New Detection Methods for Cryphonectria Hypovirus 1 (CHV1) through SYBR Green-Based Real-Time PCR and Loop-Mediated Isothermal Amplification (LAMP)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Source of CHV1
2.2. Bavendamm Test
2.3. RNA Extraction, DNase Treatment, and cDNA Synthesis
2.4. Primer Design
2.5. Initial Conditions of Colorimetric LAMP and SYBR Green qPCR
2.6. Sensitivity and Specificity of the LAMP and SYBR Green qPCR
2.7. Comparison of the Assays
3. Results
3.1. Optimization and Validation of Primer Sets for CHV1 Diagnosis Using LAMP and qPCR
3.2. Sensitivity and Specificity Assessment of Novel LAMP and qPCR Assays
3.3. Comparative Analysis of the Methods
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Pearson, M.N.; Beever, R.E.; Boine, B.; Arthur, K. Mycoviruses of filamentous fungi and their relevance to plant pathology. Mol. Plant Pathol. 2009, 10, 115–128. [Google Scholar] [CrossRef] [PubMed]
- International Committee on Taxonomy of Viruses (ICTV). Report on Virus Classification and Taxon Nomenclature. 2023. Available online: https://ictv.global/report# (accessed on 4 September 2023).
- Hillman, B.I.; Shapira, R.; Nuss, D.L. Hypovirulence-associated suppression of host functions in Cryphonectria parasitica can be partially relieved by high light intensity. Phytopathology 1990, 80, 950–956. [Google Scholar] [CrossRef]
- Preisig, O.; Moleleki, N.; Smit, W.A.; Wingfield, B.D.; Wingfield, M.J. A novel RNA mycovirus in a hypovirulent isolate of the plant pathogen Diaporthe ambigua. J. Gen. Virol. 2000, 81, 3107–3114. [Google Scholar] [CrossRef]
- Chu, Y.M.; Jeon, J.J.; Yea, S.J.; Kim, Y.H.; Yun, S.H.; Lee, Y.W.; Kim, K.H. Double-stranded RNA mycovirus from Fusarium graminearum. Appl. Environ. Microbiol. 2002, 68, 2529–2534. [Google Scholar] [CrossRef]
- Chiba, S.; Salaipeth, L.; Lin, Y.H.; Sasaki, A.; Kanematsu, S.; Suzuki, N. A novel bipartite double-stranded RNA mycovirus from the white root rot fungus Rosellinia necatrix: Molecular and biological characterization, taxonomic considerations, and potential for biological control. J. Virol. 2009, 83, 12801–12812. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.C.; Dynek, J.N.; Hillman, B.I.; Milgroom, M.G. Diversity of viruses in Cryphonectria parasitica and C. nitschkei in Japan and China, and partial characterization of a new chrysovirus species. Mycol. Res. 2007, 111, 433–442. [Google Scholar] [CrossRef] [PubMed]
- Anagnostakis, S.L. Chestnut blight: The classical problem of an introduced pathogen. Mycologia 1987, 79, 23–37. [Google Scholar] [CrossRef]
- Robin, C.; Heiniger, U. Chestnut blight in Europe: Diversity of Cryphonectria parasitica, hypovirulence and biocontrol. For. Snow Landsc. Res. 2001, 76, 361–367. [Google Scholar]
- Çakar, D.; Özer, G.; Akıllı Şimşek, S.; Maden, S. Determination of vc and mating types of Cryphonectria parasitica isolates by multiplex PCR and their genetic diversity in 13 chestnut-growing provinces of Turkey. For. Pathol. 2023, 53, e12813. [Google Scholar] [CrossRef]
- Heiniger, U.; Rigling, D. Biological control of chestnut blight in Europe. Annu. Rev. Phytopathol. 1994, 32, 581–599. [Google Scholar] [CrossRef]
- Hillman, B.I.; Suzuki, N. Viruses in the chestnut blight fungus. Adv. Virus Res. 2004, 63, 423–472. [Google Scholar] [PubMed]
- Chiba, S.; Velasco, L.; Ayllón, M.A.; Suzuki, N.; Lee-Marzano, S.Y.; Sun, L.; Sabanadzovic, S.; Turina, M. ICTV virus taxonomy profile: Hypoviridae 2023. J. Gen. Virol. 2023, 104, 001848. [Google Scholar] [CrossRef]
- Jacob-Wilk, D.; Turina, M.; Van Alfen, N.K. Mycovirus Cryphonectria hypovirus 1 elements cofractionate with trans-Golgi network membranes of the fungal host Cryphonectria parasitica. J. Virol. 2006, 80, 6588–6596. [Google Scholar] [CrossRef] [PubMed]
- Han, Z.; Liu, J.; Kong, L.; He, Y.; Wu, H.; Xu, W. A special satellite-like RNA of a novel hypovirus from Pestalotiopsis fici broadens the definition of fungal satellite. PLoS Pathog. 2023, 19, e1010889. [Google Scholar] [CrossRef] [PubMed]
- Krstin, L.; Katanić, Z.; Repar, J.; Ježić, M.; Kobaš, A.; Ćurković-Perica, M. Genetic diversity of Cryphonectria hypovirus 1, a biocontrol agent of chestnut blight, in Croatia and Slovenia. Microb. Ecol. 2020, 79, 148–163. [Google Scholar] [CrossRef] [PubMed]
- McCartney, H.A.; Foster, S.J.; Fraaije, B.A.; Ward, E. Molecular diagnostics for fungal plant pathogens. Pest Manag. Sci. Former. Pestic. Sci. 2003, 59, 129–142. [Google Scholar] [CrossRef] [PubMed]
- Grimaldi, V.; Astuto, A.; Granata, G.; Santuccio, T. Detection of dsRNA in hypovirulent strains of Cryphonectria parasitica by polymerase chain reaction analysis. In Proceedings of the International Congress on Chestnut, Spoleto, Italy, 20–23 October 1993; pp. 20–23. [Google Scholar]
- Allemann, C.; Hoegger, P.; Heiniger, U.; Rigling, D. Genetic variation of Cryphonectria hypoviruses (CHV1) in Europe, assessed using restriction fragment length polymorphism (RFLP) markers. Mol. Ecol. 1999, 8, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Gobbin, D.; Hoegger, P.J.; Heiniger, U.; Rigling, D. Sequence variation and evolution of Cryphonectria hypovirus 1 (CHV-1) in Europe. Virus Res. 2003, 97, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Griffin, G.J.; Robbins, N.; Hogan, E.P.; Farias-Santopietro, G. Nucleotide sequence identification of Cryphonectria hypovirus 1 infecting Cryphonectria parasitica on grafted American chestnut trees 12–18 years after inoculation with a hypovirulent strain mixture. For. Pathol. 2004, 34, 33–46. [Google Scholar] [CrossRef]
- Sotirovski, K.; Milgroom, M.G.; Rigling, D.; Heiniger, U. Occurrence of Cryphonectria hypovirus 1 in the chestnut blight fungus in Macedonia. For. Pathol. 2006, 36, 136–143. [Google Scholar] [CrossRef]
- Castaño, C.; Bassie, L.; Oliach, D.; Gomez, M.; Medina, V.; Liu, B.; Colinas, C. Cryphonectria hypovirus 1 (CHV-1) survey reveals low occurrence and diversity of subtypes in NE Spain. For. Pathol. 2015, 45, 51–59. [Google Scholar] [CrossRef]
- Rigling, D.; Borst, N.; Cornejo, C.; Supatashvili, A.; Prospero, S. Genetic and phenotypic characterization of Cryphonectria hypovirus 1 from Eurasian Georgia. Viruses 2018, 10, 687. [Google Scholar] [CrossRef] [PubMed]
- Chun, J.; Ko, Y.H.; Kim, D.H. Transcriptome analysis of Cryphonectria parasitica infected with Cryphonectria hypovirus 1 (CHV1) reveals distinct genes related to fungal metabolites, virulence, antiviral RNA-silencing, and their regulation. Front. Microbiol. 2020, 11, 1711. [Google Scholar] [CrossRef] [PubMed]
- Romon-Ochoa, P.; Forster, J.; Chitty, R.; Gorton, C.; Lewis, A.; Eacock, A.; Kupper, Q.; Rigling, D.; Pérez-Sierra, A. Canker development and biocontrol potential of CHV-1 infected English isolates of Cryphonectria parasitica is dependent on the virus concentration and the compatibility of the fungal inoculums. Viruses 2022, 14, 2678–2693. [Google Scholar] [CrossRef] [PubMed]
- Romon-Ochoa, P.; Smith, O.; Lewis, A.; Kupper, Q.; Shamsi, W.; Rigling, D.; Pérez-Sierra, A.; Ward, L. Temperature effects on the Cryphonectria hypovirus 1 accumulation and recovery within its fungal host, the chestnut blight pathogen Cryphonectria parasitica. Viruses 2023, 15, 1260–1272. [Google Scholar] [CrossRef]
- Maurer, J.J. Rapid detection and limitations of molecular techniques. Annu. Rev. Food Sci. Technol. 2011, 2, 259–279. [Google Scholar] [CrossRef] [PubMed]
- Çelik, A. A novel technology for the one-step detection of prune dwarf virus: Colorimetric reverse transcription loop-mediated isothermal amplification assay. Crop Prot. 2022, 155, 105910. [Google Scholar] [CrossRef]
- Mahmoudian, A.; Kirkpatrick, N.C.; Coppo, M.; Lee, S.W.; Devlin, J.M.; Markham, P.F.; Browning, G.F.; Noormohammadi, A.H. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus. Avian Pathol. 2011, 40, 237–242. [Google Scholar] [CrossRef]
- Çakar, D. Characterisation of Cryphonectrıa parasitica, the Causal Agent of Chestnut Blight, and Cryphonectria Hypovirus Isolates Obtained from Different Regions of Turkey. Thesis Center of YOK Council of Higher Education. Ph.D. Thesis, (Thesis No. 779512). 2022. Available online: https://tez.yok.gov.tr/UlusalTezMerkezi/giris.jsp (accessed on 25 March 2024).
- Rigling, D.; Heiniger, U.; Hohl, H.R. Reduction of laccase activity in dsRNA-containing hypovirulent strains of Cryphonectria (Endothia) parasitica. Phytopathology 1989, 79, 219–223. [Google Scholar] [CrossRef]
- Feau, N.; Dutech, C.; Brusini, J.; Rigling, D.; Robin, C. Multiple introductions and recombination in Cryphonectria hypovirus 1: Perspective for a sustainable biological control of chestnut blight. Evol. Appl. 2014, 7, 580–596. [Google Scholar] [CrossRef]
- Akıllı, S.; Ulubaş Serçe, Ç.; Katırcıoğlu, Y.Z.; Maden, S.; Rigling, D. Characterization of hypovirulent isolates of the chestnut blight fungus, Cryphonectria parasitica from the Marmara and Black Sea regions of Turkey. Eur. J. Plant Pathol. 2013, 135, 323–334. [Google Scholar] [CrossRef]
- Rigling, D.; Prospero, S. Cryphonectria parasitica, the causal agent of chestnut blight: Invasion history, population biology and disease control. Mol. Plant Pathol. 2018, 19, 7–20. [Google Scholar] [CrossRef] [PubMed]
- Romon-Ochoa, P.; Lewis, A.; Gorton, C.; van der Linde, S.; Pérez-Sierra, A. Effects of growth medium, temperature and mycelium age on CHV-1 accumulation and transmission. For. Ecol. Manag. 2023, 529, 120705–120716. [Google Scholar] [CrossRef]
- Çelik, A.; Morca, A.F.; Emiralioğlu, O.; Yeken, M.Z.; Özer, G.; Çiftçi, V. The use of colorimetric loop-mediated isothermal amplification assay for naked-eye detection of bean common mosaic virus. Physiol. Mol. Plant Pathol. 2023, 125, 102017. [Google Scholar] [CrossRef]
- Nuskern, L.; Stojanović, M.; Milanović-Litre, M.; Šibenik, T.; Ježić, M.; Poljak, I.; Ćurković-Perica, M. Filling the Gap in Southern Europe—Diversity of Cryphonectria parasitica and Associated Mycovirus (Cryphonectria hypovirus 1) in Montenegro. J. Fungi 2022, 8, 552. [Google Scholar] [CrossRef] [PubMed]
- Torres, C.; Vitalis, E.A.; Baker, B.R.; Gardner, S.N.; Torres, M.W.; Dzenitis, J.M. LAVA: An open-source approach to designing LAMP (loop-mediated isothermal amplification) DNA signatures. BMC Bioinform. 2011, 12, 240. [Google Scholar] [CrossRef] [PubMed]
- Alkan, M.; Bayraktar, H.; İmren, M.; Özdemir, F.; Lahlali, R.; Mokrini, F.; Paulitz, T.; Dababat, A.A.; Özer, G. Monitoring of host suitability and defense-related genes in wheat to Bipolaris sorokiniana. J. Fungi 2022, 8, 149. [Google Scholar] [CrossRef] [PubMed]
- Çelik, A.; Emiralioğlu, O.; Yeken, M.Z.; Çiftçi, V.; Özer, G.; Kim, Y.; Baloch, F.S.; Chung, Y.S. A novel study on bean common mosaic virus accumulation shows disease resistance at the initial stage of infection in Phaseolus vulgaris. Front. Genet. 2023, 14, 1136794. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
- Kurosaki, Y.; Takada, A.; Ebihara, H.; Grolla, A.; Kamo, N.; Feldmann, H.; Kawaoka, Y.; Yasuda, J. Rapid and simple detection of Ebola virus by reverse transcription-loop-mediated isothermal amplification. J. Virol. Methods 2007, 141, 78–83. [Google Scholar] [CrossRef]
- Kitamura, M.; Aragane, M.; Nakamura, K.; Adachi, T.; Watanabe, K.; Sasaki, Y. Improved on-site protocol for the DNA-based species identification of Cannabis sativa by loop-mediated isothermal amplification. Biol. Pharm. Bull. 2018, 41, 1303–1306. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Dai, J.; Liu, Y.; Yang, J.; Hou, Q.; Ou, Y.; Ding, Y.; Ma, B.; Chen, H.; Li, M.; et al. Development of a potential penside colorimetric LAMP assay using neutral red for detection of African swine fever virus. Front. Microbiol. 2021, 12, 609821. [Google Scholar] [CrossRef]
- Goto, M.; Honda, E.; Ogura, A.; Nomoto, A.; Hanaki, K.I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 2009, 46, 167–172. [Google Scholar] [CrossRef] [PubMed]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef] [PubMed]
- Çelik, A.; Morca, A.F. Development of colorimetric and real-time loop-mediated isothermal amplification (cr-LAMP) assay for rapid detection of Wheat dwarf virus (WDV). Crop Prot. 2021, 149, 105786. [Google Scholar] [CrossRef]
- Wu, W.; Yin, C.; Yue, A.; Niu, J.; Du, W.; Liu, D.; Zhao, J. Rapid and visual detection of Soybean mosaic virus SC7 with a loop-mediated isothermal amplification strategy. Sens. Actuators B Chem. 2022, 373, 132733. [Google Scholar] [CrossRef]
- Pham, H.M.; Nakajima, C.; Ohashi, K.; Onuma, M. Loop-mediated isothermal amplification for rapid detection of Newcastle disease virus. J. Clin. Microbiol. 2005, 43, 1646–1650. [Google Scholar] [CrossRef] [PubMed]
- Stehlíková, D.; Luchi, N.; Aglietti, C.; Pepori, A.L.; Diez, J.J.; Santini, A. Real-time loop-mediated isothermal amplification assay for rapid detection of Fusarium circinatum. Biotechniques 2020, 69, 11–17. [Google Scholar] [CrossRef]
- Golabi, M.; Flodrops, M.; Grasland, B.; Vinayaka, A.C.; Quyen, T.L.; Nguyen, T.; Bang, D.D.; Wolff, A. Development of reverse transcription loop-mediated isothermal amplification assay for rapid and on-site detection of avian influenza virus. Front. Cell. Infect. Microbiol. 2021, 11, 652048. [Google Scholar] [CrossRef]
- Peltzer, D.; Tobler, K.; Fraefel, C.; Maley, M.; Bachofen, C. Rapid and simple colorimetric loop-mediated isothermal amplification (LAMP) assay for the detection of Bovine alphaherpesvirus 1. J. Virol. Methods 2021, 289, 114041. [Google Scholar] [CrossRef]
- Olveira, J.G.; Souto, S.; Bandín, I.; Dopazo, C.P. Development and validation of a SYBR green real time PCR protocol for detection and quantification of nervous necrosis virus (NNV) using different standards. Animals 2021, 11, 1100. [Google Scholar] [CrossRef] [PubMed]
- Mumford, R.A.; Walsh, K.; Barker, I.; Boonham, N. Detection of Potato mop top virus and Tobacco rattle virus using a multiplex real-time fluorescent reverse-transcription polymerase chain reaction assay. Phytopathology 2000, 90, 448–453. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Dasgupta, I. Development of SYBR Green I based real-time PCR assays for quantitative detection of Rice tungro bacilliform virus and Rice tungro spherical virus. J. Virol. Methods 2012, 181, 86–92. [Google Scholar] [CrossRef]
- Herrera-Vásquez, J.A.; Rubio, L.; Alfaro-Fernández, A.; Debreczeni, D.E.; Font-San-Ambrosio, I.; Falk, B.W.; Ferriol, I. Detection and absolute quantitation of Tomato torrado virus (ToTV) by real time RT-PCR. J. Virol. Methods 2015, 221, 90–94. [Google Scholar] [CrossRef]
- MacKenzie, T.D.; Nie, X.; Singh, M. RT-PCR and real-time RT-PCR methods for the detection of Potato virus Y in potato leaves and tubers. In Plant Virology Protocols: New Approaches to Detect Viruses and Host Responses; Springer: Berlin/Heidelberg, Germany, 2015; pp. 13–26. [Google Scholar]
- Broeders, S.; Huber, I.; Grohmann, L.; Berben, G.; Taverniers, I.; Mazzara, M.; Roosens, N.; Morisset, D. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci. Technol. 2014, 37, 115–126. [Google Scholar] [CrossRef]
- Kokane, A.D.; Kokane, S.B.; Warghane, A.J.; Gubyad, M.G.; Sharma, A.K.; Reddy, M.K.; Ghosh, D.K. A rapid and sensitive reverse transcription–loop-mediated isothermal amplification (RT-LAMP) assay for the detection of Indian Citrus ringspot virus. Plant Dis. 2021, 105, 1346–1355. [Google Scholar] [CrossRef]
- Fan, X.; Du, Y.; Cai, Y.; Zhang, Y.; Zhao, X.; Liang, J.; Yang, D.; Zhang, Q.; Zhang, X.; Zhang, W.; et al. Rapid and sensitive detection of cucumber mosaic virus by reverse transcription loop-mediated isothermal amplification. Acta Biochim. Biophys. Sin. 2019, 51, 223–226. [Google Scholar] [CrossRef] [PubMed]
- Galvez, L.C.; Barbosa, C.F.C.; Koh, R.B.L.; Aquino, V.M. Loop-mediated isothermal amplification (LAMP) assays for the detection of abaca bunchy top virus and banana bunchy top virus in abaca. Crop Prot. 2020, 131, 105101. [Google Scholar] [CrossRef]
- Rizzo, D.; Da Lio, D.; Panattoni, A.; Salemi, C.; Cappellini, G.; Bartolini, L.; Parrella, G. Rapid and sensitive detection of tomato brown rugose fruit virus in tomato and pepper seeds by reverse transcription loop-mediated isothermal amplification assays (real time and visual) and comparison with RT-PCR end-point and RT-qPCR methods. Front. Microbiol. 2021, 12, 640932. [Google Scholar] [CrossRef]
- Candresse, T.; Cambra, M. Causal agent of sharka disease: Historical perspective and current status of Plum pox virus strains. EPPO Bull. 2006, 36, 239–246. [Google Scholar] [CrossRef]
Provinces/ Location | Coordinates | Isolates ID | Culture Color | Color of Bavendamm Test |
---|---|---|---|---|
Bolu/ Akçakoca | 41.010615 N 31.182617 E | B_01 | Cream | Weak |
41.010344 N 31.181339 E | B_02 | Cream | Weak | |
41.010182 N 31.181543 E | B_03 | Cream | Weak | |
41.009988 N 31.182508 E | B_04 | Cream | Intensive | |
41.010036 N 31.181747 E | B_05 | White | Intensive | |
41.013886 N 31.153606 E | B_06 | Cream | Intensive | |
41.013494 N 31.153015 E | B_07 | White | Weak | |
41.013446 N 31.153358 E | B_08 | White | Weak | |
41.013616 N 31.153229 E | B_09 | Cream | Weak | |
41.013340 N 31.154034 E | B_10 | White | Weak | |
Yalova/ Esenköy | 40.624436 N 28.995506 E | YL-10 | supplied by Çakar [31] | |
European tester strains | - | EU-1 | supplied by Dr. Daniel Rigling and Dr. Paolo Cortesi | |
- | EU-2 |
Assay | Target | Primer | Sequence (5′–3′) | Length (bp) |
---|---|---|---|---|
LAMP | ORF A | F3 | GCGCGATACGAGGTGAAC | 18 |
B3 | TTGGTCAAGCCAGCAAGG | 18 | ||
FIP | GTTTCTTGGCCATGTGCGACCGTCGTCACAAGGCCGAAC | 39 | ||
BIP | AAGGACTCGTTCTTCCGACGCCAGCAAGTGACGATCACGC | 40 | ||
qPCR | ORF B | F | CCGTTTATCACTGGATGTACCC | 22 |
R | TGATAGATGAGGAGCCTATCGAG | 23 |
Samples | Bavendamm | PCR | LAMP | qPCR |
---|---|---|---|---|
1 | + | + | + | + |
2 | + | + | + | + |
3 | - | + | + | + |
4 | + | + | + | + |
5 | + | + | + | + |
6 | - | + | + | + |
7 | + | + | + | + |
8 | + | + | + | + |
9 | - | + | + | + |
10 | + | + | + | + |
EU1 | - | - | - | - |
EU12 | - | - | - | - |
ddH2O | - | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Çelik, A.; Çakar, D.; Derviş, S.; Morca, A.F.; Akıllı Şimşek, S.; Romon-Ochoa, P.; Özer, G. New Detection Methods for Cryphonectria Hypovirus 1 (CHV1) through SYBR Green-Based Real-Time PCR and Loop-Mediated Isothermal Amplification (LAMP). Viruses 2024, 16, 1203. https://doi.org/10.3390/v16081203
Çelik A, Çakar D, Derviş S, Morca AF, Akıllı Şimşek S, Romon-Ochoa P, Özer G. New Detection Methods for Cryphonectria Hypovirus 1 (CHV1) through SYBR Green-Based Real-Time PCR and Loop-Mediated Isothermal Amplification (LAMP). Viruses. 2024; 16(8):1203. https://doi.org/10.3390/v16081203
Chicago/Turabian StyleÇelik, Ali, Deniz Çakar, Sibel Derviş, Ali Ferhan Morca, Seçil Akıllı Şimşek, Pedro Romon-Ochoa, and Göksel Özer. 2024. "New Detection Methods for Cryphonectria Hypovirus 1 (CHV1) through SYBR Green-Based Real-Time PCR and Loop-Mediated Isothermal Amplification (LAMP)" Viruses 16, no. 8: 1203. https://doi.org/10.3390/v16081203