Genetic Characterization of Lumpy Skin Disease Viruses Circulating in Lesotho Cattle
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Sample Collection
2.3. Sample Extraction and Processing
2.4. DNA Amplification
2.5. Amplification and Sequencing of Selected CaPV Genes
2.6. Whole-Genome Sequencing of LSDV
2.7. Sequence and Phylogenetic Analysis of CaPV-Marker Genes
2.8. Whole-Genome Reconstruction, Annotation, and SNP Analysis of the Lesotho LSDV Isolate
3. Results
3.1. Investigation of the LSD Outbreak and Clinical Signs
3.2. Molecular Diagnosis of LSDV
3.3. Sequence and Phylogenetic Analysis of the Targeted CaPV Genes
3.4. LSDV Whole Genome Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chouhan, C.S.; Parvin, M.S.; Ali, M.Y.; Sadekuzzaman, M.; Chowdhury, M.G.A.; Ehsan, M.A.; Islam, M.T. Epidemiology and Economic Impact of Lumpy Skin Disease of Cattle in Mymensingh and Gaibandha Districts of Bangladesh. Transbound. Emerg. Dis. 2022, 69, 3405–3418. [Google Scholar] [CrossRef] [PubMed]
- Suwankitwat, N.; Songkasupa, T.; Boonpornprasert, P.; Sripipattanakul, P.; Theerawatanasirikul, S.; Deemagarn, T.; Suwannaboon, M.; Arjkumpa, O.; Buamithup, N.; Hongsawat, A.; et al. Rapid Spread and Genetic Characterisation of a Recently Emerged Recombinant Lumpy Skin Disease Virus in Thailand. Vet. Sci. 2022, 9, 542. [Google Scholar] [CrossRef] [PubMed]
- Tuppurainen, E.S.M.; Venter, E.H.; Shisler, J.L.; Gari, G.; Mekonnen, G.A.; Juleff, N.; Lyons, N.A.; De Clercq, K.; Upton, C.; Bowden, T.R.; et al. Review: Capripoxvirus Diseases: Current Status and Opportunities for Control. Transbound. Emerg. Dis. 2017, 64, 729–745. [Google Scholar] [CrossRef] [PubMed]
- ICTV Taxonomy My Release. 2022. Available online: https://ictv.global/taxonomy (accessed on 17 March 2023).
- Mcinnes, C.J.; Damon, I.K.; Smith, G.L.; Mcfadden, G.; Isaacs, S.N.; Roper, R.L.; Evans, D.H.; Damaso, C.R.; Carulei, O.; Wise, L.M.; et al. ICTV Virus Taxonomy Profile: Poxviridae 2023. J. Gen. Virol. 2023, 104, 001849. [Google Scholar] [CrossRef] [PubMed]
- Abeya, A.; Feyisa, B.; Gezali, A.; Derej, A. Review on Epidemiological Aspects and Economic Impact of Lumpy Skin Disease. J. Dairy Vet. Sci. 2018, 7, 555716. [Google Scholar] [CrossRef]
- Roche, X.; Rozstalnyy, A.; TagoPacheco, D.; Kamata, A.; Pittiglio, C.; Beltran-alcrudo, D.; Bisht, K.; Karki, S.; Kayamori, J.; Larfaoui, F.; et al. Introduction and Spread of Lumpy Skin Disease in South, East and Southeast Asia: Qualitative Risk Assessment and Management, FAO Animal Production and Health Papers; Paper 183; FAO: Rome, Italy, 2020; pp. 3–5. [Google Scholar] [CrossRef]
- Das, M.; Chowdhury, M.; Akter, S.; Mondal, A.; Uddin, M.; Rahman, M.; Rahman, M. An updated review on lumpy skin disease: A perspective of Southeast Asian countries. J. Adv. Biotechnol. Exp. Ther. 2021, 4, 322–333. [Google Scholar] [CrossRef]
- Byadovskaya, O.; Prutnikov, P.; Shalina, K.; Babiuk, S.; Perevozchikova, N.; Korennoy, F.; Chvala, I.; Kononov, A.; Sprygin, A. The changing epidemiology of lumpy skin disease in Russia since the first introduction from 2015 to 2020. Transbound. Emerg. Dis. 2022, 69, e2551–e2562. [Google Scholar] [CrossRef] [PubMed]
- World Organisation for Animal Health (WOAH). Animal Health Data: Lumpy Skin Disease. World Animal Health Information System. 2022. Available online: https://wahis.woah.org/#/ (accessed on 17 September 2023).
- Dubey, A.; Ghosh, N.S.; Gupta, A.; Singh, S. A review on current epidemiology and molecular studies of lumpy skin disease virus-an emerging worldwide threat to domestic animals. J. Med. Pharm. Allied Sci. 2023, 12, 5635–5643. [Google Scholar] [CrossRef]
- Guyassa, C. Epidemiology and diagnostic methods of lumpy skin disease: A Short Review. Int. J. Vet. Sci. Res. 2022, 8, 064–070. [Google Scholar] [CrossRef]
- Liang, Z.; Yao, K.; Wang, S.; Yin, J.; Ma, X.; Yin, X.; Wang, X.; Sun, Y. Understanding the Research Advances on Lumpy Skin Disease: A Comprehensive Literature Review of Experimental Evidence. Front. Microbiol. 2022, 13, 1065894. [Google Scholar] [CrossRef]
- Pandey, N.; Hopker, A.; Prajapati, G.; Rahangdale, N.; Gore, K.; Sargison, N. Observations on Presumptive Lumpy Skin Disease in Native Cattle and Asian Water Buffaloes around the Tiger Reserves of the Central Indian Highlands. N. Z. Vet. J. 2022, 70, 101–108. [Google Scholar] [CrossRef] [PubMed]
- Akther, M.; Akter, S.H.; Sarker, S.; Aleri, J.W.; Annandale, H.; Abraham, S.; Uddin, J.M. Global Burden of Lumpy Skin Disease, Outbreaks, and Future Challenges. Viruses 2023, 15, 1861. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.; Godara, B.; Chander, Y.; Kachhawa, J.P.; Dedar, R.K.; Verma, A.; Riyesh, T.; Pal, Y.; Barua, S.; Tripathi, B.N.; et al. Evidence of lumpy skin disease virus infection in camels. Acta Trop. 2023, 242, 106922. [Google Scholar] [CrossRef] [PubMed]
- Mathewos, M.; Dulo, F.; Tanga, Z.; Sombo, M. Clinicopathological and molecular studies on cattle naturally infected with lumpy skin diseases in selected districts of Wolaita Zone, Southern Ethiopia. BMC Vet. Res. 2022, 18, 297. [Google Scholar] [CrossRef] [PubMed]
- Archana, M.; D’Souza, P.E.; Ojha, R.; Jalali, S. DNA barcoding of flies commonly prevalent in poultry farms of Bengaluru District. J. Entomol. Zool. Stud. 2016, 4, 228–233. [Google Scholar]
- Rouby, S.R.; Safwat, N.M.; Hussein, K.H.; Abdel-Ra’ouf, A.M.; Madkour, B.S.; Abdel-Moneim, A.S.; Hosein, H.I. Lumpy skin disease outbreaks in Egypt during 2017–2018 among sheeppox vaccinated cattle: Epidemiological, pathological, and molecular findings. PLoS ONE 2021, 16, e0258755. [Google Scholar] [CrossRef] [PubMed]
- Mulatu, E.; Feyisa, A. Review: Lumpy skin disease. J. Vet. Sci. Technol. 2018, 9, 1–8. [Google Scholar] [CrossRef]
- Selim, A.; Manaa, E.; Khater, H. Seroprevalence and Risk Factors for Lumpy Skin Disease in Cattle in Northern Egypt. Trop. Anim. Health Prod. 2021, 53, 350. [Google Scholar] [CrossRef] [PubMed]
- Issimov, A.; Kushaliyev, K.; Abekeshev, N.; Molla, W.; Rametov, N.; Bayantassova, S.; Zhanabayev, A.; Paritova, A.; Shalmenov, M.; Ussenbayev, A.; et al. Risk factors associated with lumpy skin disease in cattle in West Kazakhstan. Prev. Vet. Med. 2022, 207, 105660. [Google Scholar] [CrossRef]
- Abutarbush, S.M. Lumpy Skin Disease (Knopvelsiekte, Pseudo-Urticaria, Neethling Virus Disease, Exanthema Nodularis Bovis). In Emerging and Re-Emerging Infectious Diseases of Livestock; Bayry, J., Ed.; Springer: Cham, Switzerland, 2017; pp. 309–326. [Google Scholar] [CrossRef]
- Sprygin, A.; Pestova, Y.; Wallace, D.B.; Tuppurainen, E.; Kononov, A.V. Transmission of lumpy skin disease virus: A short review. Virus Res. 2019, 269, 197637. [Google Scholar] [CrossRef]
- Ardestani, E.G.; Mokhtari, A. Modeling the lumpy skin disease risk probability in central Zagros Mountains of Iran. Prev. Vet. Med. 2020, 176, 104887. [Google Scholar] [CrossRef] [PubMed]
- Bianchini, J.; Simons, X.; Humblet, M.-F.; Saegerman, C. Lumpy Skin Disease: A Systematic Review of Mode of Transmission, Risk of Emergence and Risk Entry Pathway. Viruses 2023, 15, 1622. [Google Scholar] [CrossRef] [PubMed]
- Datten, B.; Chaudhary, A.A.; Sharma, S.; Singh, L.; Rawat, K.D.; Ashraf, M.S.; Alneghery, L.M.; Aladwani, M.O.; Rudayni, H.A.; Dayal, D. An extensive examination of the warning signs, symptoms, diagnosis, available therapies, and prognosis for lumpy skin disease. Viruses 2023, 15, 604. [Google Scholar] [CrossRef] [PubMed]
- Toker, E.B.; Ates, O.; Yeşilbağ, K. Inhibition of bovine and ovine capripoxviruses (Lumpy skin disease virus and Sheeppox virus) by ivermectin occurs at different stages of propagation in vitro. Virus Res. 2022, 310, 198671. [Google Scholar] [CrossRef] [PubMed]
- Haig, D. Lumpy skin disease. Bull. Epizoot. Dis. Afr. 1957, 5, 421–430. [Google Scholar]
- Le Goff, C.; Lamien, C.E.; Fakhfakh, E.; Chadeyras, A.; Aba-Adulugba, E.; Libeau, G.; Tuppurainen, E.; Wallace, D.B.; Adam, T.; Silber, R.; et al. Capripoxvirus G-protein-coupled chemokine receptor: A host-range gene suitable for virus animal origin discrimination. J. Gen. Virol. 2009, 90 Pt 8, 1967–1977. [Google Scholar] [CrossRef]
- Lamien, C.E.; Lelenta, M.; Goger, W.; Silber, R.; Tuppurainen, E.; Matijevic, M.; Luckins, A.G.; Diallo, A. Real time PCR method for simultaneous detection, quantitation and differentiation of capripoxviruses. J. Virol. Methods 2011, 171, 134–140. [Google Scholar] [CrossRef]
- Li, L.; Qi, C.; Li, J.; Nan, W.; Wang, Y.; Chang, X.; Chi, T.; Gong, M.; Ha, D.; De, J.; et al. Quantitative Real-time PCR Detection and Analysis of a Lumpy Skin Disease Outbreak in Inner Mongolia Autonomous Region, China. Front. Vet. Sci. 2022, 9, 936581. [Google Scholar] [CrossRef]
- Jiang, C.; Tao, D.; Geng, Y.; Yang, H.; Xu, B.; Chen, Y.; Hu, C.; Chen, H.; Xie, S.; Guo, A. Sensitive and Specific Detection of Lumpy Skin Disease Virus in Cattle by Crispr-cas12a Fluorescent Assay Coupled with Recombinase Polymerase Amplification. Genes 2022, 13, 734. [Google Scholar] [CrossRef]
- Badhy, S.C.; Chowdhury, M.G.A.; Settypalli, T.B.K.; Cattoli, G.; Lamien, C.E.; Fakir, M.A.U.; Akter, S.; Osmani, M.G.; Talukdar, F.; Begum, N.; et al. Molecular Characterization of Lumpy Skin Disease Virus (LSDV) Emerged in Bangladesh Reveals Unique Genetic Features Compared to Contemporary Field Strains. BMC Vet. Res. 2021, 17, 61. [Google Scholar] [CrossRef]
- Gelaye, E.; Belay, A.; Ayelet, G.; Jenberie, S.; Yami, M.; Loitsch, A.; Tuppurainen, E.; Grabherr, R.; Diallo, A.; Lamien, C.E. Capripox disease in Ethiopia: Genetic differences between field isolates and vaccine strain, and implications for vaccination failure. Antivir. Res. 2015, 119, 28–35. [Google Scholar] [CrossRef] [PubMed]
- Samojlović, M.; Polaček, V.; Gurjanov, V.; Lupulović, D.; Lazić, G.; Petrović, T.; Lazić, S. Detection of antibodies against Lumpy skin disease virus by Virus neutralization test and ELISA methods. Acta Vet. 2019, 69, 47–60. [Google Scholar] [CrossRef]
- Zewdie, G.; Mammo, B.; Gelaye, E.; Getachew, B.; Bayssa, B. Isolation, molecular characterisation and vaccine effectiveness study of lumpy skin disease virus in selected dairy farms of Central Ethiopia. J. Biol. Agric. Healthc. 2019, 9, 1–13. [Google Scholar] [CrossRef]
- Heine, H.G.; Stevens, M.P.; Foord, A.J.; Boyle, D.B. A Capripoxvirus detection PCR and antibody ELISA based on the major antigen p32, the homolog of the vaccinia virus H3L gene. J. Immunol. Methods 1999, 227, 187–196. [Google Scholar] [CrossRef] [PubMed]
- Koirala, P.; Meki, I.K.; Maharjan, M.; Settypalli, B.K.; Manandhar, S.; Yadav, S.K.; Cattoli, G.; Lamien, C.E. Molecular Characterization of the 2020 Outbreak of Lumpy Skin Disease in Nepal. Microorganisms 2022, 10, 539. [Google Scholar] [CrossRef]
- Maw, M.T.; Khin, M.M.; Hadrill, D.; Meki, I.K.; Settypalli, T.B.K.; Kyin, M.M.; Myint, W.W.; Thein, W.Z.; Aye, O.; Palamara, E.; et al. First Report of Lumpy Skin Disease in Myanmar and Molecular Analysis of the Field Virus Isolates. Microorganisms 2022, 10, 897. [Google Scholar] [CrossRef] [PubMed]
- Pareek, C.S.; Smoczynski, R.; Tretyn, A. Sequencing Technologies and Genome Sequencing. J. Appl. Genet. 2011, 52, 413–435. [Google Scholar] [CrossRef]
- Tulman, E.R.; Afonso, C.L.; Lu, Z.; Zsak, L.; Kutish, G.F.; Rock, D.L. Genome of Lumpy Skin Disease Virus. J. Virol. 2001, 75, 7122–7130. [Google Scholar] [CrossRef]
- Breman, F.C.; Haegeman, A.; Krešić, N.; Philips, W.; De Regge, N. Lumpy Skin Disease Virus Genome Sequence Analysis: Putative Spatio-temporal Epidemiology, Single Gene Versus Whole Genome Phylogeny and Genomic Evolution. Viruses 2023, 15, 1471. [Google Scholar] [CrossRef]
- Giani, A.M.; Gallo, G.R.; Gianfranceschi, L.; Formenti, G. Long walk to genomics: History and current approaches to genome sequencing and assembly. Comput. Struct. Biotechnol. J. 2020, 18, 9–19. [Google Scholar] [CrossRef]
- Kumar, A.; Venkatesan, G.; Kushwaha, A.; Poulinlu, G.; Saha, T.; Ramakrishnan, M.A.; Dhar, P.; Kumar, G.S.; Singh, R.K. Genomic characterization of Lumpy Skin Disease virus (LSDV) from India: Circulation of Kenyan-like LSDV strains with unique kelch-like proteins. Acta Trop. 2023, 241, 106838. [Google Scholar] [CrossRef]
- Alkhamis, M.A.; Vanderwaal, K. Spatial and Temporal Epidemiology of Lumpy Skin Disease in the Middle East, 2012–2015. Front. Vet. Sci. 2016, 3, 9. [Google Scholar] [CrossRef]
- Machado, G.; Korennoy, F.; Alvarez, J.; Picasso-Risso, C.; Perez, A.; Vanderwaal, K. Mapping Changes in the Spatiotemporal Distribution of Lumpy Skin Disease Virus. Transbound. Emerg. Dis. 2019, 66, 2045–2057. [Google Scholar] [CrossRef]
- Mathijs, E.; Vandenbussche, F.; Haegeman, A.; King, A.; Nthangeni, B.; Potgieter, C.; Maartens, L.; Borm, S.V.; Clercq, K.D. Complete Genome Sequences of the Neethling-Like Lumpy Skin Disease Virus Strains Obtained Directly from Three Commercial Live Attenuated Vaccines. Genome Announc. 2016, 4, e01255-16. [Google Scholar] [CrossRef]
- Mafirakureva, P.; Saidi, B.; Mbanga, J. Incidence and Molecular Characterisation of Lumpy Skin Disease Virus in Zimbabwe Using the P32 Gene. Trop. Anim. Health Prod. 2017, 49, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Molini, U.; Boshoff, E.; Niel, A.P.; Phillips, J.; Khaiseb, S.; Settypalli, T.B.K.; Dundon, W.G.; Cattoli, G.; Lamien, C.E. Detection of Lumpy Skin Disease Virus in an Asymptomatic Eland (taurotragus Oryx) in Namibia. J. Wildl. Dis. 2021, 57, 708–711. [Google Scholar] [CrossRef]
- Motlhale, M. Heterologous Expression of LSDV Immunogenic Epitopes as TMV Coat Protein Fusions in Nicotiana benthamiana Plants. Master’s Thesis, University of Botswana, Gaborone, Botswana, 2016. Available online: http://hdl.handle.net/10311/1467 (accessed on 9 March 2024).
- World Organization of Animal Health (WOAH). World Animal Health Information System—Lumpy Skin Disease. Available online: https://web.oie.int/hs2/zi_pays_mald.asp?c_pays=112&annee=2004&c_mald=8 (accessed on 17 March 2024).
- Bowden, T.R.; Babiuk, S.L.; Parkyn, G.R.; Copps, J.S.; Boyle, D.B. Capripoxvirus tissue tropism and shedding: A quantitative study in experimentally infected sheep and goats. Virology 2008, 371, 380–393. [Google Scholar] [CrossRef] [PubMed]
- Sendow, I.; Meki, I.K.; Dharmayanti, N.L.P.I.; Hoerudin, H.; Ratnawati, A.; Settypalli, T.B.K.; Ahmed, H.O.; Nuradji, H.; Saepulloh, M.; Adji, R.S. Molecular characterization of recombinant LSDV isolates from 2022 outbreak in Indonesia through phylogenetic networks and whole-genome SNP-based analysis. BMC Genom. 2024, 25, 240. [Google Scholar] [CrossRef]
- Kumar, K. Classical and Bayesian estimation in log-logistic distribution under random censoring. Int. J. Syst. Assur. Eng. Manag. 2018, 9, 440–451. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (itol) V5: An Online Tool for Phylogenetic Tree Display and Annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Robinson, J.T.; Thorvaldsdóttir, H.; Turner, D.; Mesirov, J.P. igv. js: An embeddable JavaScript implementation of the Integrative Genomics Viewer (IGV). Bioinformatics 2023, 39, btac830. [Google Scholar] [CrossRef]
- Jombart, T.; Ahmed, I. Adegenet 1.3-1: New Tools for the Analysis of Genome-wide SNP Data. Bioinformatics 2011, 27, 3070–3071. [Google Scholar] [CrossRef]
- Leigh, J.W.; Bryant, D. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Aleksandr, K.; Olga, B.; David, W.B.; Pavel, P.; Yana, P.; Svetlana, K.; Alexander, N.; Vladimir, R.; Dmitriy, L.; Alexander, S. Non-vector-borne transmission of lumpy skin disease virus. Sci. Rep. 2020, 10, 7436. [Google Scholar] [CrossRef]
- Sprygin, A.; Pestova, Y.; Bjadovskaya, O.; Prutnikov, P.; Zinyakov, N.; Kononova, S.; Ruchnova, O.; Lozovoy, D.; Chvala, I.; Kononov, A. Evidence of recombination of vaccine strains of lumpy skin disease virus with field strains, causing disease. PLoS ONE 2020, 15, e0232584. [Google Scholar] [CrossRef]
- Shumilova, I.; Sprygin, A.; Mazloum, A.; Pronin, V.; Byadovskaya, O.; Babiuk, S.; Donnik, I.; Chvala, I. Comparison of gross pathology between classical and recombinant lumpy skin disease viruses. Viruses 2023, 15, 1883. [Google Scholar] [CrossRef] [PubMed]
- Ochwo, S.; VanderWaal, K.; Munsey, A.; Ndekezi, C.; Mwebe, R.; Okurut, A.R.A.; Nantima, N.; Mwiine, F.N. Spatial and temporal distribution of lumpy skin disease outbreaks in Uganda (2002–2016). BMC Vet. Res. 2018, 14, 174. [Google Scholar] [CrossRef] [PubMed]
- Dao, T.D.; Tran, L.H.; Nguyen, H.D.; Hoang, T.T.; Nguyen, G.H.; Tran, K.V.D.; Nguyen, H.X.; Van Dong, H.; Bui, A.N.; Bui, V.N. Characterization of Lumpy skin disease virus isolated from a giraffe in Vietnam. Transbound. Emerg. Dis. 2022, 69, e3268–e3272. [Google Scholar] [CrossRef]
- Haegeman, A.; Sohier, C.; Mostin, L.; De Leeuw, I.; Van Campe, W.; Philips, W.; De Regge, N.; De Clercq, K. Evidence of lumpy skin disease virus transmission from subclinically infected cattle by Stomoxys calcitrans. Viruses 2023, 15, 1285. [Google Scholar] [CrossRef]
- Mathijs, E.; Vandenbussche, F.; Ivanova, E.; Haegeman, A.; Aerts, L.; De Leeuw, I.; Van Borm, S.; De Clercq, K. Complete coding sequence of a lumpy skin disease virus from an outbreak in Bulgaria in 2016. Microbiol. Resour. Announc. 2020, 9. [Google Scholar] [CrossRef]
- Van Schalkwyk, A.; Kara, P.; Ebersohn, K.; Mather, A.; Annandale, C.H.; Venter, E.H.; Wallace, D.B. Potential link of single nucleotide polymorphisms to virulence of vaccine-associated field strains of lumpy skin disease virus in South Africa. Transbound. Emerg. Dis. 2020, 67, 2946–2960. [Google Scholar] [CrossRef] [PubMed]
- Krotova, A.; Mazloum, A.; van Schalkwyk, A.; Prokhvatilova, L.; Gubenko, O.; Byadovskaya, O.; Chvala, I.; Sprygin, A. The characterization and differentiation of recombinant lumpy skin disease isolates using a region within ORF134. Appl. Microbiol. 2022, 3, 35–44. [Google Scholar] [CrossRef]
- (Menasherow, S.; Rubinstein-Giuni, M.; Kovtunenko, A.; Eyngor, Y.; Fridgut, O.; Rotenberg, D.; Khinich, Y.; Stram, Y. Development of an assay to differentiate between virulent and vaccine strains of lumpy skin disease virus (LSDV). J. Virol. Methods 2014, 199, 95–101. [Google Scholar] [CrossRef] [PubMed]
- Zaghloul, M.; Azooz, M.; Ali, S.; Soliman, H.; Sayed, M.; Kafafy, M.; Morsy, A. Sequencing and phylogenetic analysis of GPCR, RPO30, P32 and EEV glycoprotein genes of lumpy skin disease virus recent isolates in Egypt. J. Virol. Sci. Spec. 2022, 1, 1–11. [Google Scholar]
- Chibssa, T.R.; Sombo, M.; Lichoti, J.K.; Adam, T.I.B.; Liu, Y.; Elraouf, Y.A.; Grabherr, R.; Settypalli, T.B.K.; Berguido, F.J.; Loitsch, A. Molecular analysis of East African lumpy skin disease viruses reveals a mixed isolate with features of both vaccine and field isolates. Microorganisms 2021, 9, 1142. [Google Scholar] [CrossRef]
- van Schalkwyk, A.; Kara, P.; Heath, L. Phylogenomic characterization of historic lumpy skin disease virus isolates from South Africa. Arch. Virol. 2022, 167, 2063–2070. [Google Scholar] [CrossRef]
- Kara, P.; Afonso, C.; Wallace, D.; Kutish, G.; Abolnik, C.; Lu, Z.; Vreede, F.; Taljaard, L.; Zsak, A.; Viljoen, G.J. Comparative sequence analysis of the South African vaccine strain and two virulent field isolates of lumpy skin disease virus. Arch. Virol. 2003, 148, 1335–1356. [Google Scholar] [CrossRef]
- Molini, U.; Aikukutu, G.; Khaiseb, S.; Haindongo, N.N.; Lilungwe, A.C.; Cattoli, G.; Dundon, W.G.; Lamien, C.E. Molecular characterization of lumpy skin disease virus in Namibia, 2017. Arch. Virol. 2018, 163, 2525–2529. [Google Scholar] [CrossRef]
- Modise, B.M.; Settypalli, T.B.K.; Kgotlele, T.; Xue, D.; Ntesang, K.; Kumile, K.; Naletoski, I.; Nyange, J.F.; Thanda, C.; Macheng, K.N. First molecular characterization of poxviruses in cattle, sheep, and goats in Botswana. Virol. J. 2021, 18, 167. [Google Scholar] [CrossRef]
- Haegeman, A.; De Leeuw, I.; Mostin, L.; Campe, W.V.; Aerts, L.; Venter, E.; Tuppurainen, E.; Saegerman, C.; De Clerk, K. Comparative evaluation of lumpy skin disease virus-based live attenuated vaccines. Vaccines 2021, 9, 473. [Google Scholar] [CrossRef]
- Tuppurainen, E.; Dietze, K.; Wolff, J.; Bergmann, H.; Beltran-Alcrudo, D.; Fahrion, A.; Lamien, C.E.; Busch, F.; Sauter-Louis, C.; Conraths, F.J. Vaccines and vaccination against lumpy skin disease. Vaccines 2021, 9, 1136. [Google Scholar] [CrossRef] [PubMed]
- Wolff, J.; Moritz, T.; Schlottau, K.; Hoffmann, D.; Beer, M.; Hoffmann, B. Development of a safe and highly efficient inactivated vaccine candidate against lumpy skin disease virus. Vaccines 2020, 9, 4. [Google Scholar] [CrossRef] [PubMed]
- Matsiela, M.S.; Naicker, L.; Dibakwane, V.S.; Ntombela, N.; Khoza, T.; Mokoena, N. Improved safety profile of inactivated Neethling strain of the lumpy skin disease vaccine. Vaccine X 2022, 12, 100209. [Google Scholar] [CrossRef] [PubMed]
Primer ID | Primer Sequence (3′ to 5′) | Fragment Size bp | Publisher |
---|---|---|---|
CpRPO30-OL1F | CAGCTGTTTGTTTACATTTGATTTTT | 554 | [36] |
CpRPO30-OL1R | TCGTATAGAAACAAGCCTTTAATAGA | ||
CpRPO30-OL2F | TTTGAACACATTTTATTCCAAAAAG | 520 | |
CpRPO30-OL2R | AACCTACATGCATAAACAGAAGC | ||
CpGPCR-OL1F | TGAAAAATTAATCCATTCTTCTAAACA | 617 | |
CpGPCR-OL1R | TCATGTATTTTATAACGATAATGCAAA | ||
CpGPCR-OL2F | TTAGCGGTATAATCATTCCAAATA | 603 | |
CpGPCR-OL2R | GCGATGATTATGATGATTATGAAGTG | ||
CpGPCR-OL3F | CACAATTATATTTCCAAATAATCCAA | 684 | |
CpGPCR-OL3R | TGTACATGTGTAATTTTAATGTTCGTA | ||
EEVGly-F | ATGGGAATAGTATCTGTTGTATACG | 866–931 | [35] |
EEVGly-R | ATGGGAATAGTATCTGTTGTATACG | ||
B22R_CaPVFw | TCATTTTCTTCTAGTTCCGACGA | 863 | [40] |
B22R_CaPVRv | TTCGTTGATGATAAATAACTGGAAA |
Sample | Collection Date | Location | Cq Bowden |
---|---|---|---|
LSD_Leso_484 | 16 January 2022 | Maseru | 23.9 |
LSD_Leso_490 | 16 January 2022 | Leribe | 19.0 |
LSD_Leso_LAC1 | 16 January 2022 | Maseru | 18.3 |
LSD_Leso_LAC2 | 16 January 2022 | Maseru | 21.9 |
LSD_Leso_Sefikeng | 16 January 2021 | Berea | 22.2 |
LSD_Leso_87.2 | 23 February 2022 | Mohales’ Hoek | 23.5 |
LSD_Leso_485 | 17 January 2022 | Maseru | 24.0 |
LSD_Leso_489 | 26 January 2022 | Maseru | 24.7 |
LSD_Leso_584 | 5 February 2022 | Maseru | 25.0 |
LSD_Leso_Ntlama | 20 February 2021 | Berea | 24.1 |
LSD_Leso_Tsakholo | 12 March 2021 | Mafeteng | 23.4 |
LSD_Leso_506 | 11 February 2022 | Berea | 25.0 |
LSD_Leso_585 | 5 January 2022 | Berea | 24.9 |
LSD_Leso_601 | 17 March 2022 | Mafeteng | 26.3 |
LSD_Leso_88 | 6 February 2022 | Maseru | 27.2 |
LSD_Leso_480 | 19 January 2021 | Leribe | 29.0 |
LSD_Leso_605 | 20 January 2022 | Leribe | 28.0 |
LSD_Leso_604 | 17 January 2022 | Maseru | 27.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Makalo, M.J.R.; Settypalli, T.B.K.; Meki, I.K.; Bakhoum, M.T.; Ahmed, H.O.; Phalatsi, M.S.; Ramatla, T.; Onyiche, T.E.; Nionzima-Bohloa, L.; Metlin, A.; et al. Genetic Characterization of Lumpy Skin Disease Viruses Circulating in Lesotho Cattle. Viruses 2024, 16, 762. https://doi.org/10.3390/v16050762
Makalo MJR, Settypalli TBK, Meki IK, Bakhoum MT, Ahmed HO, Phalatsi MS, Ramatla T, Onyiche TE, Nionzima-Bohloa L, Metlin A, et al. Genetic Characterization of Lumpy Skin Disease Viruses Circulating in Lesotho Cattle. Viruses. 2024; 16(5):762. https://doi.org/10.3390/v16050762
Chicago/Turabian StyleMakalo, Mabusetsa Joseph Raporoto, Tirumala Bharani Kumar Settypalli, Irene Kasindi Meki, Mame Thierno Bakhoum, Hatem Ouled Ahmed, Moeketsi Solomon Phalatsi, Tsepo Ramatla, ThankGod Emmanuel Onyiche, Lineo Nionzima-Bohloa, Artem Metlin, and et al. 2024. "Genetic Characterization of Lumpy Skin Disease Viruses Circulating in Lesotho Cattle" Viruses 16, no. 5: 762. https://doi.org/10.3390/v16050762