Next Article in Journal
MicroRNA750-3p Targets Processing of Precursor 7 to Suppress Rice Black-Streaked Dwarf Virus Propagation in Vector Laodelphax striatellus
Previous Article in Journal
Viruses of Apple Are Seedborne but Likely Not Vertically Transmitted
Previous Article in Special Issue
Transcriptome Dynamics in Triticum aestivum Genotypes Associated with Resistance against the Wheat Dwarf Virus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 16
Issue 1
10.3390/v16010096
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Distribution of Wheat-Infecting Viruses and Genetic Variability of Wheat Streak Mosaic Virus and Barley Stripe Mosaic Virus in Kazakhstan

by
Anastasiya Kapytina
1,
Mariya Kolchenko
1,
Nazym Kerimbek
1,2,
Alexandr S. Pozharskiy
1,
Gulnaz Nizamdinova
1,
Aisha Taskuzhina
1,2,
Kamila Adilbayeva
1,
Marina Khusnitdinova
1,
Malika Amidullayeva
1,
Ruslan Moisseyev
1,2,
Zulfiya Kachiyeva
1,3 and
Dilyara Gritsenko
1,*
1
Laboratory of Molecular Biology, Institute of Plant Biology and Biotechnology, Almaty 050040, Kazakhstan
2
Department of Molecular Biology and Genetics, Al Farabi Kazakh National University, Almaty 050040, Kazakhstan
3
Research Institute of Applied and Fundamental Medicine, Kazakh National Medical University, Almaty 050000, Kazakhstan
*
Author to whom correspondence should be addressed.
Viruses 2024, 16(1), 96; https://doi.org/10.3390/v16010096
Submission received: 29 November 2023 / Revised: 29 December 2023 / Accepted: 4 January 2024 / Published: 8 January 2024
(This article belongs to the Special Issue Cereal Virus Diseases)
Browse Figures
Review Reports Versions Notes

Abstract

:
Wheat is an essential cereal crop for the economy and food safety of Kazakhstan. In the present work, a screening of wheat and barley from different regions of Kazakhstan was conducted using newly developed specific primers for reverse transcription PCR and loop-mediated isothermal amplification (LAMP) assays. In total, 82 and 19 of 256 samples of wheat and barley tested positive for wheat streak mosaic virus (WSMV) and barley stripe mosaic virus (BSMV), respectively. A phylogenetic analysis using two independent methods revealed that most of the analyzed isolates had a European origin. Molecular data on the distribution and diversity of cereal viruses in Kazakhstan were obtained for the first time and will help lay a foundation for the implementation of genetics and genomics in wheat phyto-epidemiology in the country.

1. Introduction

Wheat (Triticum aestivum L.) is a crop essential to the world in general and Kazakhstan in particular, where it is important both for export and domestic consumption [1]. In 2021, its harvest area reached 12.7 million hectares, with an average yield of 1.1 tons per hectare, resulting in a total production of 14 million tons of grain [2]. Plant viruses pose a significant threat because their spread is difficult and costly to control, and there is no reliable treatment aside from the total eradication of suspected vectors and infected plants [3]. Viruses of special importance to wheat include barley stripe mosaic virus (BSMV), wheat streak mosaic virus (WSMV), triticum mosaic virus (TriMV), and Emaravirus tritici (previously HPWMoV) [4,5,6]. BSMV and wheat streak mosaic (WSM) complex, comprising the latter three viruses, have similar symptoms, such as a mosaic pattern of yellow or light green stripes running parallel to the veins of the infected leaves (Figure 1B), and their combined infection results in disease synergism detectable via increased titers of all viruses [7]. Grain yield is shown to decline exponentially from WSM infections [8], and some outbreaks lead to a total crop failure [9]. Wheat dwarf virus, which is currently gaining prominence in Europe, can also cause streak-like leaf chlorosis [10], but the dwarfism associated with it has not been reported in Kazakhstan or its neighboring regions.
Barley stripe mosaic virus (BSMV), belonging to the genus Hordeivirus, family Virgaviridae, can infect barley, wheat, and oats [11,12,13]. Its genome consists of three positive-sense single-stranded RNA subunits, RNAα, RNAβ, and RNAγ, collectively encoding seven polypeptides: αa, βa (CP), ßb (TGB1), ßc (TGB3), ßd (TGB2), γa, and γb [14,15,16]. The latter, cysteine-rich 17 kDa γb protein, tends to accumulate during the BSMV infection cycle and plays a pivotal role in pathogenesis [14,17], systemic movement [18], and silencing suppression [19,20]. BSMV has no natural transmitting vectors and is distributed via pollen or seeds [21]. Its uncontrolled spread may lead to up to 75% yield losses [22,23], but it can be prevented through the use of certified virus-free planting material [12].
Wheat streak mosaic virus (WSMV), of the genus Tritimovirus, family Potyviridae, is a highly destructive pathogen affecting a wide range of cereal crops and significantly impacting worldwide grain production [6]. It has a rod-shaped virion containing a ssRNA (+) genome of 9.3–9.4 kb, which has one open reading frame and encodes a large polypeptide from which 10 mature proteins are cleaved (P1, HC-Pro, P3, 6K1, CI, 6K2, VPg, NIa, NIb, and CP) [24,25,26]. Among them are the nuclear inclusion b cistron (NIb) protein (57 kDa), a replicase strongly conserved among potyviruses [27,28], and the coat protein (CP, 37 kDa), which, besides virion formation, is involved in cell-to-cell movement via its C-terminal aspartic acid residues [6,29]. WSMV has been detected in all major grain exporter regions, including the USA [30], Mexico [31], Argentina [32], Russia [33], Iran [34,35], and Australia [36,37], and has the potential to jeopardize their production rates.
Triticum mosaic virus (TriMV) is a ssRNA (+) virus with a genome of about 10.2 kb, which is translated into a single polyprotein of approximately 350 kDa [27,38,39], which is cleaved into several proteins characteristic for the Potyviridae family that show functional similarity to those of WSMV [40,41]. TriMV is mostly found in co-infection with WSMV, where their synergetic interaction leads to increased virus titers and yield losses [42,43].
HPWMoV (Emaravirus tritici [44], previously High Plains wheat mosaic emaravirus) has an octopartite, ssRNA (−) genome that is enveloped by a 32 kDa nucleocapsid (NC) encoded by RNA3 [45,46,47]. Its RNA1 and RNA2 encode an RNA-dependent RNA polymerase (RdRp) and a glycoprotein precursor protein, respectively, and P4-P6 are homologous to other Emaravirus proteins, unlike the gene products of RNA7 and RNA8 [45]. HPWMoV not only causes significant losses in the USA [48], but also infects wheat crops in Europe [49] and Australia [50].
The natural vector for WSMV, TriMV, and HPWMoV is Aceria tosichella Keifer [51,52]. The three viruses can be transmitted either individually or in various combinations, with yield losses exacerbated by co-infection [42]. Studies of wheat fields in the Great Plains have also shown that WSMV and HPWMoV are primarily detected as single infections, while TriMV is mostly found together with WSMV [53], and even collective triple infections are not uncommon [48]. Seed transmission is less prominent for the WSM complex, with Jones et al. citing 0.5% to 1.5% [54], while a recent study found WSMV in 13% of seeds from infected susceptible cultivars [55].
The detection of WSMV and BSMV is commonly conducted via commercial serological kits based on triple or double antibody sandwich ELISA, or molecular methods. Multiplex RT-PCR has been successfully applied for the screening and quantification of WSMV and TriMV [56,57], and RT-qPCR has been shown to be twice and thrice more sensitive than ELISA in the detection of TriMV and HPWMoV, respectively [58]. For BSMV, Zarzyńska et al. demonstrated the limitations of ELISA as a diagnostic tool: it could not detect mild infections with moderate virus titers, while RT-PCR [59] and LAMP [60] were more sensitive. RT-qPCR is a valuable tool in studying virus gene expression and virus–host interactions [6].
Although no systematic studies of wheat viruses have been conducted in Kazakhstan to date, there are unpublished data reporting typical symptoms of viral disease in wheat and barley observed in different areas around the country. Therefore, considering the particular importance of wheat and other cereals for the economy and food safety of Kazakhstan, a comprehensive study of the distribution of wheat viruses involving molecular methods of identification and analysis is necessary for disease management and the prevention of massive outbreaks in the country.
In the present work, we evaluated the performance of established primers and designed new specific sets for the detection of WSMV and BSMV, which were tested on wheat and barley from different regions of the country. Amplicons produced by the new primers were sequenced and aligned with the accessions available in GenBank. A phylogenetic analysis was performed to shed new light on the genetic variability of WSMV and BSMV at local and global levels and to elucidate the origin, distribution, and impact of the viruses on wheat culture in Kazakhstan. The identification and population studies of WSMV and BSMV were conducted for the first time in Kazakhstan and will become the basis for further investigations on wheat viruses and protection against them.

2. Materials and Methods

2.1. Sample Collection and RNA Extraction

In 2021, 20 wheat and barley fields in northern and southeastern Kazakhstan were surveyed for plants displaying chlorosis, streaks, and mosaic (Figure 1A,B). In total, 256 leaf samples of both symptomatic and asymptomatic plants were collected (Table A1). The GPS coordinates of the sampling sites were recorded with a portable GPS navigator (Garmin 66S) and mapped using ArcGIS 10.5 software (Figure 1A). The plants were transported in plastic bags, frozen in liquid nitrogen, and stored at −80 °C until further use.
RNA was extracted using cetyltrimethylammonium bromide (CTAB) [61]. To confirm the quality of the total RNA extracts, 200 ng of RNA was separated on a 2% (w/v) agarose gel. Complementary DNA (cDNA) was synthesized using RevertAid Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). After combining 200 ng of RNA, 0.5 μg Oligo-dT, and 0.5 μg random hexamer primers in a final volume of 15 μL, the mix was denatured for 10 min at 72 °C and then cooled on ice. After adding 5× RT reaction buffer, 0.5 mM dNTPs, and 100 U reverse transcriptase, cDNA was synthesized for 1 h at 45 °C. The integrity of the isolated RNA was confirmed on agarose gel.
Viruses 16 00096 g001
Figure 1. Sampling of wheat and barley in the northern and southeastern regions of Kazakhstan. (A) Map of Kazakhstan with sampling sites; location points according to Table A1. (B) Examples of wheat and barley leaves with symptoms of viral disease; all leaves are shown alongside a healthy leaf (rightmost leaf in each photo); grid size: 5 mm.
Figure 1. Sampling of wheat and barley in the northern and southeastern regions of Kazakhstan. (A) Map of Kazakhstan with sampling sites; location points according to Table A1. (B) Examples of wheat and barley leaves with symptoms of viral disease; all leaves are shown alongside a healthy leaf (rightmost leaf in each photo); grid size: 5 mm.
Viruses 16 00096 g001

2.2. Primer Design

The initial screening was performed using previously established detection primers (Table 1): two sets of primers for WSMV [43,62], and one of each for BSMV [59], TriMV [43], and HPWMoV [43]. However, the majority of samples showing strong symptoms of viral infection were negative for all viruses, or produced amplicons outside of target sizes (Figure S1). Therefore, in the current work, we developed and tested new sets of primers for WSMV and BSMV to detect strains and isolates circulating in Kazakhstan with possible mutations in the binding sites of previously established primers.
RT-PCR primers for each virus were designed using Primer3 based on all the sequences of the WSMV coat protein and BSMV γB protein available in NCBI and described in Table S1, and the specificity of each primer set was tested in silico using Primer-BLAST (https://www.ncbi.nlm.nih.gov/ (accessed on 5 January 2024)) (Table 1).
Three sets of LAMP primers targeting conservative regions of WSMV Nlb and CP encoding genes were designed using the Neb LAMP primer design tool (https://lamp.neb.com/#!/ (accessed on 5 January 2024)) (Table 2). The analysis of all Nlb and CP sequences available in NCBI and the determination of conservative regions was performed in UGENE [63]. LAMP primers were selected based on the values of free energy at the 3′ ends of F2/B2, F3/B3, and LF/LB, and the 5′ end of F1c/B1c, set to –4 kcal/mol or less. Because the 5′ end of F1c after amplification corresponded to the 3′ end of F1, stability was very important (https://primerexplorer.jp/e/ (accessed on 5 January 2024)). Additionally, loop primers for each set were developed to reduce the amplification time and improve the specificity.

2.3. Detection of Viruses Using PCR and LAMP

PCR screening for WSMV, BSMV, TriMV, and HPWMoV was performed according to the protocols described in the respective works [43,59,62]. For the newly developed primers, PCR was conducted in 25 μL of reaction mix containing 10 mM of each primer and 2 μL of cDNA as a template for amplification. The PCR cycling conditions were 95 °C for 3 min, followed by 30 cycles of 30 s at 95 °C, 20 s at 54 °C (for WSMV) and 58 °C (for BSMV), and 40 s at 72 °C. After a final extension of 5 min at 72 °C, 10 μL of each PCR reaction was separated on a 2.0% (w/v) agarose gel.
The detection of WSMV using LAMP was performed in accordance with the protocol for the WarmStart Colorimetric LAMP 2× Master Mix with UDG (M1804L, New England BioLabs, Ipswich, MA, USA). The primer mix was prepared separately for each set, including LB/RB or both, and 1 μL of sample RNA was used as a template. The resulting mix was amplified for 30–60 min at 65 °C. The results were analyzed both visually (phenol red indicator) and on 1.5% agarose gel.

2.4. Targeted Sequencing

Short amplicons produced via PCR (Table 1) and almost complete sequences of WSMV coat protein gene and BSMV γB gene amplified using a different set of primers (Table 3) were sequenced for the investigation of genetic diversity. The 950 bp sequences of WSMV CP and 460 bp sequences of BSMV γB were amplified using the overlapping method [64]. The sequencing reaction was performed in 10 μL of mix containing 5–10 ng of the PCR product, 3.2 mM of either the forward or reverse primer for each virus, 1 μL BigDye™ Terminator Reaction Mix (Thermo Fisher Scientific, Waltham, MA, USA), and 1.5 μL BigDye™ Terminator sequencing buffer. The cycling conditions were 96 °C for 1 min, followed by 25 cycles of 10 s at 96 °C, 5 s at 50 °C, and 4 min at 60 °C. Sequencing was carried out on a 3500 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA) using the StdSeq50_POP7 run mode.
All sequences were assembled using DNAMAN and deposited in the NCBI GenBank (OP793649–OP793678).

2.5. Phylogenetic Analysis

The nucleotide sequences coding for the WSMV CP region and BSMV γB protein were subsequently aligned with relevant accessions from the NCBI GenBank (Table S1) using MAFFT [65], including whole genome sequences of both viruses, the polyprotein or coat protein cDNA of WSMV, and the γRNA or γB protein of BSMV (Table S1). The alignment was inspected and refined manually to exclude low-quality sequences and to correct alignment mistakes. Phylogenetic trees were constructed in MrBayes (average standard deviation of split frequencies < 0.01) [66,67].
The combined set of sequences was tested for possible recombination events using RDP5 software [68] with the following methods: RDP [69], GENECONV [70], Bootscan [71], Maxchi [72], Chimaera [73], SiSscan [74], and 3Seq [75].

3. Results

3.1. RT-PCR and LAMP Detection of Wheat Viruses

Sample screening for WSMV, BSMV TriMV, and HPWMoV using pre-established detection primers delivered mixed results. TriMV and HPWMoV were not detected, while the two sets of WSMV primers amplified sequences of various lengths from different isolates. One set of primers by Byamukama et al. detected WSMV in 10 of the isolates, while the expected 750-bp fragment of the set WS-8166-8909 [62] was amplified in 32 of them. As for BSMV, eight specimens were positive for the TGB2 set [59].
The newly developed primer WSMV-8156-8783 identified WMSV infection in 82 samples, 24 of which were previously detected via WS-8166-8909 and 3 via WSMV, and 4 isolates amplified all three primers (Figure 2). However, four and three were detected only by WS-8166-8909 and WSMV, respectively. Cumulatively, the new primer set made it possible to identify 51 more isolates, the identity of which was confirmed via sequencing.
BSMV-2763-2868 produced amplicons in 19 isolates, allowing to identify 13 new infections. A mixed infection of WSMV and BSMV was detected in 10 samples.
Three sets of LAMP primers complementary to WSMV CP and Nlb protein coding regions were designed (Table 3) and tested on the 82 isolates where WSMV was detected. Sets No. 1 and No. 3 indicated nonspecific amplification in some samples and the negative control, so set No. 2 was chosen as the best suitable primer set because it showed higher specificity and sensitivity (Figure S1). The positive LAMP products were analyzed using the colorimetric method due to the pH-sensitive indicator phenol red changing from red to yellow, as well as gel electrophoresis displaying multiple bands of different sizes due to the formation of stem-loop DNA of different lengths (Figure 3).
The newly developed primers for RT-PCR and LAMP were consistently amplified in the same samples.

3.2. Genetic Variability of WSMV and BSMV

To confirm the sequence identity between the amplification products and the corresponding genomic region of WSMV or BSMV, both amplicons and extended sequences of the target regions were sequenced and aligned with the accessions retrieved from the NCBI GenBank (Table S1).
From the positive sample pool, 23 WSMV and 6 BSMV isolates from different regions of Kazakhstan were randomly selected, sequenced, and subjected to phylogenetic analysis. The 950 bp of WSMV CP (Figure 4), as well as 460 bp of BSMV γB (Figure 5) coding regions were used for analysis. Additionally, cladograms based on the amplicons (274 bp for WSMV and 134 bp for BSMV) were constructed (Figure S2).
Almost all Kazakh WSMV isolates formed a clade close to the isolates of European origin (Ukraine, Czech Republic, and Hungary). For isolate KZ57, both sequences had a similar distinct position in all cladograms and were located near Iranian and American isolates.
The sequenced fragments of BSMV demonstrated relative proximity to European isolates (Figure 5). However, the low number of foreign isolates available for comparison limited the possible conclusions about the clustering on the global scale. All sequenced isolates were detected on the “Svetlana” farm near Almaty (location point “S”), except for KZ8 (Pavlodar, location point 28). The latter formed a well-supported (bootstrap value 99) clade with the isolates from Egypt and China.
Overall, the phylogenetic trees constructed using short (Figure S2) and long reads of WSMV and BSMV displayed relative similarity between the composition of larger groupings such as continental division, although short sequences could not be used to distinguish the phylogenetic relationships within them. This indicates that short sequences, instead of long ones, can be used for the rapid evaluation of clade numbers in the populations, which reduces the time required for workflow and analysis. However, the loss of complexity between the topologies of the two BSMV trees is quite severe, and the one based on shorter sequences retains only one distinct clade (American).
The RDP5 software test revealed a single potential recombination event involving WSMV sample KZ28 from ‘Lyubava’ farm and two Ukrainian isolates (MH523357.1 and MH523356.1) with Bootscan (p-value 1.44 × 10–4), Maxchi (p-value 2.3 × 10–6), and 3Seq (p-value 5.85 × 10–13); however, the exact breakpoint positions and relations between the relevant sequences could not be determined due to the incompleteness of data, so we consider this unreliable. All other potential recombination events were not supported by any of the used tests, and/or were identified as false positive.

4. Discussion

The early detection of plant viruses using molecular methods is essential for implementing quarantine measures to prevent further disease spread. Therefore, sensitive, quick, and robust molecular methods, such as LAMP, RT-PCR, RT-qPCR, and dPCR will always be relevant and necessary [76]. The natural evolution of viruses and rapidly expanding genetic data enable the development of new, more reliable detection systems and the modification of existing ones. In this work, the previously established primer sets were incapable of detecting WSMV and BSMV in several samples with strong symptoms of viral infection, possibly due to mutations in the binding sites of the primers on behalf of the viral isolates circulating in Kazakhstan. The primers developed in the present work allowed us to identify 82 and 19 instances of WSMV and BSMV infections, respectively, and to perform a comparative phylogenetic analysis. Additionally, we were able to demonstrate the successful amplification of WSMV within 60 min at 65 °C using an RT-LAMP assay.
TriMV and HPWMoV were not detected in the collected samples of wheat and barley. This may have occurred because of the specificity of the primers used to detect these viruses, the low concentration of viruses in plants, inappropriate time for testing, dependence on the distribution of natural vectors, or the absence of viruses. TriMV was not detected outside North America before 2023 [77], and its limited distribution in Iraq suggests a recent introduction. So far, Ukraine [78] and Iran [79] report the presence of HPWMoV in Eurasia, and EFSA considers it a potential quarantine pest for the EU [80]. Notably, both research groups used the same set of primers targeting the HPWMoV nucleocapsid region developed by Lebas et al. [81], which is located within genomic RNA 3 characterized by two heterogenous variants [45]. The higher specificity afforded by the RT-PCR assay may hinder the detection of divergent strains, and the lower sensitivity of ELISA could tolerate substitutions at key positions, making it a useful tool for the first detection of viruses in a new location. While the recent introductions in Iran and Iraq are troubling, the spread of the virus has not reached the levels observed in North America and could be avoided through appropriate quarantine measures.
WSMV is one of the most common viruses in wheat-growing regions on six continents. Its topology consists of four main clades: A (Mexico), B (Europe, Russia, and East Asia), C (Iran and West Asia), and D (the USA, Argentina, Brazil, Australia, Turkey, and Canada) [28,49]. It has been suggested that the American isolates of WSMV form a population separate from Eurasian isolates, and Turkish isolates are known to be closer to American than Eurasian ones [22,33]. These results indicate that there has been a separation of American and Turkish isolates from isolates from Mexico, Central Europe, Russia, and Iran. The 23 isolates found in Kazakhstan were grouped into one cluster with European isolates, placing them inside Clade B. However, isolate KZ57 (Kostanay) clustered away from Clade B and shared a high-support (bootstrap value 100) common ancestor with Australian and American sequences of Clade D as well as several Iranian isolates. It also showed evidence of recombination according to RDP5, supporting the previous findings that the 3′ end of the CP coding region is a common recombination spot [82]. Yet, only limited conclusions can be drawn from the sequence analysis of one of the most variable fragments of a viral genome, and whole genome sequencing can shed more light on potential sources of infection.
Another important factor is that seed transmission, while possible, is infrequent: both 0.5–1.5% [54] and up to 13% in susceptible cultivars have been reported [55]. Thus, it is unlikely that the incidence of 21 viral infections (as in location 7) is the product of infected international germplasm. WSMV is primarily transmitted via wheat curl mites (WCM), which can acquire the virus after a 15 min feeding session [83] and spread it around the field. Currently, no reports or comprehensive studies exist on WCM of Kazakhstan, so further research of the topic of the wheat streak mosaic should be based upon a deeper understanding of the WCM distribution within the grain growing locations.
According to the data from the State Revenue Committee of the Ministry of Finance of the Republic of Kazakhstan, the predominant direction of foreign wheat trade is Europe [84]. Thus, the genetic relationship among isolates could be explained by the flow of the viral genetic pool via wheat seeds accompanied by insects. However, the available data do not define the exact proportion of flow or the time. The primary testing of imported wheat seeds and the correlation between the source of infection and cultivars could be more useful in the prediction of the infection’s origin.
Throughout the years, BSMV has been detected in North America, Europe, Asia, and North Africa [21,85]. BSMV sequences from Kazakhstan showed a high nucleotide identity with those from Europe; however, the low diversity of available isolates makes it difficult to draw conclusions about the global spread of the virus. While the main source of barley seed imports to Kazakhstan is Iran [84], the detected BSMV isolates were found in proximity to European isolates. Despite the lack of sequence data from other regions, particularly West Asia and Iran, it could be assumed that the virus was introduced alongside the wheat seed material imported from Europe. However, the well-supported cluster composed of isolates from China and Egypt could represent the spot where Iranian isolates could be located within this phylogenetic tree.
Thus, it is important to establish strict control over grain imports to avoid new infection transfers and to take appropriate epidemiological measures to prevent the further spread of isolates already present in the country. Factors such as the possible lack of spatial isolation of winter and spring crops and grasses, the late sowing of spring and early sowing of winter crops, and the presence of weeds and vector pests could lead to the preservation and spread of these viruses. While BSMV can be managed by seed testing and the timely isolation of the infected plants, WSMV is more difficult to control because of the mobility of vector mites. The principal method is to control the vector population by disrupting their life cycle [86]. Therefore, it is necessary to destroy the residual harvest in a timely manner after planting to effectively combat wheat mites. In addition, it is necessary to till the soil and destroy the surrounding weeds with herbicides, which will help reduce the sources of viral inoculum and the mite population. Crop rotation and methods of sowing crops at the beginning/end of the season can also reduce the vector populations and prevent the spread of viral infections.

5. Conclusions

Despite the crucial role of wheat in the economy and food safety of Kazakhstan, the lack of epidemiological studies on plant viruses leaves wheat production in the country vulnerable to viral infections. Molecular genetic techniques are among the key modern methods in the epidemiology, ecology, and biology of viral infections. Methods including LAMP, RT-PCR, RT-qPCR, and sequencing allow prompt virus diagnosis, thereby facilitating the management of plant diseases. The present study will contribute to the development and implementation of new effective and long-term strategies for the control of cereal viruses in the country, as well as providing a better understanding of the genetic variability in local populations of WSMV and BSMV. Further work will involve improving sequencing quality and targeting whole genome sequences as well as deepening the understanding of local wheat curl mite dispersal.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v16010096/s1, Table S1. Wheat streak mosaic virus (WSMV) and barley stripe mosaic virus (BSMV) isolates obtained from GenBank and used in sequence analysis. Figure S1. Gel images of samples positive for each set of primers used for detection (WSMV-8156-8783, LAMP, BSMV-2763-2868, TGB2, WS-8166-8909, and WSMV). Figure S2. Cladograms constructed based on the amplicons produced by the newly developed primers WSMV-8156-8783 and BSMV-2763-2868.

Author Contributions

Conceptualization, D.G.; methodology, A.T., A.K. and N.K.; software, A.S.P.; formal analysis, M.K. (Marina Khusnitdinova) and G.N.; investigation, A.K. and N.K., validation, K.A., R.M. and M.A.; resources, Z.K.; data curation, N.K.; writing—original draft preparation, A.K. and N.K.; writing—review and editing, M.K. (Mariya Kolchenko) and D.G.; visualization, A.K. and M.K. (Mariya Kolchenko); project administration, D.G.; funding acquisition, D.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science and Higher Education of Kazakhstan, grant number BR18574099, “Study of molecular genetics and cellular processes to increase disease resistance and crop productivity”.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Raw data are available in the Supplementary Material.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Sampling locations where WSMV and BSMV infections were detected.
Table A1. Sampling locations where WSMV and BSMV infections were detected.
Location PointLatitudeLongitudeHost PlantPlants with Symptoms TestedPlants without Symptoms TestedPCR WSMV+PCR BSMV+Sequences
350°11.133′58°40.880′Wheat0200
450°14.383′58°26.214′Wheat1110
550°14.381′58°18.364′Wheat0200
750°33.891′57°32.293′Barley231212KZ90, KZ93, KZ94, KZ96, KZ99, KZ103, KZ104, KZ108, (WSMV)
850°21.584′57°23.847′Wheat4940KZ48, KZ49 (WSMV)
1253°13.133′63°45.438′Barley3121
1353°12.957′63°46.143′Wheat9190KZ57, KZ58, KZ59, KZ60, KZ62, KZ63, KZ64, KZ65 (WSMV)
1453°13.288′63°47.131′Wheat109100KZ68, KZ72, KZ73, KZ69, KZ70 (WSMV)
1751°40.282′71°01.126′Wheat0500
1851°40.282′71°01.143′Wheat1210
2051°38.004′71°02.413′Wheat11810
2151°38.007′71°02.411′Wheat3130
2251°38.817′71°01.820′Barley5050
2351°37.804′71°01.812′Wheat3720
2650°49.495′72°33.790′Wheat0500
2852°44.708′76°42.226′Wheat3521KZ8 (BSMV)
3550°15.910’72°40.247’Wheat01100
3849°37.410’72°53.835’Wheat16 6118
K A43°13.598’76°42.036’Wheat11 5147
S B43°10.833’76°19.950’Wheat, barley6 2060KZ2, KZ3, KZ4, KZ6, KZ7 (BSMV)
A Experimental plot of the Kazakh Research Institute of Agriculture and Plant Growing (Almaty). B “Svetlana” farm (Almaty region).

References

  1. Turuspekov, Y.; Plieske, J.; Ganal, M.; Akhunov, E.; Abugalieva, S. Phylogenetic Analysis of Wheat Cultivars in Kazakhstan Based on the Wheat 90 K Single Nucleotide Polymorphism Array. Plant Genet. Resour. 2017, 15, 29–35. [Google Scholar] [CrossRef]
  2. FAOSTAT. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 12 July 2023).
  3. Tatineni, S.; Hein, G.L. Plant Viruses of Agricultural Importance: Current and Future Perspectives of Virus Disease Management Strategies. Phytopathology 2023, 113, 117–141. [Google Scholar] [CrossRef]
  4. Hodge, B.A.; Paul, P.A.; Stewart, L.R. Occurrence and High-Throughput Sequencing of Viruses in Ohio Wheat. Plant Dis. 2020, 104, 1789–1800. [Google Scholar] [CrossRef]
  5. Rotenberg, D.; Bockus, W.W.; Whitfield, A.E.; Hervey, K.; Baker, K.D.; Ou, Z.; Laney, A.G.; De Wolf, E.D.; Appel, J.A. Occurrence of Viruses and Associated Grain Yields of Paired Symptomatic and Nonsymptomatic Tillers in Kansas Winter Wheat Fields. Phytopathology 2016, 106, 202–210. [Google Scholar] [CrossRef]
  6. Singh, K.; Wegulo, S.N.; Skoracka, A.; Kundu, J.K. Wheat Streak Mosaic Virus: A Century Old Virus with Rising Importance Worldwide. Mol. Plant Pathol. 2018, 19, 2193–2206. [Google Scholar] [CrossRef]
  7. Tatineni, S.; Alexander, J.; Qu, F. Differential Synergistic Interactions Among Four Different Wheat-Infecting Viruses. Front. Microbiol. 2022, 12, 800318. [Google Scholar] [CrossRef]
  8. Almas, L.K.; Price, J.A.; Workneh, F.; Rush, C.M. Quantifying Economic Losses Associated with Levels of Wheat Streak Mosaic Incidence and Severity in the Texas High Plains. Crop Prot. 2016, 88, 155–160. [Google Scholar] [CrossRef]
  9. French, R.; Stenger, D.C. Evolution of Wheat Streak Mosaic Virus: Dynamics of Population Growth within Plants May Explain Limited Variation. Annu. Rev. Phytopathol. 2003, 41, 199–214. [Google Scholar] [CrossRef]
  10. Pfrieme, A.-K.; Will, T.; Pillen, K.; Stahl, A. The Past, Present, and Future of Wheat Dwarf Virus Management—A Review. Plants 2023, 12, 3633. [Google Scholar] [CrossRef]
  11. McKinney, H.H.; Greeley, L.W. Biological Characteristics of Barley Stripe-Mosaic Virus Strains and Their Evolution; U.S. Department of Agriculture: Washington, DC, USA, 1965. [Google Scholar]
  12. Donald, R.G.K.; Zhou, H.; Jackson, A.O. Serological Analysis of Barley Stripe Mosaic Virus-Encoded Proteins in Infected Barley. Virology 1993, 195, 659–668. [Google Scholar] [CrossRef]
  13. King, A.M.; Adams, M.; Carstens, E.; Lefkowitz, E.J. Family Virgaviridae. In Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier Academic Press: Waltham, MA, USA, 2011; ISBN 978-0-12-384684-6. [Google Scholar]
  14. Donald, R.G.; Jackson, A.O. The Barley Stripe Mosaic Virus Gamma b Gene Encodes a Multifunctional Cysteine-Rich Protein That Affects Pathogenesis. Plant Cell 1994, 6, 1593–1606. [Google Scholar] [CrossRef] [PubMed]
  15. Gustafson, G.; Armour, S.L. The Complete Nucleotide Sequence of RNA Beta from the Type Strain of Barley Stripe Mosaic Virus. Nucleic Acids Res. 1986, 14, 3895–3909. [Google Scholar] [CrossRef]
  16. Jackson, A.O.; Lim, H.-S.; Bragg, J.; Ganesan, U.; Lee, M.Y. Hordeivirus Replication, Movement, and Pathogenesis. Annu. Rev. Phytopathol. 2009, 47, 385–422. [Google Scholar] [CrossRef]
  17. Zhang, X.; Dong, K.; Xu, K.; Zhang, K.; Jin, X.; Yang, M.; Zhang, Y.; Wang, X.; Han, C.; Yu, J.; et al. Barley Stripe Mosaic Virus Infection Requires PKA-Mediated Phosphorylation of Γb for Suppression of Both RNA Silencing and the Host Cell Death Response. New Phytol. 2018, 218, 1570–1585. [Google Scholar] [CrossRef]
  18. Yelina, N.E.; Savenkov, E.I.; Solovyev, A.G.; Morozov, S.Y.; Valkonen, J.P.T. Long-Distance Movement, Virulence, and RNA Silencing Suppression Controlled by a Single Protein in Hordei- and Potyviruses: Complementary Functions between Virus Families. J. Virol. 2002, 76, 12981–12991. [Google Scholar] [CrossRef]
  19. Donald, R.G.K.; Jackson, A.O. RNA-Binding Activities of Barley Stripe Mosaic Virus Γb Fusion Proteins. J. Gen. Virol. 1996, 77, 879–888. [Google Scholar] [CrossRef]
  20. Bragg, J.N.; Jackson, A.O. The C-Terminal Region of the Barley Stripe Mosaic Virusγb Protein Participates in Homologous Interactions and Is Required for Suppression of RNA Silencing. Mol. Plant Pathol. 2004, 5, 465–481. [Google Scholar] [CrossRef]
  21. Smith, O.; Clapham, A.; Rose, P.; Liu, Y.; Wang, J.; Allaby, R.G. A Complete Ancient RNA Genome: Identification, Reconstruction and Evolutionary History of Archaeological Barley Stripe Mosaic Virus. Sci. Rep. 2014, 4, 4003. [Google Scholar] [CrossRef]
  22. McNeil, J.E.; French, R.; Hein, G.L.; Baenziger, P.S.; Eskridge, K.M. Characterization of Genetic Variability among Natural Populations of Wheat Streak Mosaic Virus. Phytopathology 1996, 86, 1222–1227. [Google Scholar] [CrossRef]
  23. Kapooria, R.G.; Ndunguru, J. Occurrence of Viruses in Irrigated Wheat in Zambia. EPPO Bull. 2004, 34, 413–419. [Google Scholar] [CrossRef]
  24. Stenger, D.C.; Hall, J.S.; Choi, I.-R.; French, R. Phylogenetic Relationships within the Family Potyviridae: Wheat Streak Mosaic Virus and Brome Streak Mosaic Virus Are Not Members of the Genus Rymovirus. Phytopathology 1998, 88, 782–787. [Google Scholar] [CrossRef]
  25. Choi, I.-R.; Horken, K.M.; Stenger, D.C.; French, R. Mapping of the P1 Proteinase Cleavage Site in the Polyprotein of Wheat Streak Mosaic Virus (Genus Tritimovirus). J. Gen. Virol. 2002, 83, 443–450. [Google Scholar] [CrossRef] [PubMed]
  26. Chung, B.Y.-W.; Miller, W.A.; Atkins, J.F.; Firth, A.E. An Overlapping Essential Gene in the Potyviridae. Proc. Natl. Acad. Sci. USA 2008, 105, 5897–5902. [Google Scholar] [CrossRef] [PubMed]
  27. Tatineni, S.; Ziems, A.D.; Wegulo, S.N.; French, R. Triticum Mosaic Virus: A Distinct Member of the Family Potyviridae with an Unusually Long Leader Sequence. Phytopathology 2009, 99, 943–950. [Google Scholar] [CrossRef] [PubMed]
  28. Redila, C.D.; Phipps, S.; Nouri, S. Full Genome Evolutionary Studies of Wheat Streak Mosaic-Associated Viruses Using High-Throughput Sequencing. Front. Microbiol. 2021, 12, 699078. [Google Scholar] [CrossRef] [PubMed]
  29. Tatineni, S.; French, R. The C-Terminus of Wheat Streak Mosaic Virus Coat Protein Is Involved in Differential Infection of Wheat and Maize through Host-Specific Long-Distance Transport. MPMI 2014, 27, 150–162. [Google Scholar] [CrossRef]
  30. Choi, I.-R.; Hall, J.S.; Henry, M.; Zhang, L.; Hein, G.L.; French, R.; Stenger, D.C. Contributions of Genetic Drift and Negative Selection on the Evolution of Three Strains of Wheat Streak Mosaic Tritimovirus. Arch. Virol. 2001, 146, 619–628. [Google Scholar] [CrossRef] [PubMed]
  31. Sánchez-Sánchez, H.; Henry, M.; Cárdenas-Soriano, E.; Alvizo-Villasana, H.F. Identification of Wheat Streak Mosaic Virus and Its Vector Aceria tosichella in Mexico. Plant Dis. 2001, 85, 13–17. [Google Scholar] [CrossRef]
  32. Navia, D.; Truol, G.; Mendonca, R.S.; Sagadin, M. Aceria tosichella Keifer (Acari: Eriophyidae) from Wheat Streak Mosaic Virus-Infected Wheat Plants in Argentina. Int. J. Acarol. 2006, 32, 189–193. [Google Scholar] [CrossRef]
  33. Rabenstein, F.; Seifers, D.L.; Schubert, J.; French, R.; Stenger, D.C. Phylogenetic Relationships, Strain Diversity and Biogeography of Tritimoviruses. J. Gen. Virol. 2002, 83, 895–906. [Google Scholar] [CrossRef]
  34. Foulad, P.; Izadpanah, K. Identification of Wheat Streak Mosaic Virus in Iran. Iran. Agric. Res. 1986, 5, 73–84. [Google Scholar]
  35. Hassani, M.; Lotfipour, M.; Qasemi Nejad, M.; Tabib, M.H.; Baimani, M. Occurrence of Major Viruses in Wheat in Khuzestan Province. J. Iran. Plant Prot. Res. 2022, 36, 1–8. [Google Scholar] [CrossRef]
  36. Dwyer, G.I.; Gibbs, M.J.; Gibbs, A.J.; Jones, R.A.C. Wheat Streak Mosaic Virus in Australia: Relationship to Isolates from the Pacific Northwest of the USA and Its Dispersion Via Seed Transmission. Plant Dis. 2007, 91, 164–170. [Google Scholar] [CrossRef]
  37. Ellis, M.H.; Rebetzke, G.J.; Mago, R.; Chu, P. First Report of Wheat Streak Mosaic Virus in Australia. Australas. Plant Pathol. 2003, 32, 551–553. [Google Scholar] [CrossRef]
  38. Fellers, J.P.; Seifers, D.; Ryba-White, M.; Joe Martin, T. The Complete Genome Sequence of Triticum Mosaic Virus, a New Wheat-Infecting Virus of the High Plains. Arch. Virol. 2009, 154, 1511–1515. [Google Scholar] [CrossRef]
  39. Seifers, D.L.; Martin, T.J.; Harvey, T.L.; Fellers, J.P.; Stack, J.P.; Ryba-White, M.; Haber, S.; Krokhin, O.; Spicer, V.; Lovat, N.; et al. Triticum Mosaic Virus: A New Virus Isolated from Wheat in Kansas. Plant Dis. 2008, 92, 808–817. [Google Scholar] [CrossRef]
  40. Young, B.A.; Stenger, D.C.; Qu, F.; Morris, T.J.; Tatineni, S.; French, R. Tritimovirus P1 Functions as a Suppressor of RNA Silencing and an Enhancer of Disease Symptoms. Virus Res. 2012, 163, 672–677. [Google Scholar] [CrossRef]
  41. Tatineni, S.; Alexander, J.; Gupta, A.K.; French, R. Asymmetry in Synergistic Interaction Between Wheat Streak Mosaic Virus and Triticum Mosaic Virus in Wheat. MPMI 2019, 32, 336–350. [Google Scholar] [CrossRef]
  42. Byamukama, E.; Wegulo, S.N.; Tatineni, S.; Hein, G.L.; Graybosch, R.A.; Baenziger, P.S.; French, R. Quantification of Yield Loss Caused by Triticum Mosaic Virus and Wheat Streak Mosaic Virus in Winter Wheat under Field Conditions. Plant Dis. 2014, 98, 127–133. [Google Scholar] [CrossRef] [PubMed]
  43. Byamukama, E.; Tatineni, S.; Hein, G.; McMechan, J.; Wegulo, S.N. Incidence of Wheat Streak Mosaic Virus, Triticum Mosaic Virus, and Wheat Mosaic Virus in Wheat Curl Mites Recovered from Maturing Winter Wheat Spikes. Plant Dis. 2016, 100, 318–323. [Google Scholar] [CrossRef] [PubMed]
  44. Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Dempsey, D.M.; Dutilh, B.E.; García, M.L.; Curtis Hendrickson, R.; et al. Recent Changes to Virus Taxonomy Ratified by the International Committee on Taxonomy of Viruses (2022). Arch. Virol. 2022, 167, 2429–2440. [Google Scholar] [CrossRef]
  45. Tatineni, S.; McMechan, A.J.; Wosula, E.N.; Wegulo, S.N.; Graybosch, R.A.; French, R.; Hein, G.L. An Eriophyid Mite-Transmitted Plant Virus Contains Eight Genomic RNA Segments with Unusual Heterogeneity in the Nucleocapsid Protein. J. Virol. 2014, 88, 11834–11845. [Google Scholar] [CrossRef]
  46. Ahn, K.K.; Kim, K.S.; Gergerich, R.C.; Jensen, S.G. High Plains Disease of Corn and Wheat: Ultrastructural and Serological Aspects. J. Submicrosc. Cytol. Pathol. 1998, 30, 563–571. [Google Scholar]
  47. Mielke-Ehret, N.; Mühlbach, H.-P. Emaravirus: A Novel Genus of Multipartite, Negative Strand RNA Plant Viruses. Viruses 2012, 4, 1515–1536. [Google Scholar] [CrossRef]
  48. Burrows, M.; Franc, G.; Rush, C.; Blunt, T.; Ito, D.; Kinzer, K.; Olson, J.; O’Mara, J.; Price, J.; Tande, C.; et al. Occurrence of Viruses in Wheat in the Great Plains Region, 2008. Plant Health Prog. 2009, 10, 14. [Google Scholar] [CrossRef]
  49. Pozhylov, I.; Snihur, H.; Shevchenko, T.; Budzanivska, I.; Liu, W.; Wang, X.; Shevchenko, O. Occurrence and Characterization of Wheat Streak Mosaic Virus Found in Mono- and Mixed Infection with High Plains Wheat Mosaic Virus in Winter Wheat in Ukraine. Viruses 2022, 14, 1220. [Google Scholar] [CrossRef]
  50. Jones, R.A.C.; Vazquez-Iglesias, I.; McGreig, S.; Fox, A.; Gibbs, A.J. Genomic High Plains Wheat Mosaic Virus Sequences from Australia: Their Phylogenetics and Evidence for Emaravirus Recombination and Reassortment. Viruses 2023, 15, 401. [Google Scholar] [CrossRef]
  51. McMechan, A.J.; Tatineni, S.; French, R.; Hein, G.L. Differential Transmission of Triticum Mosaic Virus by Wheat Curl Mite Populations Collected in the Great Plains. Plant Dis. 2014, 98, 806–810. [Google Scholar] [CrossRef]
  52. Seifers, D.L.; Martin, T.J.; Harvey, T.L.; Fellers, J.P.; Michaud, J.P. Identification of the Wheat Curl Mite as the Vector of Triticum Mosaic Virus. Plant Dis. 2009, 93, 25–29. [Google Scholar] [CrossRef] [PubMed]
  53. Byamukama, E.; Seifers, D.L.; Hein, G.L.; De Wolf, E.; Tisserat, N.A.; Langham, M.A.C.; Osborne, L.E.; Timmerman, A.; Wegulo, S.N. Occurrence and Distribution of Triticum Mosaic Virus in the Central Great Plains. Plant Dis. 2013, 97, 21–29. [Google Scholar] [CrossRef] [PubMed]
  54. Jones, R.A.C.; Coutts, B.A.; Mackie, A.E.; Dwyer, G.I. Seed Transmission of Wheat Streak Mosaic Virus Shown Unequivocally in Wheat. Plant Dis. 2005, 89, 1048–1050. [Google Scholar] [CrossRef]
  55. Gautam, S.; Chinnaiah, S.; Herron, B.; Workneh, F.; Rush, C.M.; Gadhave, K.R. Seed Transmission of Wheat Streak Mosaic Virus and Triticum Mosaic Virus in Differentially Resistant Wheat Cultivars. Viruses 2023, 15, 1774. [Google Scholar] [CrossRef]
  56. Price, J.A.; Smith, J.; Simmons, A.; Fellers, J.; Rush, C.M. Multiplex Real-Time RT-PCR for Detection of Wheat Streak Mosaic Virus and Tritcum Mosaic Virus. J. Virol. Methods 2010, 165, 198–201. [Google Scholar] [CrossRef]
  57. Tatineni, S.; Graybosch, R.A.; Hein, G.L.; Wegulo, S.N.; French, R. Wheat Cultivar-Specific Disease Synergism and Alteration of Virus Accumulation during Co-Infection with Wheat Streak Mosaic Virus and Triticum Mosaic Virus. Phytopathology 2010, 100, 230–238. [Google Scholar] [CrossRef]
  58. Bryan, B.; Paetzold, L.; Workneh, F.; Rush, C.M. Incidence of Mite-Vectored Viruses of Wheat in the Texas High Plains and Interactions with Their Host and Vector. Plant Dis. 2019, 103, 2996–3001. [Google Scholar] [CrossRef]
  59. Zarzyńska, A.; Jeżewska, M.; Trzmiel, K.; Hasiów-Jaroszewska, B. Development of a One-Step Immunocapture Real-Time RT-PCR Assay for the Detection of Barley Stripe Mosaic Virus Strains in Barley Seedlings. Acta Virol. 2014, 58, 81–85. [Google Scholar] [CrossRef]
  60. Zarzyńska-Nowak, A.; Hasiów-Jaroszewska, B.; Jeżewska, M. Molecular Analysis of Barley Stripe Mosaic Virus Isolates Differing in Their Biological Properties and the Development of Reverse Transcription Loop-Mediated Isothermal Amplification Assays for Their Detection. Arch. Virol. 2018, 163, 1163–1170. [Google Scholar] [CrossRef]
  61. Amraee, L.; Rahmani, F. Modified CTAB Protocol for RNA Extraction from Lemon Balm (Melissa Officinalis L.). Acta Agric. Slov. 2020, 115, 53–57. [Google Scholar] [CrossRef]
  62. Kúdela, O.; Kúdelová, M.; Nováková, S.; Glasa, M. First Report of Wheat Streak Mosaic Virus in Slovakia. Plant Dis. 2008, 92, 1365. [Google Scholar] [CrossRef] [PubMed]
  63. Okonechnikov, K.; Golosova, O.; Fursov, M.; Varlamov, A.; Vaskin, Y.; Efremov, I.; German Grehov, O.G.; Kandrov, D.; Rasputin, K.; Syabro, M.; et al. Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
  64. Deng, Y.-M.; Spirason, N.; Iannello, P.; Jelley, L.; Lau, H.; Barr, I.G. A Simplified Sanger Sequencing Method for Full Genome Sequencing of Multiple Subtypes of Human Influenza A Viruses. J. Clin. Virol. 2015, 68, 43–48. [Google Scholar] [CrossRef]
  65. Katoh, K.; Misawa, K.; Kuma, K.I.; Miyata, T. MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [PubMed]
  66. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian Phylogenetic Inference under Mixed Models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
  67. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
  68. Martin, D.P.; Varsani, A.; Roumagnac, P.; Botha, G.; Maslamoney, S.; Schwab, T.; Kelz, Z.; Kumar, V.; Murrell, B. RDP5: A Computer Program for Analyzing Recombination in, and Removing Signals of Recombination from, Nucleotide Sequence Datasets. Virus Evol. 2021, 7, veaa087. [Google Scholar] [CrossRef] [PubMed]
  69. Martin, D.; Rybicki, E. RDP: Detection of Recombination amongst Aligned Sequences. Bioinformatics 2000, 16, 562–563. [Google Scholar] [CrossRef] [PubMed]
  70. Padidam, M.; Sawyer, S.; Fauquet, C.M. Possible Emergence of New Geminiviruses by Frequent Recombination. Virology 1999, 265, 218–225. [Google Scholar] [CrossRef]
  71. Martin, D.P.; Posada, D.; Crandall, K.A.; Williamson, C. A Modified Bootscan Algorithm for Automated Identification of Recombinant Sequences and Recombination Breakpoints. AIDS Res. Hum. Retroviruses 2005, 21, 98–102. [Google Scholar] [CrossRef]
  72. Smith, J.M. Analyzing the Mosaic Structure of Genes. J. Mol. Evol. 1992, 34, 126–129. [Google Scholar] [CrossRef]
  73. Posada, D.; Crandall, K.A. Evaluation of Methods for Detecting Recombination from DNA Sequences: Computer Simulations. Proc. Natl. Acad. Sci. USA 2001, 98, 13757–13762. [Google Scholar] [CrossRef]
  74. Gibbs, M.J.; Armstrong, J.S.; Gibbs, A.J. Sister-Scanning: A Monte Carlo Procedure for Assessing Signals in Recombinant Sequences. Bioinformatics 2000, 16, 573–582. [Google Scholar] [CrossRef] [PubMed]
  75. Lam, H.M.; Ratmann, O.; Boni, M.F. Improved Algorithmic Complexity for the 3SEQ Recombination Detection Algorithm. Mol. Biol. Evol. 2018, 35, 247–251. [Google Scholar] [CrossRef] [PubMed]
  76. Baldi, P.; La Porta, N. Molecular Approaches for Low-Cost Point-of-Care Pathogen Detection in Agriculture and Forestry. Front. Plant Sci. 2020, 11, 570862. [Google Scholar] [CrossRef] [PubMed]
  77. Khalaf, L.K.; Adhab, M.; Aguirre-Rojas, L.M.; Timm, A.E. Occurrences of Wheat Curl Mite Aceria tosichella Keifer 1969 (Eriophyidae) and the Associated Viruses, (WSMV, HPWMoV, TRIMV) in Iraq. Iraqi J. Agric. Sci. 2023, 54, 837–849. [Google Scholar] [CrossRef]
  78. Snihur, H.; Pozhylov, I.; Budzanivska, I.; Shevchenko, O. First Report of High Plains Wheat Mosaic Virus on Different Hosts in Ukraine. J. Plant Pathol. 2020, 102, 545–546. [Google Scholar] [CrossRef]
  79. Nourbakhsh, F.; Massah, A.; Soorni, A.; Talaee, L. First Report of High Plains Wheat Mosaic Virus in Iran. New Dis. Rep. 2023, 47, e12188. [Google Scholar] [CrossRef]
  80. EFSA Panel on Plant Health (PLH); Bragard, C.; Baptista, P.; Chatzivassiliou, E.; Di Serio, F.; Gonthier, P.; Jaques Miret, J.A.; Justesen, A.F.; MacLeod, A.; Magnusson, C.S.; et al. Pest Categorisation of High Plains Wheat Mosaic Virus. EFSA J. 2022, 20, e07302. [Google Scholar] [CrossRef]
  81. Lebas, B.S.M.; Ochoa-Corona, F.M.; Elliott, D.R.; Tang, Z.; Alexander, B.J.R. Development of an RT-PCR for High Plains Virus Indexing Scheme in New Zealand Post-Entry Quarantine. Plant Dis. 2005, 89, 1103–1108. [Google Scholar] [CrossRef]
  82. Robinson, M.D.; Murray, T.D. Genetic Variation of Wheat Streak Mosaic Virus in the United States Pacific Northwest. Phytopathology 2013, 103, 98–104. [Google Scholar] [CrossRef]
  83. Orlob, G.B. Feeding and Transmission Characteristics of Aceria tulipae Keifer as Vector of Wheat Streak Mosaic Virus1). J. Phytopathol. 1966, 55, 218–238. [Google Scholar] [CrossRef]
  84. State Revenue Committee of the Ministry of Finance of the Republic of Kazakhstan. Available online: https://kgd.gov.kz/en/exp_trade_files (accessed on 18 November 2023).
  85. Omar, S.; Easa, Z.; Abed-Alsaed, A. First Report of Barley Stripe Mosaic Virus Infecting Barley (Hordem Vulgare L.) In Al-Jabal Al-Akhdar- Libya. AlQalam J. Med. Appl. Sci. 2023, 6, 408–415. [Google Scholar]
  86. Oliveira-Hofman, C.; Wegulo, S.N.; Tatineni, S.; Hein, G.L. Impact of Wheat Streak Mosaic Virus and Triticum Mosaic Virus Coinfection of Wheat on Transmission Rates by Wheat Curl Mites. Plant Dis. 2015, 99, 1170–1174. [Google Scholar] [CrossRef]
Viruses 16 00096 g002
Figure 2. Overlap in amplicons produced by the three sets of WSMV primers. WSMV-8156-8783 (this study) was the only set to amplify 51 of the isolates analyzed; another 24 were also detected by WS-8166-8909 [62] and 3 by WSMV [43]. Only four isolates amplified all three sets of primers.
Figure 2. Overlap in amplicons produced by the three sets of WSMV primers. WSMV-8156-8783 (this study) was the only set to amplify 51 of the isolates analyzed; another 24 were also detected by WS-8166-8909 [62] and 3 by WSMV [43]. Only four isolates amplified all three sets of primers.
Viruses 16 00096 g002
Viruses 16 00096 g003
Figure 3. Wheat streak mosaic virus (WSMV) detection using LAMP assay. (A) Amplification analysis using the colorimetric method; pH-sensitive indicator phenol red changes the color from red to yellow in positive samples. (B) LAMP products separated on 2% agarose gel.
Figure 3. Wheat streak mosaic virus (WSMV) detection using LAMP assay. (A) Amplification analysis using the colorimetric method; pH-sensitive indicator phenol red changes the color from red to yellow in positive samples. (B) LAMP products separated on 2% agarose gel.
Viruses 16 00096 g003
Viruses 16 00096 g004
Figure 4. Cladogram constructed from all publicly available coat protein sequences of WSMV using the Bayesian algorithm, based on 950 bp sequences of the coat protein coding region. Branches and taxa are according to their continent of origin.
Figure 4. Cladogram constructed from all publicly available coat protein sequences of WSMV using the Bayesian algorithm, based on 950 bp sequences of the coat protein coding region. Branches and taxa are according to their continent of origin.
Viruses 16 00096 g004
Viruses 16 00096 g005
Figure 5. Phylogenetic tree constructed from all publicly available coat protein sequences of BSMV using the ML algorithm, based on 460 bp sequences of the γB protein coding region. Branches and taxa are according to their continent of origin.
Figure 5. Phylogenetic tree constructed from all publicly available coat protein sequences of BSMV using the ML algorithm, based on 460 bp sequences of the γB protein coding region. Branches and taxa are according to their continent of origin.
Viruses 16 00096 g005
Table 1. Primers for the detection of wheat streak mosaic virus (WSMV), barley stripe mosaic virus (BSMV), triticum mosaic virus (TriMV), and Emaravirus tritici (previously HPWMoV).
Table 1. Primers for the detection of wheat streak mosaic virus (WSMV), barley stripe mosaic virus (BSMV), triticum mosaic virus (TriMV), and Emaravirus tritici (previously HPWMoV).
Primer NameTarget VirusTarget RegionPrimer SequenceTm (°C)Product Size (bp)Source
WSMV-8581FWSMVcoat proteinCGACAAGATAAAGCCTGAAT54274This study
WSMV-8783R AGTGCTCTGTTCTCTGG
BSMV-2763FBSMVγB proteinAGAAGAAGATGCAGGAGCTGA58134This study
BSMV-2868R AAGAATCATCACATCCAACAG
WS-8166FWSMVcoat proteinGAGAGCAATACTGCGTGTACG45750[62]
WS-8909R GCATAATGGCTCGAAGTGATG
WSMVWSMVcoat proteinGTTGGGAGGCTTAATTGAAGTG55720[43]
CAGCCATTACTCGTGTTATCCA
TGB2FBSMVγB proteinGGATGAAGACCACAGTTGGTTC55397[59]
TGB2R CTAGCCAATATCGCATAGTAATG
TriMVTriMVPIPO regionCTTAAGCACATGTTACAATC451200[43]
GTCCCTGATAACTAATTCTA
WMoVHPWMoVRNA3GTTCCAATTCCTGTGCTTGATCTGTC45490[43]
AACAATGACATAGCAATTACCTCAGCA
Table 2. Primer sets for the detection of WSMV using LAMP assay.
Table 2. Primer sets for the detection of WSMV using LAMP assay.
SetProteinPrimerSequence (5′-3′)
1CPF3GCAGCAACTGATGCTGTCT
B3CTTGACCAGTCTTGGCTCC
FIPGCCGTGCTTGCACTCAGACTCGCAAATGCGGAAGTGGCA
BIPACCATCAGGATCAGGTTCCGGATGACCGACACGTTGCTAGA
LBGCGGGTGGATCAGGTTCAG
LFGCGTGCTTCCACTACTCG
2CPF3CGAGTGAGCAGCAACTGA
B3GACACGTTGCTAGACTGTGT
FIPGACTCGACTGCGTGCTTCCACTCTGGCAGCAGCAAATGC
BIPCAAGCACGGCAAGCGGATCAGATCCTGAACCTGATCCACC
LBTCACCATCAGGATCAGGTTCCG
3NIbF3GCATACTACAAGGACGTGTT
B3TTTCTTCCCTGAATATAACGC
FIPTAGTTGCAACCACTGCCTTCGGTACAACAAAGATATAATTGTCGGA
BIPGAGATAGCCGGGTTCTCAAAGGGCATCCAGATTCAAGTCGTT
LBAAAGCACACTTCATCAGTTCC
LFGACAATTTCAGCCCATCTTTGA
Table 3. Primers for the sequencing of long reads of the WSMV CP and BSMV γb protein.
Table 3. Primers for the sequencing of long reads of the WSMV CP and BSMV γb protein.
Target GeneForward Primer (5′→3′)Reverse Primer (5′→3′)
WSMV coat proteinTCGAGTAGTGGAAGCACTCAGTCCATGACAGATACGTTATTAGATTG
TCATGCGCGGTGCAGATGACACAATGACGTGAGTTGTCCTCATTAG
BSMV γBATGATGGCTACTTTCTCTTGTGTTTACAACTTAGAAACGGAAGAAG
TTCTTGTTTCAGAATATACATGCGCTAAGCTTGAAAGTGAGGTTAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kapytina, A.; Kolchenko, M.; Kerimbek, N.; Pozharskiy, A.S.; Nizamdinova, G.; Taskuzhina, A.; Adilbayeva, K.; Khusnitdinova, M.; Amidullayeva, M.; Moisseyev, R.; et al. Distribution of Wheat-Infecting Viruses and Genetic Variability of Wheat Streak Mosaic Virus and Barley Stripe Mosaic Virus in Kazakhstan. Viruses 2024, 16, 96. https://doi.org/10.3390/v16010096

AMA Style

Kapytina A, Kolchenko M, Kerimbek N, Pozharskiy AS, Nizamdinova G, Taskuzhina A, Adilbayeva K, Khusnitdinova M, Amidullayeva M, Moisseyev R, et al. Distribution of Wheat-Infecting Viruses and Genetic Variability of Wheat Streak Mosaic Virus and Barley Stripe Mosaic Virus in Kazakhstan. Viruses. 2024; 16(1):96. https://doi.org/10.3390/v16010096

Chicago/Turabian Style

Kapytina, Anastasiya, Mariya Kolchenko, Nazym Kerimbek, Alexandr S. Pozharskiy, Gulnaz Nizamdinova, Aisha Taskuzhina, Kamila Adilbayeva, Marina Khusnitdinova, Malika Amidullayeva, Ruslan Moisseyev, and et al. 2024. "Distribution of Wheat-Infecting Viruses and Genetic Variability of Wheat Streak Mosaic Virus and Barley Stripe Mosaic Virus in Kazakhstan" Viruses 16, no. 1: 96. https://doi.org/10.3390/v16010096

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop