Characterization of Genetic Diversity in the Capsid Protein Gene of Grapevine Fleck Virus and Development of a New Real-Time RT-PCR Assay
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Virus Source
2.2. High Throughput Sequencing
2.3. Sequence and Phylogenetic Analyses
2.4. Development of a New GFkV RT-qPCR Assay
2.5. RT-qPCR Assay Validation
2.6. Large-Scale Testing Using the New Assay
3. Results
3.1. New Genetic Diversity among GFkV Isolates
3.2. Assay Design and Validation
3.3. Large-Scale Testing by GFkV-CP Assay
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bisson, L.F.; Waterhouse, A.L.; Ebeler, S.E.; Walker, M.A.; Lapsley, J.T. The Present and Future of the International Wine Industry. Nature 2002, 418, 696–699. [Google Scholar] [CrossRef] [PubMed]
- Wilcox, W.F.; Gubler, W.D.; Uyemoto, J.K. Compendium of Grape Diseases, Disorders, and Pests; APS Press, The American Phytopathological Society: St. Paul, MN, USA, 2015; ISBN 0-89054-479-4. [Google Scholar]
- Fuchs, M. Grapevine Virology Highlights: 2018–2023. In Proceedings of the 20th Conference of the International Council for the Study of Virus and Virus-Like Diseases of the Grapevine, Thessaloniki, Greece, 25–29 September 2023; pp. 18–26. [Google Scholar]
- Sabanadzovic, S.; Aboughanem-Sabanadzovic, N.; Martelli, G. Grapevine Fleck and Similar Viruses. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Springer: Berlin/Heidelberg, Germany, 2017; pp. 331–349. [Google Scholar]
- Wilcox, W.F.; Gubler, W.D.; Uyemoto, J.K. PART I: Diseases Caused by Biotic Factors. In Compendium of Grape Diseases, Disorders, and Pests, 2nd ed.; Wilcox, W.F., Gubler, W.D., Uyemoto, J.K., Eds.; Diseases and Pests Compendium Series; The American Phytopathological Society: St. Paul, MN, USA, 2015; pp. 17–146. ISBN 978-0-89054-481-5. [Google Scholar]
- Huttinga, H. Sensitivity of Indexing Procedures for Viruses and Viroids. Adv. Bot. Res. 1996, 23, 59–72. [Google Scholar]
- Credi, R.; Babini, A.R. Effects of Virus and Virus-Like Infections on Growth, Yield, and Fruit Quality of Albana and Trebbiano Romagnolo Grapevines. Am. J. Enol. Vitic. 1997, 48, 7. [Google Scholar] [CrossRef]
- Osman, F.; Leutenegger, C.; Golino, D.; Rowhani, A. Comparison of Low-Density Arrays, RT-PCR and Real-Time TaqMan RT-PCR in Detection of Grapevine Viruses. J. Virol. Methods 2008, 149, 292–299. [Google Scholar] [CrossRef]
- Diaz-Lara, A.; Stevens, K.A.; Klaassen, V.; Hwang, M.S.; Al Rwahnih, M. Sequencing a Strawberry Germplasm Collection Reveals New Viral Genetic Diversity and the Basis for New RT-qPCR Assays. Viruses 2021, 13, 1442. [Google Scholar] [CrossRef] [PubMed]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A Virus Classification Tool Based on Pairwise Sequence Alignment and Identity Calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef]
- Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A New and Scalable Tool for the Selection of DNA and Protein Evolutionary Models. Mol. Biol. Evol. 2020, 37, 291–294. [Google Scholar] [CrossRef]
- Bouckaert, R.; Vaughan, T.G.; Barido-Sottani, J.; Duchene, S.; Fourment, M.; Gavryushkina, A.; Heled, J.; Jones, G.; Kuhnert, D.; De Maio, N.; et al. BEAST 2.5: An Advanced Software Platform for Bayesian Evolutionary Analysis. PLoS Comput. Biol. 2019, 15, e1006650. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Puckett, J.; Al Rwahnih, M.; Klassen, V.; Golino, D. The Davis Grapevine Virus Collection—A Current Perspective. In Proceedings of the 19th Congress of International Council for the Study of Virus and Virus-Like Diseases of the Grapevine (ICVG), Santiago, Chile, 9–12 April 2018. [Google Scholar]
- Diaz-Lara, A.; Stevens, K.; Klaassen, V.; Golino, D.; Al Rwahnih, M. Comprehensive Real-Time RT-PCR Assays for the Detection of Fifteen Viruses Infecting Prunus spp. Plants 2020, 9, 273. [Google Scholar] [CrossRef]
- Osman, F.; Rowhani, A. Application of a Spotting Sample Preparation Technique for the Detection of Pathogens in Woody Plants by RT-PCR and Real-Time PCR (TaqMan). J. Virol. Methods 2006, 133, 130–136. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Lara, A.; Klaassen, V.; Stevens, K.; Sudarshana, M.R.; Rowhani, A.; Maree, H.J.; Chooi, K.M.; Blouin, A.G.; Habili, N.; Song, Y.; et al. Characterization of Grapevine Leafroll-Associated Virus 3 Genetic Variants and Application towards RT-qPCR Assay Design. PLoS ONE 2018, 13, e0208862. [Google Scholar] [CrossRef] [PubMed]
- Dreher, T.; Edwards, M.; Haenni, A.L.; Hammond, R.W.; Jupin, I.; Koenig, R.; Sabanadzovic, S.; Martelli, G.P. Family Tymoviridae. In Virus Taxonomy—Classification and Nomenclature of Viruses (Ninth Report of the International Committee on Taxonomy of Viruses); King, A.M.Q., Lefkowitz, E., Adams, M.J., Carstens, E.B., Eds.; Elsevier: Amsterdam, The Netherlands, 2012; pp. 944–952. [Google Scholar]
- Sabanadzovic, S.; Abou-Ghanem, N.; Castellano, M.A.; Digiaro, M.; Martelli, G.P. Grapevine fleck virus-like viruses in Vitis. Arch. Virol. 2000, 145, 553–565. [Google Scholar] [CrossRef] [PubMed]
- Sabanadzovic, S.; Ghanem-Sabanadzovic, N.A.; Saldarelli, P.; Martelli, G.P. Complete nucleotide sequence and genome organization of Grapevine fleck virus. J. Gen. Virol. 2001, 82, 2009–2015. [Google Scholar] [CrossRef]
- Shi, B.; Habili, N.; Symons, R. Nucleotide Sequence Variation in a Small Region of the Grapevine Fleck Virus Replicase Provides Evidence for Two Sequence Variants of the Virus. Ann. Appl. Biol. 2003, 142, 349–355. [Google Scholar] [CrossRef]
- Ghanem-Sabanadzovic, N.A.; Sabanadzovic, S.; Martelli, G.P. Sequence Analysis of the 3′ End of Three Grapevine Fleck Virus-like Viruses from Grapevine. Virus Genes 2003, 27, 11–16. [Google Scholar] [CrossRef]
- Fiore, N.; Zamorano, A.; Sanchez-Diana, N.; González, X.; Pallas, V.; Sanchez-Navarro, J. First Detection of Grapevine Rupestris Stem Pitting-Associated Virus and Grapevine Rupestris Vein Feathering Virus, and New Phylogenetic Groups for Grapevine Fleck Virus and Hop Stunt Viroid Isolates, Revealed from Grapevine Field Surveys in Spain. Phytopathol. Mediterr. 2016, 55, 225–238. [Google Scholar]
- Glasa, M.; Predajňa, L.; Komínek, P. Grapevine Fleck Virus Isolates Split into Two Distinct Molecular Groups. J. Phytopathol. 2011, 159, 805–807. [Google Scholar] [CrossRef]
- Bruisson, S.; Lebel, S.; Walter, B.; Prevotat, L.; Seddas, S.; Schellenbaum, P. Comparative detection of a large population of grapevine viruses by TaqMan® RT-qPCR and ELISA. J. Virol. Methods 2017, 240, 73–77. [Google Scholar] [CrossRef]
- Duffy, S. Why Are RNA Virus Mutation Rates so Damn High? PLoS Biol. 2018, 16, e3000003. [Google Scholar] [CrossRef] [PubMed]
Sample Designation | Viruses Present in the Sample a |
---|---|
1 | GRGV, GRVFV, GSyV-1 |
2 | GRGV, GRVFV, GSyV-1 |
3 | GRGV, GRVFV, GSyV-1 |
4 | GRGV, GRVFV, GSyV-1 |
5 | GRGV, GRVFV, GSyV-1 |
6 | GRGV, GRVFV, GSyV-1 |
7 | GRGV, GRVFV, GSyV-1 |
8 | GRGV, GSyV-1 |
9 | GRGV, GRVFV |
10 | GAMaV, GSyV-1 |
11 | GRGV, GSyV-1 |
Virus | Oligo Name | Sequence (5′ to 3′) | 5′ Reporter | Probe Type | Target Region |
---|---|---|---|---|---|
GFkV | GFkV-F1 | AGCTCTCGCTCTGACTCTC | CP | ||
GFkV-R1 | ACTGGAAGGGGAGGTGGAT | ||||
GFkV-F2 | AGCGCTCGCTCAGACTC | ||||
GFkV-R2 | GAACTGGAAGGGAAGATGGATG | ||||
GFkV-P1 | TTGCCCGCAACCC | FAM | MGB | ||
GFkV-P2 | TTGCCCGCAATCC | FAM | MGB |
Country of Origin | Positive Samples |
---|---|
Afghanistan | 3 |
Australia | 2 |
Austria | 9 |
Canada | 6 |
China | 1 |
France | 8 |
Germany | 3 |
Greece | 4 |
Italy | 17 |
Japan | 2 |
Morocco | 1 |
Pakistan | 7 |
Portugal | 12 |
Russian Federation | 4 |
Serbia | 2 |
South Africa | 4 |
Soviet Union | 3 |
Spain | 1 |
Ukraine | 1 |
United Kingdom | 1 |
United States | 98 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
de Souza, J.O.; Klaassen, V.; Stevens, K.; Erickson, T.M.; Heinitz, C.; Al Rwahnih, M. Characterization of Genetic Diversity in the Capsid Protein Gene of Grapevine Fleck Virus and Development of a New Real-Time RT-PCR Assay. Viruses 2024, 16, 1457. https://doi.org/10.3390/v16091457
de Souza JO, Klaassen V, Stevens K, Erickson TM, Heinitz C, Al Rwahnih M. Characterization of Genetic Diversity in the Capsid Protein Gene of Grapevine Fleck Virus and Development of a New Real-Time RT-PCR Assay. Viruses. 2024; 16(9):1457. https://doi.org/10.3390/v16091457
Chicago/Turabian Stylede Souza, Juliana Osse, Vicki Klaassen, Kristian Stevens, Teresa M. Erickson, Claire Heinitz, and Maher Al Rwahnih. 2024. "Characterization of Genetic Diversity in the Capsid Protein Gene of Grapevine Fleck Virus and Development of a New Real-Time RT-PCR Assay" Viruses 16, no. 9: 1457. https://doi.org/10.3390/v16091457