As controls, we included non-treated cells (NT) and mock-infected cells, which consisted of VLPs harboring GFP. One hour post-infection, cells were washed, and fresh medium was added. Then, 8, 24, and 48 h post-infection, supernatants were collected to assess infectious particle production, and cells were harvested for western blot and RT-qPCR analyses.
2.5. ELISA
HIV-1 NL4-3 and NL4-3 Δnef virus stocks and culture supernatants, obtained from either HEK293T cells or through infectivity assays in JurkatTAg cells, were titered by ELISA (HIV-1 p24 antigen-capture assay, ABL inc., Rockville, MD, USA, #5421), following the manufacturer’s instructions. Similarly, SIVmac239 and SIVΔnef culture supernatants obtained from HEK293T cells were titered by ELISA (SIV p27 antigen-capture assay, ABL inc., #5436), following the manufacturer’s instructions. Differences in virus particle release between SERINC5+ and SERINC5− cells were expressed as the percentage of virion production, in which particle production from SERINC5− cells was considered as the maximum release (100%).
2.6. Median Tissue Culture Infectious Dose Assay (TCID50)
For this, 2.5 × 10
4 VeroE6 cells were seeded in 96-well plates. The supernatants recovered from SARS-CoV-2 infections were serially diluted (10
−1 to 10
−9) in DMEM with 3% FBS. Cell media were removed, and cells were infected with 100 μL of virus dilutions in six replicates. Infected cells were incubated at 37 °C. Three days post-infection, the cytopathic effect (CPE) on each well was determined by optical microscopy. The TCID
50 of viruses was calculated using the Spearman–Kärber method [
24].
2.7. Western Blot
Cells subjected to western blot analyses were washed with DPBS (ThermoFisher Scientific, #14190-144) and harvested by adding lysis IP buffer (ThermoFisher Scientific, #87787). Cells were then kept on ice for 30 min. Cell lysate was cleared by centrifugation at 16,000×
g at 4 °C for 8 min. Next, the supernatants were mixed with 2× SDS sample buffer (Sigma-Aldrich, #S3401), and samples were boiled for 10 min on a heat block. In case of SARS-CoV-2-infected cells, lysis buffer was supplemented with 1% Triton X-100 (Sigma-Aldrich, #X100). Proteins were separated using 12% SDS-PAGE polyacrylamide gels. Proteins were then transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Hercules, CA, USA #1620264) using a Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were incubated for 1 h with 5% non-fat milk (Bio-Rad, #1706404XTU) at room temperature, followed by an overnight incubation with the primary antibodies (
Table 1) at 4 °C. Next, membranes were washed 3 times with PBS-tween (Sigma-Aldrich, #P3563) followed by 1 h incubation with the secondary antibodies (
Table 1) at room temperature. Subsequently, three additional washes with PBS-tween were performed before imaging the membranes. Finally, membranes were developed by adding the SuperSignal West Femto maximum-sensitivity substrate (ThermoFisher Scientific, #34095), and proteins were visualized in a ChemiDoc imaging system (Bio-Rad). The expression level of proteins was quantified using ChemiDoc Image Lab software, version 6.1 (Bio-Rad). Each experiment was repeated three independent times.
2.8. Fluorescence Microscopy
To visualize SERINC5 and SERINC1, 6 × 10
5 HeLa cells were seeded in 6-well plates. 24 h later, cells were co-transfected with 1000 ng of SERINC1-Myc-Flag and SERINC5-HA constructs. The following day, 3 × 10
4 cells were plated onto tissue culture-treated 8-well microscopy slides. 48 h post-transfection, cells were washed with ice-cold DPBS three times. Next, cells were fixed and permeabilized by adding 50:50 acetone:methanol (Sigma-Aldrich, #270725 and #34860) for 10 min at −20 °C. Cells were then blocked with antibody diluent solution (2% fish skin gelatin (Sigma-Aldrich) + 0.1% Triton X-100 (Sigma-Aldrich) + 10% goat serum (ThermoFisher Scientific, #67765) in 1 × DPBS) for 30 min at room temperature, followed by an incubation of 1 h with a primary antibody cocktail at room temperature (anti-Myc-tag rabbit polyclonal at 1:200 and an anti-HA-tag mouse IgG
1 at 1:200, see
Table 1). Next, cells were washed with wash buffer (2% fish skin gelatin + 0.1% Triton X-100 in 1 × DPBS) three times and incubated with a secondary antibody cocktail (Alexa-488 anti-mouse IgG
1 and Alexa-568 anti-rabbit IgG, both at 1:500;
Table 1) for 30 min. After washing 3 times, cells were incubated with DAPI at a 1:5000 dilution (
Table 1) for 5 min to visualize the nuclei. Finally, the slides were washed and mounted using anti-quenching mounting medium (Vector Laboratories, Newark, CA, USA #3304770) and they were visualized using a BioTek Lionheart FX automated microscope using 20× and 40× objectives and filter cubes of 377, 469, and 586 nm. Images were processed and analyzed using the Gen5 software version 3.14 (BioTek Instruments, Winooski, VT, USA).
2.9. RT-qPCR Assays
RNA extraction and cDNA synthesis. Cells with different treatments (transfection, infection, drug treatments) were harvested, washed with DPBS, and total RNA was extracted using the Qiagen RNeasy Mini-kit (Germantown, MD, USA #74004), following the manufacturer’s instructions. In the case of cells infected with SARS-CoV-2, total RNA was extracted by adding 1 mL of Trizol (ThermoFisher Scientific, #15596018) per well. Then, 200 μL of chloroform (Spectrum Chemical, New Brunswick, NJ, USA #C1220) was added, and samples were centrifuged at 12,000× g for 15 min at 4 °C to create three phases of separation: a lower red phenol-chloroform phase, an interphase, and a transparent upper aqueous phase. The aqueous phase was collected and mixed with 500 μL of isopropyl alcohol (Sigma-Aldrich, #W292907) to precipitate RNA. RNA was then washed with 75% ethanol and eluted in RNase-free water (ThermoFisher Scientific, #10977-025). The concentration and A260/A280 ratio of RNA were measured by a NanoDrop (ThermoFisher Scientific). Next, 1 μg of purified RNA was converted into cDNA using the iScript cDNA synthesis kit (Bio-Rad, #1725037), following the manufacturer’s instructions.
qPCR. The mRNA levels of genes of interest were measured by the SYBR green-based real-time qPCR method. For each sample, different controls, including RNA quality (RQ1 and RQ2), genomic DNA contamination (gDNA), and housekeeping genes (
GAPDH,
Calreticulin), were measured by qPCR. In each PCR reaction, 10 μL of 2× SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, #1725272), 0.2 μL of cDNA, 8.8 μL of RNase-free water (ThermoFisher Scientific, #10977-015), and 1 μL of the primer pair for the target gene or control were included. The amplification program was as follows: 2 min at 95 °C for initial activation, 40 cycles at 95 °C for 5 s, 60 °C for 30 s, and then melting analyses from 65 to 95 °C (0.5 °C increments). Each sample was analyzed by qPCR in two technical replicates on a CFX-96 BioRad instrument. Assays were performed three independent times for each experimental condition. The following qPCR primers were purchased from BioRad: Human Calreticulin (#qHsaCID0016904), Human GAPDH (#qHsaCED0038674), Human gDNA (#qHsaCtlD0001004), Human LC3B (#qHsaCED0038576), Human RQ1/RQ2 (#qHsaCtlD0001002), and Human SERINC1 (#qHsaCID0016529). Additional primers for qPCR were synthesized from Integrated DNA Technologies (Coralville, IA, USA): GFP (FW: 5′CAAACTGCCTGTTCCATGGC3′, RV: 5′CCTTCGGGCATGACACTCTT3′), SARS-CoV-2 NSP6 (FW: 5′ATGGTGCTAGGAGAGTGTGG3′, RV: 5′AGAGCCCACATGGAAATGGC3′), SARS-CoV-2 RdRp (FW: 5′AATAGAGCTCGCACCGTAGC3′, RV: 5′CATGTTGTGCCAACCACCAT3′), HIV NL4-3 Gag (FW: 5′TATCAGAAGGAGCCACCCCA3′, RV: 5′CCCATTCTGCAGCTTCCTCA3′), HIV NL4-3 Tat (FW: 5′GCGACGAAGAGCTCATCAGA3′, RV: 5′CTATTCCTTCGGGCCTGTCG3′), HIV NL4-3 splicing donor site 1 (FW: 5′CAAGAGGCGAGGGGCGGCGA3′), HIV NL4-3 splicing accepting site 1 (RV: 5′CTTGGCACTACTTTTATGT3′), HIV NL4-3 splicing accepting site 2 (RV: 5′CTAGGACTAACTATACGT3′), HIV NL4-3 splicing accepting site 3 (RV: 5′ACTTCCTGGATGCTTCCAG3′), HIV NL4-3 splicing accepting site 5 (RV: 5′ACTATTATAGGTTGCATTA3′), and Human SERINC5 (FW: 5′ATCGAGTTCTGACGCTCTGC3′, RV: 5′GCTCTTCAGTGTCCTCTCCAC3′). Differences in expression were calculated as the fold-change over SERINC1, vector, or SERINC5-KO cells. A fold-change of >2.0 or <0.5 relative to the control samples was considered biologically relevant [
25].
2.10. DNA Isolation
Here, 5 × 105 HEK293T cells were seeded in 6-well plates. 24 h later, cells were co-transfected with 1500 ng of pCGCG and 500 ng of plasmids encoding either an empty vector, SERINC1-Myc-Flag, or SERINC5-HA. Cells were harvested at 4, 24, 48, and 96 h post-transfection. DNA was isolated at each time point using a Genomic DNA Extraction Kit (Qiagen, #69504), following the manufacturer’s instructions. The concentration and A260/A280 ratios of the DNA samples were measured by a NanoDrop (ThermoFisher Scientific). Then, 50 ng of isolated DNA were amplified by qPCR to assess for the DNA levels of SERINC1/5, host input DNA, and GFP plasmids, using the primers and procedures described above.
Integrated HIV DNA. qPCR analyses were also performed to measure the relative levels of integrated HIV DNA. Here, 10
6 JurkatTAg SERINC5 knockout cells, and parental JurkatTAg cells harboring an HA tag on the fourth extracellular loop of endogenous SERINC5, were spinoculated with 500 ng of p24 equivalents of NL4-3 Δ
nef at 1650×
g and 4 °C for 1 h to synchronize the infections. Cells were then washed, resuspended in complete medium, seeded in 24-well plates, and incubated at 37 °C. 16 h later, cells were harvested, and total DNA was extracted using a Genomic DNA Extraction Kit (Qiagen, #69504). Integrated HIV DNA was measured by Alu-qPCR through a 2-step PCR reaction. First, 50 ng of total DNA was amplified using Alu-FW (5′GCCTCCCAAAGTGCTGGGATTACAG3′) and Gag-RV (5′GTTCCTGCTATGTCACTTCC3′) primers. Next, 2 μL of the purified PCR product were amplified by qPCR using R-FW (5′TTAAGCCTCAATAAAGCTTGCC3′) and U5-RV (5′GTTCGGGCGCCACTGCTAGA3′) primers, as described previously [
26]. To ensure a comparable DNA input across samples, qPCR primers against host genomic DNA and GAPDH were used (see
Section 2.8). To examine whether differences in DNA integration are caused by changes in infectivity between parental and SERINC5-KO cells, additional infections were performed. Total RNA was harvested at time zero (right after spinoculation, to measure the degree of attached virions), and 2 h post-infection (to measure viral uptake). The amounts of HIV genomic RNA were measured by RT-qPCR using the NL4-3 Gag FW and RV primers described in
Section 2.8.
2.11. Drug Treatments
To measure the impact of SERINC5 on HIV protein degradation, the lysosomal inhibitor Hydroxychloroquine (60 μM; Sigma-Aldrich, #H0915) and the proteasomal inhibitor ALLN (25 μM; Sigma-Aldrich, #208719) were added 18 h before samples were collected. Any fluctuations in host and virus protein expression were measured by western blot.
To examine the effect of SERINC5 on RNA degradation, the transcriptional inhibitor Actinomycin D (5 μg/mL; Sigma-Aldrich, #A9415) was added 24 h post-transfection. Cells were harvested at 0, 4, 8, and 24 h after adding Actinomycin D, and the RNA levels of GFP were measured by RT-qPCR, as described above.
As controls for the HIV integration assays, parental and SERINC5-KO Jurkat TAg cells were treated with Raltegravir (an integrase inhibitor; HIV Reagent Program # 11680; 260 nM) and Efavirenz (a non-nucleoside reverse transcriptase inhibitor; HIV Reagent Program #4624; 40 μM).
2.12. Statistical Analysis
Statistical calculations were performed using the two-tailed, unpaired Student’s T test analysis. All statistical analyses were performed using GraphPad Prism version 10. p values ≤ 0.05 were considered statistically significant.
4. Discussion
SERINC5 was identified in 2015 as an antiviral factor against retroviruses. Specifically, SERINC5 becomes incorporated into nascent virions and blocks their ability to infect new target cells. However, this effect is counteracted by HIV and SIV Nef [
1,
2]. Besides its impact on virus entry, two independent studies recently found that SERINC5 also inhibits virus gene expression and virion production in viruses unrelated to retroviruses, such as HBV and CSFV [
21,
22]. To evaluate if SERINC5 exerts similar antiviral actions on lentiviruses, we investigated the effect of SERINC5 on HIV and SIV protein levels and virion release. Similar to the CSFV study [
22], we found that SERINC5 affects the expression of several lentiviral proteins, including Gag, which consequently reduces virion production. However, SERINC1, a protein with similar biological functions as SERINC5, does not reduce virus protein expression. Notably, as for its effect on virus entry, this activity of SERINC5 is counteracted by Nef, since the impact on virus protein levels and virion production is magnified in
nef-deleted viruses, probably because SERINC5 was downregulated in Nef-expressing cells. However, it must be noted that these findings were observed under conditions of overexpression, which poses limitations to our study, since these effects could be observable only at high levels of SERINC5. To address this limitation, we examined this activity of SERINC5 in a more physiologically relevant system: using the endogenous levels of the protein and under conditions of infection. For this, we chose JurkatTAg cells. JurkatTAg cells deficient in SERINC5, as well as parental JurkatTAgs in which endogenous SERINC5 was tagged with HA, were infected with HIV-1 NL4-3 and NL4-3Δ
nef. In line with our observations in transfected cells, virus proteins and virion production were impacted in SERINC5
+ cells, and this effect was partly counteracted in the presence of Nef. To rule out if the effect of SERINC5 is specific against viruses or if it similarly affects host genes, we studied the effect of SERINC5 on cellular proteins that share a similar subcellular distribution to that of SERINC5: plasma membrane (IFNR1 and TNFR) and ER (Calreticulin). No changes in cellular gene expression were detected, even when fluctuations were investigated over a four-day period. Hence, these observations indicate that SERINC5 affects virus but not host protein expression, and because SERINC5 significantly downregulates Gag, virion production is also severely impacted.
To uncover how SERINC5 reduces virus protein levels, we investigated whether SERINC5 promotes their proteasomal or lysosomal degradation using inhibitors for these pathways. Whereas an enhancement in SERINC5 expression was found under these conditions, which likely reflects the natural turnover of the protein through these two pathways, no restoration in virus protein levels was detected. On the contrary, due to the enhancement in SERINC5 expression, a further reduction in HIV proteins was observed. Since these assays exclude a role for SERINC5 in promoting protein degradation, we next examined if SERINC5 affects gene expression at the RNA level. Remarkably, we found a significant reduction in HIV RNAs, similarly affecting all splicing variants of the virus. Since the degree of SERINC5-mediated reduction of mRNAs is similar among HIV splicing forms (including un-spliced, single-spliced, and multiple-spliced transcripts) and
GFP transcripts, which do not require splicing, we excluded splicing as a potential process impacted by SERINC5. A defect in RNA levels could be caused by a defect in transcription, but it could also be due to an impairment in the export of these transcripts to the cytosol. However, we also ruled this option out since HIV un-spliced, single-spliced, and multiple-spliced mRNAs, which use different mechanisms for RNA transport [
37,
38,
39], were all similarly downregulated by SERINC5. While un-spliced and single-spliced HIV RNAs use the Rev-dependent export pathway, multiple-spliced RNAs and
GFP transcripts use a Rev-independent pathway [
38,
39,
40,
41]. Notably, when we examined if the effect of SERINC5 could also be exerted on host mRNAs over time, we noticed that the mRNA levels for ectopically expressed
SERINC5 were impacted by its own expression. This made us hypothesize that SERINC5 targets non-self-DNA. This was corroborated by measuring fluctuations in ectopically expressed
GFP in the presence and absence of SERINC5. To determine if SERINC5’s effect on RNA is specifically applied on non-self-DNA or if it could also be exercised upon non-self-RNA, we infected cells with SARS-CoV-2, a virus with a positive-sense, single-stranded RNA genome that contains signatures of mRNA [
42,
43,
44,
45]. Remarkably, SERINC5 did not cause major impacts on SARS-CoV-2 RNA, proteins, or infectious particle production, suggesting that either: (i) SARS-CoV-2 is equipped to counteract SERINC5, (ii) SERINC5 has no effects on ectopic RNA, or (iii) SERINC5 affects the synthesis of RNA that requires the cellular machinery. Recent studies have revealed that SARS-CoV-2 counteracts SERINC5 through two mechanisms. First, the virus uses ORF7a to prevent SERINC5 incorporation into nascent particles [
19]. Second, SARS-CoV-2 generates small viral RNAs (svRNAs)—which work in an analogous manner to miRNAs—to decrease SERINC5 expression [
46]. Hence, the lack of impact of SERINC5 on SARS-CoV-2 RNA and proteins may be due to these countermeasures. However, even when a virus can counteract a restriction factor, a partial impact on the step targeted by such factor is normally observed compared to cells that are deficient in its expression, and this would have become more evident here, particularly because SERINC5 is present in cells prior to SARS-CoV-2 infection and the expression of SERINC5 antagonists. Hence, the most likely explanation for our findings with SARS-CoV-2 is that either SERINC5 causes no defects in ectopic RNA, or that SERINC5 only impacts the synthesis of ectopic RNA that uses the cellular machinery (SARS-CoV-2 replicates in the cytosol using its own RNA-dependent RNA polymerase). Future experiments will test these two potential scenarios.
Since our results revealed that SERINC5 attacks non-self plasmid DNA, but our initial observations were made in the context of HIV/SIV (both transfection and infection), we investigated if SERINC5 could also attack proviral DNA that had not yet been integrated into the cell genome, which would be consistent with our observations for HIV/SIV transfections. For this, we examined differences in the mRNA levels of GFP that was delivered to cells by transduction or after transduction and selection of GFP-expressing cells. These two settings represent two different steps of a retroviral life cycle. In the first one, we assessed the overall impact of SERINC5 on a gene that needs to be reverse transcribed before integration and expression, while in the second scenario we studied if SERINC5 could affect the expression of that gene once it has been integrated into the human genome (and no longer considered non-self). Our assays uncovered that GFP expression was delayed after viral transduction in SERINC5-expressing cells, while in SERINC1-expressing cells the GFP transcripts tended to increase over time. In contrast, SERINC5 had no negative impact on the GFP mRNAs produced after proviral integration. Hence, these findings corroborate that SERINC5, or a SERINC5 effector, can discriminate between self- and non-self-DNA.
To investigate how SERINC5 achieves the silencing of non-self-DNA, we explored the following hypotheses: (i) SERINC5 reduces DNA levels, (ii) SERINC5 increases RNA turnover, (iii) SERINC5 inhibits transcription, or (iv) SERINC5 reduces DNA availability. No significant changes in the DNA counts of a GFP plasmid were observed in SERINC5
+ and SERINC5
− cells. Similarly, we did not find that SERINC5 accelerates RNA turnover of
GFP transcripts, since in the presence of Actinomycin D, a transcriptional inhibitor [
47], the fold-change of RNA yields was similar regardless of SERINC5 expression. We then reasoned that SERINC5 must affect transcription by either preventing the recruitment of the RNA Pol II and related transcription factors, by epigenetically silencing non-self-DNA, or by altering DNA transport/availability. To assess if SERINC5 alters DNA availability, we assessed differences in the amounts of HIV DNA integrated in the cellular genome by Alu-qPCR [
26] in SERINC5-deficient and SERINC5-expressing cells. Remarkably, SERINC5 caused a 5-fold reduction in integrated DNA, which was not caused by a defect in virus infectivity or uptake. Therefore, SERINC5 impacts non-self-DNA availability and, in turn, its transcription.
However, several questions remain. How does SERINC5 affect the availability of non-self-DNA? Does SERINC5 work as a sensor by interacting with non-self-DNA? Does SERINC5 affect the nuclear import of ectopic DNA? Or is this effect part of the antiviral activity that SERINC5 triggers through its association with MDA5 [
22]? We hypothesize that the actions of SERINC5 on non-self-DNA are indirect. While the role of SERINC5 in triggering an antiviral state through an interaction with MDA5 has been reported [
22], and would be consistent with our observations here, our data suggest that the response is specific for DNA. In the study by Li and collaborators, the authors revealed that the SERINC5–MDA5 association triggers type I IFN signaling, even in the absence of an infection. Therefore, if cells become infected, this
milieu favors an antiviral state in which thousands of ISGs are already induced. Some of these effectors are DNA sensors (i.e., cGAS), which would be expressed over basal levels, and thus, more prone to detect foreign DNA and silence it as a consequence of downstream effectors. However, one would argue that this antiviral environment would similarly affect expression from non-self-RNA, as the authors reported for CSFV [
22]. In our study, we did not see such effect on SARS-CoV-2. Even when SARS-CoV-2 is equipped to counteract SERINC5 [
19,
46], we would expect a defect in replication since SERINC5 was already present in our cells prior to the infection and the subsequent synthesis of ORF7a and svRNAs—the SERINC5 antagonists in SARS-CoV-2. Thus, there must be a more specific mechanism causing the silencing of non-self-DNA, although MDA5 signaling might have an additive effect.
Several lines of evidence point to SERINC5 localizing at the nuclear envelope [
29,
48], as well as the plasma membrane and ER. Our fluorescence microscopy assays have confirmed that SERINC5 can be found at perinuclear locations. This subcellular distribution is consistent with the MS proteomic study by Li and colleagues [
22], in which several nuclear proteins appeared in the list of hits that physically interact with SERINC5. Among these hits, the authors found nucleosome assembly proteins, nuclear cap-binding proteins, Pol II subunit L, and TRIM28. We hypothesize that SERINC5 could impact the nuclear transport of these cellular factors or even non-self-DNA. In support of this hypothesis, a recent study has revealed that SERINC3/5 proteins cause defects in membrane asymmetry [
49], which could be responsible for fusion defects at the virus entry step. Since SERINC5 is also present at the nuclear envelope, alterations of membrane asymmetry at the nuclear membrane could similarly affect nuclear transport. Alternatively, SERINC5 could induce a signaling cascade that predisposes the cell to silence ectopic DNA and/or might promote repressive epigenetic marks in non-self-DNA, which not only affects their expression but could also alter the integration efficiency of HIV proviral DNA into the host genome, consequently impacting HIV DNA availability [
50]. Future work will test these hypotheses to uncover the molecular mechanism by which SERINC5 silences non-self-DNA.
Remarkably, while we were finishing this work, another study reported that SERINC5 restricts HIV at a post-integration step, causing a significant reduction in HIV gene expression in myeloid cells [
8]. While that study reported that SERINC5 on the surface of incoming particles is responsible for triggering this phenotype, here, we report that SERINC5 expressed in target cells can impact HIV transcription and that this block is exerted at a pre-integration step or during the integration step. Still, there may be commonalities between that report and the phenotype we are describing here, which reinforces the notion that we are only starting to understand SERINC5 actions in host defense.