Detection of Bombali Virus in a Mops condylurus Bat in Kyela, Tanzania
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bat Sampling
2.2. Taxonomic Assignment
2.3. Molecular Screening
2.4. High-Throughput Sequencing
2.5. Phylogenetic Analyses
2.6. Virus Isolation
2.7. Serological Investigation
3. Results
3.1. Taxonomic Assignment
3.2. Molecular BOMV Testing and Sequencing
3.3. Phylogenetic Analyses
3.4. Virus Isolation and Serology
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A. Figures
Appendix B. Tables
Primer/Probe | Target | Sequence | Source |
---|---|---|---|
Filo_UCD_qFor | BOMV | TCTCGACGAAGGTCATTAGCGA | Goldstein et al., 2018 [6] |
Filo_UCD_qRev | BOMV | TTGCTCTGGTACTCGCTTGGT | Goldstein et al., 2018 [6] |
Filo_UCD_probe | BOMV | FAM-TGCTGGGATGCTGTCTTTGAGCCT-BHQ | Goldstein et al., 2018 [6] |
PanFiloVMC_F2 | Filoviridae | GCNTTYCCNAGYAAYATGATGGT | In-house protocol, Charité |
PanFiloVMC_F3 | Filoviridae | TATTGCAYCARGCNTCNTGGCA | In-house protocol, Charité |
PanFiloVMC_R1 | Filoviridae | TGTNATRCAYTGRTTRTCNCC | In-house protocol, Charité |
CytB-outF | Mammalian Cytochrome B | CGAAGCTTGATATGAAAAACCATCGTTG | O’Brien et al., 2009 [29] |
CytB-inR | Mammalian Cytochrome B | AGTGGRTTRGCTGGTGTRTARTTGTC | O’Brien et al., 2009 [29] |
Genus | Species | Virus | Isolate | Accession |
---|---|---|---|---|
Cuevavirus | Cuevavirus lloviuense | Lloviu virus | Lloviu virus/M.schreibersii-wt/ESP/2003/Asturias-Bat86 | JF828358 |
Dianlovirus | Dianlovirus mengalense | Mênglà virus | Měnglà virus/Rousettus-wt/CHN/2015/Shārén-Bat9447-1 | KX371887 |
Orthoebolavirus | Orthoebolavirus bombaliense | Bombali virus | Bombali virus/M.condylurus-wt/SLE/2016/PREDICT_SLAB000156 | MF319185 |
Orthoebolavirus | Orthoebolavirus budybugyoense | Bundibugyo virus | Bundibugyo virus/H.sapiens-tc/UGA/2007/Butalya-811250 | FJ217161 |
Orthoebolavirus | Orthoebolavirus restonense | Reston virus | Reston virus/M.fascicularis-tc/USA/1989/Philippines89-Pennsylvania | AF522874 |
Orthoebolavirus | Orthoebolavirus sudanense | Sudan virus | Sudan virus/H.sapiens-tc/UGA/2000/Gulu-808892 | AY729654 |
Orthoebolavirus | Orthoebolavirus taiense | Taï Forest virus | Taï Forest virus/H.sapiens-tc/CIV/1994/Pauléoula-CI | FJ217162 |
Orthoebolavirus | Orthoebolavirus zairense | Ebola virus | Ebola virus/H.sapiens-tc/COD/1976/Yambuku-Mayinga | AF086833 |
Orthoebolavirus | Orthoebolavirus zairense | Ebola virus | Zaire ebolavirus isolate Ebola virus/H.sapiens-tc/COD/1995/Zaire-199510621 genomic sequence, sequence | KU978803 |
Orthoebolavirus | Orthoebolavirus zairense | Ebola virus | Zaire ebolavirus isolate H.sapiens-tc/GIN/14/WPG-C05, complete genome | KP096420 |
Orthomarburgvirus | Orthomarburgvirus marburgense | Marburg virus | Marburg virus/H.sapiens-tc/KEN/1980/Mt. Elgon-Musoke | DQ217792 |
Orthomarburgvirus | Orthomarburgvirus marburgense | Ravn virus | Ravn virus/H.sapiens-tc/KEN/1987/Kitum Cave-810040 | DQ447649 |
Set1 | Set2 | |
---|---|---|
MLE isochronous | −30,714 | −30,711 |
MLE tip-dated | −30,715 | −30,712 |
Log Bayes factor | 1 | 1 |
References
- WHO. Ebola Virus Disease. Available online: https://www.who.int/news-room/fact-sheets/detail/ebola-virus-disease (accessed on 21 November 2022).
- Keita, A.K.; Koundouno, F.R.; Faye, M.; Dux, A.; Hinzmann, J.; Diallo, H.; Ayouba, A.; Le Marcis, F.; Soropogui, B.; Ifono, K.; et al. Resurgence of Ebola virus in 2021 in Guinea suggests a new paradigm for outbreaks. Nature 2021, 597, 539–543. [Google Scholar] [CrossRef] [PubMed]
- Kinganda-Lusamaki, E.; Whitmer, S.; Lokilo-Lofiko, E.; Amuri-Aziza, A.; Muyembe-Mawete, F.; Makangara-Cigolo, J.C.; Makaya, G.; Mbuyi, F.; Whitesell, A.; Kallay, R.; et al. 2020 Ebola virus disease outbreak in Équateur Province, Democratic Republic of the Congo: A retrospective genomic characterisation. Lancet Microbe 2024, 5, e109–e118. [Google Scholar] [CrossRef]
- Leroy, E.M.; Kumulungui, B.; Pourrut, X.; Rouquet, P.; Hassanin, A.; Yaba, P.; Delicat, A.; Paweska, J.T.; Gonzalez, J.P.; Swanepoel, R. Fruit bats as reservoirs of Ebola virus. Nature 2005, 438, 575–576. [Google Scholar] [CrossRef]
- Olival, K.J.; Hayman, D.T. Filoviruses in bats: Current knowledge and future directions. Viruses 2014, 6, 1759–1788. [Google Scholar] [CrossRef]
- Mari Saez, A.; Weiss, S.; Nowak, K.; Lapeyre, V.; Zimmermann, F.; Dux, A.; Kuhl, H.S.; Kaba, M.; Regnaut, S.; Merkel, K.; et al. Investigating the zoonotic origin of the West African Ebola epidemic. EMBO Mol. Med. 2015, 7, 17–23. [Google Scholar] [CrossRef]
- Goldstein, T.; Anthony, S.J.; Gbakima, A.; Bird, B.H.; Bangura, J.; Tremeau-Bravard, A.; Belaganahalli, M.N.; Wells, H.L.; Dhanota, J.K.; Liang, E.; et al. The discovery of Bombali virus adds further support for bats as hosts of ebolaviruses. Nat. Microbiol. 2018, 3, 1084–1089. [Google Scholar] [CrossRef] [PubMed]
- Karan, L.S.; Makenov, M.T.; Korneev, M.G.; Sacko, N.; Boumbaly, S.; Yakovlev, S.A.; Kourouma, K.; Bayandin, R.B.; Gladysheva, A.V.; Shipovalov, A.V.; et al. Bombali Virus in Mops condylurus Bats, Guinea. Emerg. Infect. Dis. 2019, 25, 1774. [Google Scholar] [CrossRef]
- Forbes, K.M.; Webala, P.W.; Jaaskelainen, A.J.; Abdurahman, S.; Ogola, J.; Masika, M.M.; Kivisto, I.; Alburkat, H.; Plyusnin, I.; Levanov, L.; et al. Bombali Virus in Mops condylurus Bat, Kenya. Emerg. Infect. Dis. 2019, 25, 955. [Google Scholar] [CrossRef]
- Lebarbenchon, C.; Goodman, S.M.; Hoarau, A.O.G.; Le Minter, G.; Dos Santos, A.; Schoeman, M.C.; Léculier, C.; Raoul, H.; Gudo, E.S.; Mavingui, P. Bombali Ebolavirus in Mops condylurus Bats (Molossidae), Mozambique. Emerg. Infect. Dis. 2022, 28, 2583–2585. [Google Scholar] [CrossRef] [PubMed]
- Kareinen, L.; Ogola, J.; Kivistö, I.; Smura, T.; Aaltonen, K.; Jääskeläinen, A.J.; Kibiwot, S.; Masika, M.M.; Nyaga, P.; Mwaengo, D.; et al. Range Expansion of Bombali Virus in Mops condylurus Bats, Kenya, 2019. Emerg. Infect. Dis. 2020, 26, 3007–3010. [Google Scholar] [CrossRef]
- Kareinen, L.; Airas, N.; Kotka, S.T.; Masika, M.M.; Aaltonen, K.; Anzala, O.; Ogola, J.; Webala, P.W.; Vapalahti, O.; Sironen, T.; et al. No Substantial Histopathologic Changes in Mops condylurus Bats Naturally Infected with Bombali Virus, Kenya. Emerg. Infect. Dis. 2023, 29, 1029–1032. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Kapli, P.; Pavlidis, P.; Stamatakis, A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics 2013, 29, 2869–2876. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Godzik, A. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 2006, 22, 1658–1659. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Anisimova, M.; Gil, M.; Dufayard, J.F.; Dessimoz, C.; Gascuel, O. Survey of branch support methods demonstrates accuracy, power, and robustness of fast likelihood-based approximation schemes. Syst. Biol. 2011, 60, 685–699. [Google Scholar] [CrossRef]
- Yang, X.L.; Zhang, Y.Z.; Jiang, R.D.; Guo, H.; Zhang, W.; Li, B.; Wang, N.; Wang, L.; Waruhiu, C.; Zhou, J.H.; et al. Genetically Diverse Filoviruses in Rousettus and Eonycteris spp. Bats, China, 2009 and 2015. Emerg. Infect. Dis. 2017, 23, 482–486. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Jäger, G. ClipAndMerge. Available online: https://github.com/apeltzer/ClipAndMerge.
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummond, A.J.; Rambaut, A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef]
- Duchene, S.; Lemey, P.; Stadler, T.; Ho, S.Y.W.; Duchene, D.A.; Dhanasekaran, V.; Baele, G. Bayesian Evaluation of Temporal Signal in Measurably Evolving Populations. Mol. Biol. Evol. 2020, 37, 3363–3379. [Google Scholar] [CrossRef] [PubMed]
- Duchene, S.; Featherstone, L.; Haritopoulou-Sinanidou, M.; Rambaut, A.; Lemey, P.; Baele, G. Temporal signal and the phylodynamic threshold of SARS-CoV-2. Virus Evol. 2020, 6, veaa061. [Google Scholar] [CrossRef] [PubMed]
- Bokelmann, M.; Edenborough, K.; Hetzelt, N.; Kreher, P.; Lander, A.; Nitsche, A.; Vogel, U.; Feldmann, H.; Couacy-Hymann, E.; Kurth, A. Utility of primary cells to examine NPC1 receptor expression in Mops condylurus, a potential Ebola virus reservoir. PLoS Neglected Trop. Dis. 2020, 14, e0007952. [Google Scholar] [CrossRef] [PubMed]
- Ayouba, A.; Touré, A.; Butel, C.; Keita, A.K.; Binetruy, F.; Sow, M.S.; Foulongne, V.; Delaporte, E.; Peeters, M. Development of a Sensitive and Specific Serological Assay Based on Luminex Technology for Detection of Antibodies to Zaire Ebola Virus. J. Clin. Microbiol. 2017, 55, 165–176. [Google Scholar] [CrossRef] [PubMed]
- De Nys, H.M.; Kingebeni, P.M.; Keita, A.K.; Butel, C.; Thaurignac, G.; Villabona-Arenas, C.J.; Lemarcis, T.; Geraerts, M.; Vidal, N.; Esteban, A.; et al. Survey of Ebola Viruses in Frugivorous and Insectivorous Bats in Guinea, Cameroon, and the Democratic Republic of the Congo, 2015–2017. Emerg. Infect. Dis. 2018, 24, 2228–2240. [Google Scholar] [CrossRef] [PubMed]
- Schuh, A.J.; Amman, B.R.; Jones, M.E.; Sealy, T.K.; Uebelhoer, L.S.; Spengler, J.R.; Martin, B.E.; Coleman-McCray, J.A.; Nichol, S.T.; Towner, J.S. Modelling filovirus maintenance in nature by experimental transmission of Marburg virus between Egyptian rousette bats. Nat. Commun. 2017, 8, 14446. [Google Scholar] [CrossRef] [PubMed]
- Natesan, M.; Jensen, S.M.; Keasey, S.L.; Kamata, T.; Kuehne, A.I.; Stonier, S.W.; Lutwama, J.J.; Lobel, L.; Dye, J.M.; Ulrich, R.G. Human Survivors of Disease Outbreaks Caused by Ebola or Marburg Virus Exhibit Cross-Reactive and Long-Lived Antibody Responses. Clin. Vaccine Immunol. CVI 2016, 23, 717–724. [Google Scholar] [CrossRef] [PubMed]
- Allela, L.; Boury, O.; Pouillot, R.; Delicat, A.; Yaba, P.; Kumulungui, B.; Rouquet, P.; Gonzalez, J.P.; Leroy, E.M. Ebola virus antibody prevalence in dogs and human risk. Emerg. Infect. Dis. 2005, 11, 385–390. [Google Scholar] [CrossRef]
- Bodmer, B.S.; Breithaupt, A.; Heung, M.; Brunetti, J.E.; Henkel, C.; Müller-Guhl, J.; Rodríguez, E.; Wendt, L.; Winter, S.L.; Vallbracht, M.; et al. In vivo characterization of the novel ebolavirus Bombali virus suggests a low pathogenic potential for humans. Emerg. Microbes Infect. 2023, 12, 2164216. [Google Scholar] [CrossRef]
Species | Country | BOMV PCR (n Positive/n Tested) | Seroreactivity (Antigen) |
---|---|---|---|
M. condylurus | Tanzania | 1/70 | 1/53 (EBOV NP) |
Côte d’Ivoire | 0/13 | 0/12 | |
Chaerephon pumilus/leucogaster group | Tanzania | 0/20 | 0/14 |
Côte d’Ivoire | 0/89 | 1/33 (SUDV NP) | |
Chaerephon cf. major | Tanzania | 0/0 | 0/0 |
Côte d’Ivoire | 0/156 | 1/115 (EBOV GP; RESTV GP) | |
Chaerephon sp. | Tanzania | 0/0 | 0/0 |
Côte d’Ivoire | 0/1 | 0/1 |
Shotgun Sequencing | Target Enrichment | |
---|---|---|
Total reads after trimming | 25,047,869 | 2,725,836 |
Reads mapped to BOMV reference genome | 0 | 70,059 |
Unique reads mapped to BOMV reference genome | 0 | 19 |
Sites covered 1× | 0 | 411 |
Sites covered 3× | 0 | 404 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Düx, A.; Lwitiho, S.E.; Ayouba, A.; Röthemeier, C.; Merkel, K.; Weiss, S.; Thaurignac, G.; Lander, A.; Kouadio, L.; Nowak, K.; et al. Detection of Bombali Virus in a Mops condylurus Bat in Kyela, Tanzania. Viruses 2024, 16, 1227. https://doi.org/10.3390/v16081227
Düx A, Lwitiho SE, Ayouba A, Röthemeier C, Merkel K, Weiss S, Thaurignac G, Lander A, Kouadio L, Nowak K, et al. Detection of Bombali Virus in a Mops condylurus Bat in Kyela, Tanzania. Viruses. 2024; 16(8):1227. https://doi.org/10.3390/v16081227
Chicago/Turabian StyleDüx, Ariane, Sudi E. Lwitiho, Ahidjo Ayouba, Caroline Röthemeier, Kevin Merkel, Sabrina Weiss, Guillaume Thaurignac, Angelika Lander, Leonce Kouadio, Kathrin Nowak, and et al. 2024. "Detection of Bombali Virus in a Mops condylurus Bat in Kyela, Tanzania" Viruses 16, no. 8: 1227. https://doi.org/10.3390/v16081227