Identification and Molecular Characterization of Telosma Mosaic Virus (TelMV) and East Asian Passiflora Virus (EAPV) from Patchouli in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of Viral Sequences from Patchouli Plant Transcriptomic Data Analysis
2.2. Identification of TelMV from Infected Patchouli Plants in the Field by RT-PCR
2.3. Assembly of TelMV Whole Genome from Infected Patchouli Plant
2.4. Sequence Similarity and Phylogenetic Analysis
2.5. Pathogenicity Test of TelMV on Nicotiana benthamiana Plants
3. Results
3.1. De Novo Assembly of Patchouli Transcriptome for Virus Identification
3.2. Identification of TelMV from Infected Patchouli Plants in the Field
3.3. Obtaining the Complete Genome Sequence of TelMV Patchouli Isolate
3.4. Characterization and Phylogenetic Analysis of TelMV
3.5. The P1 Proteins of TelMV from Patchouli and TelMV-Pasfru Are Very Different
3.6. Biological Testing of TelMV on N. benthamiana Plants
3.7. De-Novo Genome Assembly of EAPV from Patchouli Transcriptome
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Soh, S.H.; Jain, A.; Lee, L.Y.; Chin, S.K.; Yin, C.Y.; Jayaraman, S. Techno-economic and profitability analysis of extraction of patchouli oil using supercritical carbon dioxide. J. Clean. Prod. 2021, 297, 126661. [Google Scholar] [CrossRef]
- Lal, R.K.; Chanotiya, C.S.; Singh, V.R.; Kumar, A. Genotype-environment Interaction and genotype selection for yield stability in the commercially important patchouli (Pogostemon cablin (Blanco) Benth) crop. Ind. Crops Prod. 2023, 205, 117400. [Google Scholar] [CrossRef]
- Shen, Y.; Li, W.; Zeng, Y.; Li, Z.; Chen, Y.; Zhang, J.; Zhao, H.; Feng, L.; Ma, D.; Mo, X.; et al. Chromosome-level and haplotype-resolved genome provides insight into the tetraploid hybrid origin of patchouli. Nat. Communn. 2022, 13, 3511. [Google Scholar] [CrossRef]
- Su, Y.; Zeeshan Ul Haq, M.; Liu, X.; Li, Y.; Yu, J.; Yang, D.; Wu, Y.; Liu, Y. A genome-wide identification and expression analysis of the casparian strip membrane domain protein-like gene family in Pogostemon cablin in response to p-HBA-induced continuous cropping obstacles. Plants 2023, 12, 3901. [Google Scholar] [CrossRef]
- Srivastava, S.; Lal, R.K.; Singh, V.R.; Rout, P.K.; Padalia, R.C.; Yadav, A.K.; Bawitlung, L.; Bhatt, D.; Maurya, A.K.; Pal, A.; et al. Chemical investigation and biological activities of Patchouli (Pogostemon cablin (Blanco) Benth) essential oil. Ind. Crops Prod. 2022, 188, 115504. [Google Scholar] [CrossRef]
- Galovičová, L.; Borotová, P.; Valková, V.; Ďúranová, H.; Štefániková, J.; Vukovic, N.L.; Vukic, M.; Kačániová, M. Biological activity of Pogostemon cablin essential oil and its potential use for food preservation. Agronomy 2022, 12, 387. [Google Scholar] [CrossRef]
- Zhang, G.; Wu, Y.; Muhammad, Z.U.H.; Yang, Y.; Yu, J.; Zhang, J.; Yang, D. cDNA cloning, prokaryotic expression and functional analysis of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR) in Pogostemon cablin. Protein Expr. Purif. 2019, 163, 105454. [Google Scholar] [CrossRef]
- Zhang, J.; He, L.; Wu, Y.; Ma, W.; Chen, H.; Ye, Z. Comparative proteomic analysis of Pogostemon cablin leaves after continuous cropping. Protein Expr. Purif. 2018, 152, 13–22. [Google Scholar] [CrossRef] [PubMed]
- Lubbe, A.; Verpoorte, R. Cultivation of medicinal and aromatic plants for specialty industrial materials. Ind. Crops Prod. 2011, 34, 785–801. [Google Scholar] [CrossRef]
- Singh, R.; Singh, M.; Srinivas, A.; Rao, E.P.; Puttanna, K. Assessment of Organic and Inorganic Fertilizers for Growth, Yield and Essential Oil Quality of Industrially Important Plant Patchouli (Pogostemon cablin) (Blanco) Benth. J. Essent. Oil-Bear. Plants 2015, 18, 1–10. [Google Scholar] [CrossRef]
- China Pharmacopoeia Committee CP. Chinese Pharmacopoeia; China Medical Science Press: Beijing, China, 2015; p. 45. [Google Scholar]
- Zeeshan Ul Haq, M.; Yu, J.; Yao, G.; Yang, H.; Iqbal, H.A.; Tahir, H.; Cui, H.; Liu, Y.; Wu, Y. A Systematic Review on the Continuous Cropping Obstacles and Control Strategies in Medicinal Plants. Int. J. Mol. Sci. 2023, 24, 12470. [Google Scholar] [CrossRef] [PubMed]
- Swamy, M.K.; Sinniah, U.R. Patchouli (Pogostemon cablin Benth.): Botany, agrotechnology and biotechnological aspects. Ind. Crops Prod. 2016, 87, 161–176. [Google Scholar]
- Bano, H.; Khan, J.A. Identification of viruses naturally infecting patchouli (Pogostemon cablin (Blanco) Benth.) in India. Biol. Forum. Int. J. 2023, 15, 549–558. [Google Scholar]
- Miftakhurohmah, M.; Noveriza, R. Patchouli viruses: Identification, biological and physical characters, and control strategy. J. Penelit. Dan Pengemb. Pertan. 2015, 34, 1–8. [Google Scholar]
- Pollari, M.E.; Aspelin, W.W.; Wang, L.; Mäkinen, K.M. The molecular Maze of potyviral and host protein interactions. Annu. Rev. Virol. 2024, 11, 147–170. [Google Scholar]
- Inoue-Nagata, A.K.; Jordan, R.; Kreuze, J.; Li, F.; López-Moya, J.J.; Mäkinen, K.; Ohshima, K.; Wylie, S.J. and ICTV Report Consortium. ICTV virus taxonomy profile: Potyviridae 2022. J. Gen. Virol. 2022, 103, 001738. [Google Scholar]
- Cui, H.; Wang, A. The biological impact of the hypervariable N-terminal region of potyviral genomes. Annu. Rev. Virol. 2019, 6, 255–274. [Google Scholar] [CrossRef]
- Wylie, S.J.; Adams, M.; Chalam, C.; Kreuze, J.; López-Moya, J.J.; Ohshima, K.; Praveen, S.; Rabenstein, F.; Stenger, D.; Wang, A.; et al. ICTV virus taxonomy profile: Potyviridae. J. Gen. Virol. 2017, 98, 352–354. [Google Scholar]
- Chung, B.Y.W.; Miller, W.A.; Atkins, J.F.; Firth, A.E. An overlapping essential gene in the Potyviridae. Proc. Natl. Acad. Sci. USA 2008, 105, 5897–5902. [Google Scholar]
- Olspert, A.; Chung, B.Y.W.; Atkins, J.F.; Carr, J.P.; Firth, A.E. Transcriptional slippage in the positive-sense RNA virus family Potyviridae. EMBO Rep. 2015, 16, 995–1004. [Google Scholar]
- Rodamilans, B.; Valli, A.; Mingot, A.; San León, D.; Baulcombe, D.; López-Moya, J.J.; García, J.A. RNA polymerase slippage as a mechanism for the production of frameshift gene products in plant viruses of the Potyviridae family. J. Virol. 2015, 89, 6965–6967. [Google Scholar] [CrossRef] [PubMed]
- Valli, A.A.; Domingo-Calap, M.L.; González de Prádena, A.; García, J.A.; Cui, H.; Desbiez, C.; López-Moya, J.J. Reconceptualizing transcriptional slippage in plant RNA viruses. mBio 2024, 15, e02120-24. [Google Scholar] [CrossRef] [PubMed]
- Ha, C.; Coombs, S.; Revill, P.A.; Harding, R.M.; Vu, M.; Dale, J.L. Design and application of two novel degenerate primer pairs for the detection and complete genomic characterization of potyviruses. Arch. Virol. 2008, 153, 25–36. [Google Scholar] [PubMed]
- Chiemsombat, P.; Prammanee, S.; Pipattanawong, N. Occurrence of Telosma mosaic virus causing passion fruit severe mosaic disease in Thailand and immunostrip test for rapid virus detection. J. Crop Prot. 2014, 63, 41–47. [Google Scholar] [CrossRef]
- Yang, K.; Yan, H.; Song, L.; Jin, P.; Miao, W.; Cui, H. Analysis of the complete genome sequence of a potyvirus from passion fruit suggests its taxonomic classification as a member of a new species. Arch. Virol. 2018, 163, 2583–2586. [Google Scholar]
- Yao, L.Z.; Li, X.Q.; Wang, J.G.; Chen, S.Y.; Wang, X.J. First report of telosma mosaic virus infecting Emperor’s Candlesticks (Senna alata) in China. Plant Dis. 2019, 103, 594. [Google Scholar] [CrossRef]
- Noveriza, R.; Suastika, G.; Hidayat, S.H.; Kartosuwondo, U. Potyvirus Associated with Mosaic Disease on Patchouli (Pogostemon cablin (Blanco) Benth.) Plants in Indonesia; 2012. Available online: https://www.researchgate.net/publication/288277469 (accessed on 21 November 2024).
- Gou, B.; Dai, Z.; Qin, L.; Wang, Y.; Liu, H.; Wang, L.; Liu, P.; Ran, M.; Fang, C.; Zhou, T.; et al. A zinc finger motif in the P1 N terminus, highly conserved in a subset of potyviruses, is associated with the host range and fitness of Telosma mosaic virus. J. Virol. 2023, 97, e01444-22. [Google Scholar]
- Yan, W.; Ye, Z.; Cao, S.; Yao, G.; Yu, J.; Yang, D.; Chen, P.; Zhang, J.; Wu, Y. Transcriptome analysis of two Pogostemon cablin chemotypes reveals genes related to patchouli alcohol biosynthesis. Peer J. 2021, 9, e12025. [Google Scholar]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Shan, H.; Pasin, F.; Tzanetakis, I.E.; Simón-Mateo, C.; García, J.A.; Rodamilans, B. Truncation of a P1 leader proteinase facilitates potyvirus replication in a non-permissive host. Mol. Plant Pathol. 2018, 19, 1504–1510. [Google Scholar] [CrossRef] [PubMed]
- Meera Krishna, B.; Khan, M.A.; Khan, S.T. Next-generation sequencing (NGS) platforms: An exciting era of genome sequence analysis. Microb. Genom. Sustain. Agroecosyst. 2019, 2, 89–109. [Google Scholar]
- Boonham, N.; Kreuze, J.; Winter, S.; van der Vlugt, R.; Bergervoet, J.; Tomlinson, J.; Mumford, R. Methods in virus diagnostics: From ELISA to next generation sequencing. Virus Res. 2014, 186, 20–31. [Google Scholar] [CrossRef]
- Kulski, J.K. Next-generation sequencing—An overview of the history, tools, and “Omic” applications. Next Gener. Seq.-Adv. Appl. Chall. 2016, 10, 61964. [Google Scholar]
- Jones, S.; Baizan-Edge, A.; MacFarlane, S.; Torrance, L. Viral diagnostics in plants using next generation sequencing: Computational analysis in practice. Front. Plant Sci. 2017, 8, 1770. [Google Scholar] [CrossRef]
- Barba, M.; Czosnek, H.; Hadidi, A. Historical perspective, development and applications of next-generation sequencing in plant virology. Viruses 2014, 6, 106–136. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Ding, S.W.; Zhang, Y.; Zhu, S. Identification of viruses and viroids by next-generation sequencing and homology-dependent and homology-independent algorithms. Ann. Rev. Phytopathol. 2015, 53, 425–444. [Google Scholar] [CrossRef]
- Metzker, M.L. Sequencing technologies—The next generation. Nat. Rev. Genet. 2010, 11, 31–46. [Google Scholar] [CrossRef]
- Satam, H.; Joshi, K.; Mangrolia, U.; Waghoo, S.; Zaidi, G.; Rawool, S.; Thakare, R.P.; Banday, S.; Mishra, A.K.; Das, G.; et al. Next-generation sequencing technology: Current trends and advancements. Biology 2023, 12, 997. [Google Scholar] [CrossRef]
- Kutnjak, D.; Tamisier, L.; Adams, I.; Boonham, N.; Candresse, T.; Chiumenti, M.; De Jonghe, K.; Kreuze, J.F.; Lefebvre, M.; Silva, G.; et al. A primer on the analysis of high-throughput sequencing data for detection of plant viruses. Microorganism 2021, 9, 841. [Google Scholar] [CrossRef]
- Vieira, P.; Nemchinov, L.G. A novel species of RNA virus associated with root lesion nematode Pratylenchus penetrans. J. Gen. Virol. 2019, 100, 704–708. [Google Scholar] [CrossRef] [PubMed]
- Kauffmann, C.M.; de Jesus Boari, A.; Silva, J.M.F.; Blawid, R.; Nagata, T. Complete genome sequence of patchouli chlorosis-associated cytorhabdovirus, a new cytorhabdovirus infecting patchouli plants in Brazil. Arch. Virol. 2022, 167, 2817–2820. [Google Scholar] [CrossRef] [PubMed]
- Zaim, M.; Ali, A.; Joseph, J.; Khan, F. Serological and molecular studies of a novel virus isolate causing yellow mosaic of patchouli [Pogostemon cablin (Blanco) Benth]. PLoS ONE 2013, 8, 83790. [Google Scholar] [CrossRef]
- Komorowska, B.; Malinowski, T.; Michalczuk, L. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus. J. Virol. Methods 2010, 168, 242–247. [Google Scholar] [CrossRef]
- Rubio, L.; Galipienso, L.; Ferriol, I. Detection of plant viruses and disease management: Relevance of genetic diversity and evolution. Front. Plant Sci. 2020, 11, 1092. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Jiang, J.; Chen, S.; Wang, F.; Xie, X. Telosma mosaic virus: An emerging plant RNA virus causing production loss in passion fruit across Asia. Plant Pathol. 2024, 73, 242–249. [Google Scholar] [CrossRef]
- Moradi, Z.; Mehrvar, M. Genetic variability and molecular evolution of Bean common mosaic virus populations in Iran: Comparison with the populations in the world. Eur. J. Plant Pathol. 2019, 154, 673–690. [Google Scholar] [CrossRef]
- Nigam, D.; LaTourrette, K.; Souza, P.F.; Garcia-Ruiz, H. Genome-wide variation in potyviruses. Front. Plant Sci. 2019, 10, 1439. [Google Scholar] [CrossRef]
- Iwai, H.; Yamashita, Y.; Nishi, N.; Nakamura, M. The potyvirus associated with the dappled fruit of Passiflora edulis in Kagoshima prefecture, Japan is the third strain of the proposed new species East Asian Passiflora virus (EAPV) phylogenetically distinguished from strains of Passion fruit woodiness virus. Arch. Virol. 2006, 151, 811–818. [Google Scholar]
- Norzihan Abdullah, N.A.; Ismanizan Ismail, I.I.; Vilasini Pillai, V.P.; Ruslan Abdullah, R.A.; Shaiful Adzni Sharifudin, S.A.S. Nucleotide Sequence of the Coat Protein Gene of the Malaysian Passiflora Virus and Its 3′ Non-Coding Region. Am. J. Appl. Sci. 2009, 6, 1633–1636. [Google Scholar]







| Fragment | Sequence | Ta for PCR | Length |
|---|---|---|---|
| TelMV 1 | F = TGGCATCAATCATGATTGGGTCTGT R = CACCACACTGCTCATTGTCGAAGTC | 58 | 1040 |
| TelMV 2 | F = TCAGCCACACCAGAGTTACAATTTTTC R = TATCCATGTTGCTGTGTCACTCATGATGAT | 59 | 863 |
| TelMV 3 | F = GATCGTGCGAGATTGCACATGCAAGG R = GCACGCACTCACAAAGGTAC | 58 | 1201 |
| TelMV 4 | F = TGGTCCGATTTAAGCTTGTGG R = CAGTTATGTTGCTGGAACCAAA | 54 | 1151 |
| TelMV 5 | F = GACCATTAGCTGAAAATGTGAGC R = GGATGCATGCTCCCATCATA | 54 | 962 |
| TelMV 6 | F = CCTCCCAGTCACAACACAGAGTGTCACAAC R = GCTTCACCAAAAGTGTGTTCCA | 56 | 973 |
| TelMV 7 | F = GATTGGTGGTGGATGGATGATGTGGG R = GCTTCACCAAAAGTGTGTTCCA | 58 | 988 |
| TelMV 8 | F = TCATTGAAGGTAAGGATGC R = CAGAACCACTGGCTTATTGTA | 50 | 728 |
| TelMV 9 | F = TGTATCAAGTCCCAGAGGCAGC R = CCCATTCTAGAATTGAGACA | 50 | 1120 |
| TelMV 10 | F = GACAAACTTGGTTCGTCTTTCGCAGAGCT R = AACATGGTGGTATAACCACTCTG | 54 | 1352 |
| 5 RACE-1R 5 RACE-2R 5 RACE-3R 3 RACE-1F 3 RACE-2F | GGTTCCACAATCTCTTTACATGC TACTGATGGCTGCACAGTAGCC GCCACATGGCGCGTTCATTGCAACAC CTGTCACACAGATGAAGGCAGC CTGAGAGGCACACTGCTAGAGATG |
| Closely Related Virus | Family | No. of Contigs | Length of Contigs | % aa Identity | Query Coverage |
|---|---|---|---|---|---|
| Pogostemom alphacytorhabdovirus 1_Pog | Rhabdoviridae | 10 | 319–10,344 | 100 | 27–99 |
| Pogostemom alphacytorhabdovirus 2_Pog | Rhabdoviridae | 23 | 319–10,029 | 56–100 | 42–100 |
| Telosma mosaic virus | Potyviridae | 119 | 200–1008 | 45.83–100 | 44–100 |
| East Asian Passiflora Virus | Potyviridae | 114 | 200–3568 | 50–100 | 50–100 |
| Patchouli chlorosis-associated cytorhabdovirus | Rhabdoviridae | 6 | 642–8865 | 71.55–90 | 34–81 |
| Broad bean wilt virus 2 | Secoviridae | 26 | 200–5776 | 68.09–100 | 48–100 |
| Segment | Genome Position | Length (nt) | Protein Size (aa) | Sequence Identity (nt) | |
|---|---|---|---|---|---|
| Pasfru | Hanoi | ||||
| 5′ UTR | 1–189 | 189 | - | 81.08 | - |
| P1 | 190–1140 | 951 | 317 | 69.18 | 70.59 |
| Hc-Pro | 1141–2511 | 1371 | 457 | 74.25 | 81.04 |
| P3 | 2512–3552 | 1041 | 347 | 72.41 | 77.15 |
| PIPO | 2965–3184 | 219 | 74 | 80.37 | 87.21 |
| 6K1 | 3553–3708 | 156 | 52 | 80.67 | 80.00 |
| CI | 3709–5610 | 1902 | 634 | 79.91 | 83.12 |
| 6K2 | 5611–5769 | 159 | 53 | - | 79.61 |
| NIa-VPg | 5770–6339 | 570 | 190 | 75.81 | 79.32 |
| NIa-pro | 6340–7068 | 729 | 243 | 79.78 | 85.60 |
| Nib | 7069–8619 | 1551 | 517 | 81.56 | 85.37 |
| CP | 8620–9438 | 819 | 273 | 87.44 | 88.48 |
| 3 UTR | 9439–9691 | 253 | - | 88.67 | 93.36 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aziz, A.; Li, N.; Wang, X.; Wang, L.; Wu, Y.; Zeeshan Ul Haq, M.; Dai, Z.; Cui, H. Identification and Molecular Characterization of Telosma Mosaic Virus (TelMV) and East Asian Passiflora Virus (EAPV) from Patchouli in China. Viruses 2024, 16, 1837. https://doi.org/10.3390/v16121837
Aziz A, Li N, Wang X, Wang L, Wu Y, Zeeshan Ul Haq M, Dai Z, Cui H. Identification and Molecular Characterization of Telosma Mosaic Virus (TelMV) and East Asian Passiflora Virus (EAPV) from Patchouli in China. Viruses. 2024; 16(12):1837. https://doi.org/10.3390/v16121837
Chicago/Turabian StyleAziz, Asma, Na Li, Xiaoqing Wang, Linxi Wang, Yougen Wu, Muhammad Zeeshan Ul Haq, Zhaoji Dai, and Hongguang Cui. 2024. "Identification and Molecular Characterization of Telosma Mosaic Virus (TelMV) and East Asian Passiflora Virus (EAPV) from Patchouli in China" Viruses 16, no. 12: 1837. https://doi.org/10.3390/v16121837
APA StyleAziz, A., Li, N., Wang, X., Wang, L., Wu, Y., Zeeshan Ul Haq, M., Dai, Z., & Cui, H. (2024). Identification and Molecular Characterization of Telosma Mosaic Virus (TelMV) and East Asian Passiflora Virus (EAPV) from Patchouli in China. Viruses, 16(12), 1837. https://doi.org/10.3390/v16121837

