Hepatitis B Virus Genotypes and Subgenotypes Circulating in Infected Residents in a Country with High Vaccination Rate
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Epidemiological Characterization of the Samples Studied
3.2. HBV DNA Quantification
3.3. Classification of HBV Sequences in Viral Subgenotypes
3.4. Analysis of Resistance Mutations in the RT Region
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nguyen, M.H.; Wong, G.; Gane, E.; Kao, J.H.; Dusheiko, G. Hepatitis B Virus: Advances in Prevention, Diagnosis, and Therapy. Clin. Microbiol. Rev. 2020, 33, e00046-19. [Google Scholar] [CrossRef] [PubMed]
- Alvarado-Mora, M.V.; Pinho, J.R. Distribution of HBV genotypes in Latin America. Antivir. Ther. 2013, 18, 459–465. [Google Scholar] [CrossRef] [PubMed]
- Chambal, L.M.; Samo Gudo, E.; Carimo, A.; Corte Real, R.; Mabundam, N.; Maveja, C.; Vubil, A.; Zicai, A.F.; Bhatt, N.; Antunes, F. HBV infection in untreated HIV-infected adults in Maputo, Mozambique. PLoS ONE 2017, 12, e0181836. [Google Scholar] [CrossRef] [PubMed]
- Hsu, Y.C.; Huang, D.Q.; Nguyen, M.H. Global burden of hepatitis B virus: Current status, missed opportunities and a call for action. Nat. Rev. Gastroenterol. Hepatol. 2023, 20, 524–537. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Hepatitis B Fact Sheets. Available online: http://www.who.int/mediacentre/factsheets/fs204/en/ (accessed on 25 July 2023).
- Zheng, L. Analysis of hepatocellular carcinoma associated with hepatitis B virus. J. Cell. Mol. Med. 2023, 27, 2271–2277. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, A.; Martins, H.C.; Aldir, I.; Bettencourt, J.; Rodrigues, J.; Aleixo, M.J.; Marinho, R.T. Programa Nacional Para as Hepatites Virais; Direção-Geral da Saúde: Lisbon, Portugal, 2019. [Google Scholar]
- Marinho, R.T.; Lavanchy, D. Viral Hepatitis. Viral Hepat. Prev. Board 2011, 19, 1–24. [Google Scholar]
- Instituto Nacional de Saúde Doutor Ricardo Jorge. Inquérito Serológico Nacional 2015–2016: Doenças Evitáveis por Vacinação; INSA IP: Lisbon, Portugal, 2017. [Google Scholar]
- Sunbul, M. Hepatitis B virus genotypes: Global distribution and clinical importance. World J. Gastroenterol. 2014, 20, 5427–5434. [Google Scholar] [CrossRef] [PubMed]
- Kramvis, A. Genotypes and genetic variability of hepatitis B virus. Intervirology 2014, 57, 141–150. [Google Scholar] [CrossRef] [PubMed]
- Lunaček, N.K.; Poljak, M.; Matičič, M. Distribution of hepatitis B virus genotypes in Europe and clinical implications: A review. Acta Dermatovenerol. Alp. Pannonica Adriat. 2018, 27, 141–146. [Google Scholar]
- Liu, Z.; Zhang, Y.; Xu, M.; Li, X.; Zhang, Z. Distribution of hepatitis B virus genotypes and subgenotypes: A meta-analysis. Medicine 2021, 100, e27941. [Google Scholar] [CrossRef]
- Mathew, A.; Ismael, N.; Meeds, H.; Vubil, A.; Zicai, A.F.; Mabunda, N.; Blackard, J.T. Hepatitis B virus genotypes and drug resistance mutations circulating in blood donors in Beira, Mozambique. PLoS ONE 2023, 18, e0281855. [Google Scholar] [CrossRef] [PubMed]
- Ingasia, L.; Wose Kinge, C.; Kramvis, A. Genotype E: The neglected genotype of hepatitis B virus. World J. Hepatol. 2021, 13, 1875–1891. [Google Scholar] [CrossRef] [PubMed]
- Pourkarim, M.R.; Amini-Bavil-Olyaee, S.; Kurbanov, F.; Van Ranst, M.; Tacke, F. Molecular identification of hepatitis B virus genotypes/subgenotypes: Revised classification hurdles and updated resolutions. World J. Gastroenterol. 2014, 20, 7152–7168. [Google Scholar] [CrossRef] [PubMed]
- Velkov, S.; Ott, J.J.; Protzer, U.; Michler, T. The Global Hepatitis B Virus Genotype Distribution Approximated from Available Genotyping Data. Genes 2018, 9, 495. [Google Scholar] [CrossRef] [PubMed]
- Ozaras, R.; Corti, G.; Ruta, S.; Lacombe, K.; Mondelli, M.U.; Irwing, W.L.; Puoti, M.; Khalighi, A.; Santos, M.L.; Harxhi, A.; et al. Differences in the availability of diagnostics and treatment modalities for chronic hepatitis B across Europe. Clin. Microbiol. Infect. 2015, 21, 1027–1032. [Google Scholar] [CrossRef] [PubMed]
- Kramvis, A.; Paraskevis, D. Subgenotype A1 of HBV-tracing human migrations in and out of Africa. Antivir. Ther. 2013, 18, 513–521. [Google Scholar] [CrossRef] [PubMed]
- Hampel, A.; Solbach, P.; Cornberg, M.; Schmidt, R.E.; Behrens, G.M.; Jablonka, A. Current seroprevalence, vaccination and predictive value of liver enzymes for hepatitis B among refugees in Germany. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz 2016, 59, 578–583. [Google Scholar] [CrossRef] [PubMed]
- Coppola, N.; Alessio, L.; Gualdieri, L.; Pisaturo, M.; Sagnelli, C.; Caprio, N.; Maffei, R.; Starace, M.; Angelillo, I.F.; Pasquale, G.; et al. Hepatitis B virus, hepatitis C virus and human immunodeficiency virus infection in undocumented migrants and refugees in southern Italy, January 2012 to June 2013. Eurosurveillance 2015, 20, 30009. [Google Scholar] [CrossRef] [PubMed]
- Revault, P.; Giacopelli, M.; Lefebvre, O.; Veïsse, A.; Vescovacci, K. Infections par le VHB et le VHC chez les personnes migrantes, en situation de vulnérabilité, reçues au Comede entre 2007 et 2016. Bull. Epidémiol. Hebd. 2017, 14–15, 271–276. [Google Scholar]
- Urbanus, A.T.; van de Laar, T.J.; van den Hoek, A.; Zuure, F.R.; Speksnijder, A.G.; Baaten, G.G.; Heijman, T.; Vriend, H.J.; Op de Coul, E.L.; Coutinho, R.A.; et al. Hepatitis C in the general population of various ethnic origins living in the Netherlands: Should non-Western migrants be screened? J. Hepatol. 2011, 55, 1207–1214. [Google Scholar] [CrossRef]
- Tedder, R.S.; Rodger, A.J.; Fries, L.; Ijaz, S.; Thursz, M.; Rosenberg, W.; Naoumov, N.; Banatvala, J.; Williams, R.; Dusheiko, G.; et al. The diversity and management of chronic hepatitis B virus infections in the United Kingdom: A wake-up call. Clin. Infect. Dis. 2013, 56, 951–960. [Google Scholar] [CrossRef] [PubMed]
- Carvalhana, S.C.; Leitão, J.; Alves, A.C.; Bourbon, M.; Cortez-Pinto, H. Hepatitis B and C prevalence in Portugal: Disparity between the general population and high-risk groups. Eur. J. Gastroenterol. Hepatol. 2016, 28, 640–644. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, C.R. Indicadores de Integração de Imigrantes: Relatório Estatístico Anual, 1st ed.; 2023. Available online: https://www.om.acm.gov.pt/publicacoes-om/colecao-imigracao-em-numeros/relatorios-anuais (accessed on 2 October 2023).
- Mota, A.; Guedes, F.; Areias, J.; Pinho, L.; Cardoso, M.F. Perfil epidemiológico e genotípico da infecção pelo vírus da hepatite B no Norte de Portugal. Rev. De Saúde Publica 2010, 44, 1087–1093. [Google Scholar] [CrossRef] [PubMed]
- Sargento, C.; Ferreira, C.; Almeida, A.; Silva, E.; Neto, P. Molecular epidemiology of HBV in Portugal. Vox Sang. 2009, 96, 61. [Google Scholar]
- Koch, C.; Araújo, F. Evolution of Residual Risk for HIV, HCV and HBV, from 1999 to 2010, in Blood Donations of the Centro Hospitalar S. João, EPE, Porto, Portugal. Acta Med. Port. 2013, 26, 371–376. [Google Scholar] [CrossRef] [PubMed]
- Silva, M.J.; Valente, J.; Russo, P.; Calinas, F. Epidemiology of hepatitis B in Portugal. Eur. J. Gastroenterol. Hepatol. 2017, 29, 249–258. [Google Scholar] [CrossRef] [PubMed]
- Marcelino, R.; Ezeonwumelu, I.J.; Janeiro, A.; Mimoso, P.; Matos, S.; Briz, V.; Pimentel, V.; Pingarilho, M.; Tato Marinho, R.; Maria Marcelino, J.; et al. Phylogeography of hepatitis B virus: The role of Portugal in the early dissemination of HBV worldwide. PLoS ONE. 2022, 17, e0276618. [Google Scholar] [CrossRef] [PubMed]
- Coffin, C.S.; Osiowy, C.; Gao, S.; Nishikawa, S.; van der Meer, F.; van Marle, G. Hepatitis B virus (HBV) variants fluctuate in paired plasma and peripheral blood mononuclear cells among patient cohorts during different chronic hepatitis B (CHB) disease phases. J. Viral Hepat. 2015, 22, 416–426. [Google Scholar] [CrossRef]
- Osiowy, C.; Larke, B.; Giles, E. Distinct geographical and demographic distribution of hepatitis B virus genotypes in the Canadian Arctic as revealed through an extensive molecular epidemiological survey. J. Viral Hepat. 2011, 18, e11–e19. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.; He, K.; Wu, B.; Xu, M.; Du, L.; Liu, W.; Liao, P.; Liu, Y.; He, M. A systematic genotype and subgenotype re-ranking of hepatitis B virus under a novel classification standard. Heliyon 2019, 5, e02556. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BIOEDIT: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Thijssen, M.; Lemey, P.; Amini-Bavil-Olyaee, S.; Dellicour, S.; Alavian, S.M.; Tacke, F.; Verslype, C.; Nevens, F.; Pourkarim, M.R. Mass migration to Europe: An opportunity for elimination of hepatitis B virus? Lancet Gastroenterol. Hepatol. 2019, 4, 315–323. [Google Scholar] [CrossRef] [PubMed]
- Lazarevic, I. Clinical implications of hepatitis B virus mutations: Recent advances. World J. Gastroenterol. 2014, 20, 7653–7664. [Google Scholar] [CrossRef] [PubMed]
- Gerlich, W.H. Do HBsAg subdeterminants matter for vaccination against hepatitis B? Virus Genes 2024, 60, 240–242. [Google Scholar] [CrossRef] [PubMed]
- Trickey, A.; Bivegete, S.; Duffell, E.; McNaughton, A.L.; Nerlander, L.; Walker, J.G.; Fraser, H.; Hickman, M.; Vickerman, P.; Brooks-Pollock, E.; et al. Estimating hepatitis B virus prevalence among key population groups for European Union and European Economic Area countries and the United Kingdom: A modelling study. BMC Infect. Dis. 2023, 23, 457. [Google Scholar] [CrossRef] [PubMed]
- Flores, J.E.; Thompson, A.J.; Ryan, M.; Howell, J. The Global Impact of Hepatitis B Vaccination on Hepatocellular Carcinoma. Vaccines 2022, 10, 793. [Google Scholar] [CrossRef]
- Reuter, T.Q.; Gomes-Gouvea, M.; Chuffi, S.; Duque, U.H.; Carvalho, J.A.; Perini, W.; Queiroz, M.M.; Segal, I.M.; Azevedo, R.S.; Pinho, J.R.R. Hepatitis B virus genotypes and subgenotypes and the natural history and epidemiology of hepatitis B. Ann. Hepatol. 2022, 27, 100574. [Google Scholar] [CrossRef]
- Yu, S.J.; Kim, Y.J. Hepatitis B viral load affects prognosis of hepatocellular carcinoma. World J. Gastroenterol. 2014, 20, 12039–12044. [Google Scholar] [CrossRef]
- Breakwell, L.; Tevi-Benissan, C.; Childs, L.; Mihigo, R.; Tohme, R. The status of hepatitis B control in the African region. Pan Afr. Med. J. 2017, 27, 17. [Google Scholar] [CrossRef]
- Roman, S.; Jose-Abrego, A.; Fierro, N.A.; Escobedo-Melendez, G.; Ojeda-Granados, C.; Martinez-Lopez, E.; Panduro, A. Hepatitis B virus infection in Latin America: A genomic medicine approach. World J. Gastroenterol. 2014, 20, 7181–7196. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Usage | Direction | Sequence (5′→3′) | Location 1 | Fragment Size |
---|---|---|---|---|---|
HBVpolyDF | 1st PCR round | Sense | CCTGCTGGTGGCTCCAGTTCAG | 58–79 | 1140 |
HBVpolyDR | Antisense | GTTGCGTCAGCAAACACTTGGC | 1177–1198 | ||
HBVsF01in | 2nd PCR round and sequencing | Sense | ACCCTGYRCCGAACATGGA | 143–161 | 758 |
HBVR743as | Antisense | CAACTCCCAATTACATARCCCA | 880–901 |
Samples Characterization (N = 70) | |||
---|---|---|---|
Region/Country of Birth | N | % | |
Portugal | 26 | 37.1 | |
Eastern Europe | 7 | 10.0 | |
Moldova | 2 | 2.9 | |
Georgia | 2 | 2.9 | |
Romania | 2 | 2.9 | |
Ukraine | 1 | 1.4 | |
Africa | 34 | 48.6 | |
Angola | 14 | 20.0 | |
Cape Verde | 8 | 11.4 | |
Guinea-Bissau | 6 | 8.6 | |
Mozambique | 5 | 7.1 | |
S. Tome and Principe | 1 | 1.4 | |
South America | 3 | 4.3 | |
Argentina | 2 | 2.9 | |
Brazil | 1 | 1.4 |
Region/Country of Birth | HBV DNA Quantification (N = 70) (Interval in IU/mL) | ||||
---|---|---|---|---|---|
<20 1 | [20–1000] | [1000–10,000] | >10,000 | ||
Portugal | 7 | 6 | 9 | 4 | |
Eastern Europe | Georgia | - | 1 | 1 | - |
Romania | - | 1 | 1 | - | |
Moldova | 2 | - | - | - | |
Ukraine | 1 | - | - | - | |
Subtotal | 3 | 2 | 2 | - | |
Africa | Cape Verde | 9 | 1 | 3 | 1 |
Guinea-Bissau | 4 | 3 | 1 | - | |
S. Tome and Principe | 3 | - | - | 3 | |
Angola | 3 | 1 | - | 1 | |
Mozambique | - | 1 | - | - | |
Subtotal | 19 | 6 | 4 | 5 | |
South America | Brazil | 1 | 1 | - | - |
Argentina | 1 | - | - | - | |
Subtotal | 2 | 1 | - | - | |
Total (%) | 31 (44.3%) | 15 (21.4%) | 15 (21.4%) | 9 (12.9%) |
Country of Birth | HBV Genotype/Subgenotype (N = 39) | Total N (%) | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
A 1 | A1 | A2 | A3 | D1 | D3 | D4 | E | F4 | ||
Portugal | - | 8 | 1 | - | - | 3 | 5 | 1 | 1 | 19 (48.7%) |
Eastern Europe | - | - | 2 | - | 2 | - | - | - | - | 4 (10.3%) |
Georgia | - | - | 1 | - | 1 | - | - | - | - | 2 |
Romania | - | - | 1 | - | 1 | - | - | - | - | 2 |
Africa | 1 | 3 | 1 | 1 | - | 1 | - | 8 | - | 15 (38.5%) |
Cape Verde | 1 | 2 | 1 | - | - | - | - | 1 | - | 5 |
Guinea-Bissau | - | - | - | - | - | - | - | 4 | - | 4 |
S. Tome and Principe | - | 1 | - | - | - | - | - | 2 | - | 3 |
Angola | - | - | - | 1 | - | - | - | 1 | - | 2 |
Mozambique | - | - | - | - | - | 1 | - | - | - | 1 |
South America | - | - | - | - | - | 1 | - | - | - | 1 (2.6%) |
Brazil | - | - | - | - | - | 1 | - | - | - | 1 |
Total N (%) | 1 2.6% | 11 28.2% | 4 10.3% | 1 2.6% | 2 5.1% | 5 12.8% | 5 12.8% | 9 23.1% | 1 2.6% | 39 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Silva, C.; Ramos, D.; Quina, M.; Pádua, E. Hepatitis B Virus Genotypes and Subgenotypes Circulating in Infected Residents in a Country with High Vaccination Rate. Viruses 2024, 16, 954. https://doi.org/10.3390/v16060954
Silva C, Ramos D, Quina M, Pádua E. Hepatitis B Virus Genotypes and Subgenotypes Circulating in Infected Residents in a Country with High Vaccination Rate. Viruses. 2024; 16(6):954. https://doi.org/10.3390/v16060954
Chicago/Turabian StyleSilva, Carolina, Diogo Ramos, Miriam Quina, and Elizabeth Pádua. 2024. "Hepatitis B Virus Genotypes and Subgenotypes Circulating in Infected Residents in a Country with High Vaccination Rate" Viruses 16, no. 6: 954. https://doi.org/10.3390/v16060954