Previous Article in Journal
Sociodemographic Determinants of Adherence and Treatment Efficacy in Paediatric Thalassemia Patients from Sarbaz-Rask, Iran
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Thalassemia Reports
Volume 14
Issue 3
10.3390/thalassrep14030009
thalassrep-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effect of Resveratrol on Gamma Globin Gene Expression in Patients with Beta Thalassemia: The Role of Adaptation to Cellular Stress

by
Hossein Jalali
,
Mohammad Reza Mahdavi
,
Mehrnoush Kosaryan
,
Ahmad Najafi
,
Aily Aliasgharian
and
Ebrahim Salehifar
*
Thalassemia Research Center, Hemoglobinopathy Institute, Mazandaran University of Medical Sciences, Sari 4817993375, Mazandaran, Iran
*
Author to whom correspondence should be addressed.
Thalass. Rep. 2024, 14(3), 71-80; https://doi.org/10.3390/thalassrep14030009
Submission received: 29 May 2024 / Revised: 6 August 2024 / Accepted: 10 September 2024 / Published: 17 September 2024
Browse Figures
Versions Notes

Abstract

:
HbF induction is an appropriate strategy to ameliorate the severity of β-thalassemia symptoms. Hydroxyurea (HU) is the most common chemical agent introduced as an HbF inducer but responsiveness to HU is variable and the introduction of HbF inducers alternative to HU with low cytotoxicity has been a crucial challenge. Resveratrol is an HbF inducer agent that may have favorable effects on the differentiation of hematopoietic erythroid progenitors (HEPs). The present study aimed to investigate the effect of resveratrol on γ-globin, stress response, and anti-apoptotic gene expression among hydroxyurea (HU)-responders and HU-nonresponders (HU-NR). Four cases of HU-R and four cases of HU-NR were studied. HEPs of the patients were cultured, and the expression of γ-globin, Foxo3, and Bclxl was assessed. Moreover, the differentiation and apoptotic rate of the cells were investigated using flow cytometry analysis. In three cases, the γ-globin gene expression increased after resveratrol treatment. All of the HU-NR patients were also non-responders to resveratrol (Res-NR). The expression of Foxo3 and Bclxl genes was higher in responders to resveratrol (Res-R) compared to non-responders (Res-NR). The rate of apoptosis in Res-R patients was also lower than in Res-NR. Responders to resveratrol also had a higher rate of HEP maturation. The cells of both HU–NR and Res-NR patients could not adapt to stress conditions and proceed to the erythroid differentiation. In conclusion, resveratrol increased the γ-globin expression in HEPs of β-thalassemia patients. The response was observed only in R-HU patients with similar cellular pathways.

1. Introduction

β-thalassemia is the most frequent inheritable single-gene disorder in the world [1]. The disease is caused by pathogenic variants in the β-globin gene, resulting in the reduced production of adult hemoglobin (HbA; α2β2) [2]. Anemia, extramedullary hematopoiesis, splenomegaly, and iron overload are the most common features of β-thalassemia [3]. Regular blood transfusion in combination with iron chelation therapy is the main therapy for β-thalassemia, and bone marrow transplantation may be an acceptable choice in selected patients to cure the disease [4].
In humans, the γ-globin gene is expressed during the fetal and neonatal period, and then its expression reduces less than 2% of total hemoglobin while the expression of the β-globin gene increases [5]. This process is known as globin switching. Both γ and β-globin chains have a high affinity to α-globin chains, leading to the formation of fetal hemoglobin (e.g., HbF; α2 γ 2) and HbA (α2β2), respectively.
Oxidative stress is one of the crucial components that leads to pathophysiological damage in thalassemia, and other types of hereditary and acquired hemolytic anemia. Iron overload as a result of increased iron absorption in the gastrointestinal tract, regular blood transfusions, and increased intracellular denaturation of imbalanced hemoglobin subunits is the main cause of oxidative stress [6,7]. Non-transferrin-bound iron overload takes part in the generation of reactive oxygen species (ROS) that leads to damage in vital organs such as the heart, liver, and endocrine system [8].
HbF induction is a proper strategy to alleviate the symptoms of β-thalassemia patients [9] and several efforts have been made to introduce agents that could increase HbF expression. Hydroxyurea (HU), the most common chemical agent used as an HbF inducer, was introduced in the 1960s, and it has been used for the treatment of hemoglobinopathies since 1984 [10,11]. It is an FDA-approved drug for the treatment of sickle cell disease and has been used as an HbF inducer in patients with β-thalassemia [12,13,14,15,16]. The responsiveness to HU is variable [15]. Several genetic factors like Xmn I polymorphism and α-globin gene deletions may be involved in responsiveness to HU therapy [17,18,19]. It has been argued that in in vivo condition, HU-responder (HU-R) patients can adapt themselves to oxidative stress and may show a lower rate of apoptosis in comparison to HU-nonresponse (HU-NR) patients [20].
The introduction of HbF inducers alternative to HU with low cytotoxicity has been one of the crucial challenges over the past years in treating β-thalassemia patients [21,22,23,24]. Resveratrol (trans-3,4,5-trihydroxystilbene) is a natural plant-derived agent with a wide range of pharmacological activities that have multi-potential effects including anti-inflammatory [25] and antioxidant activities [26]. Resveratrol can also induce erythropoiesis by activating the Forkhead box O3 (Foxo3) transcriptional factor and as a result reduce oxidative stress in red blood cells of patients with β-thalassemia. Moreover, some in vitro studies have indicated that, similar to HU, resveratrol can induce γ-globin mRNA expression in human erythroid precursors (HEPs) and patients with sickle cell anemia [27,28] but the effect of resveratrol on HBF induction in HEPs of thalassemia patients was not investigated.
The present study aimed to investigate the impact of resveratrol on γ-globin mRNA expression among HEPs of HU-R and HU-NR β-thalassemia patients. Moreover, the present study also aimed to evaluate the expression of stress response and anti-apoptotic genes (Foxo3 and Bclxl) in these cells.

2. Material and Methods

2.1. Sample Selection

The study was approved by the local Ethics Committee at Mazandaran University of Medical Sciences, Sari, Iran. All the subjects signed the informed consent form before enrolling in the study.
Eight β-thalassemia patients were selected among the registered patients at the Thalassemia Research Center, Sari, Iran. All of the cases had the same β-globin gene pathogenic variant (homozygote for c.315+1 G>A being the most frequent pathogenic variant in the region [29]); they had the +/+ haplotype for the XmnI polymorphism (that some reports declared is related to responsiveness to HU) [30,31,32]. In addition, the subjects did not have common alpha globin deletions that are very common in the region [33] (-- Med, α3.7, α 4.2, and ααα Anti3.7), which may affect the response to HbF-inducing agents [34,35,36,37].
Based on clinical findings, of the eight selected patients, four cases had a good response to HU treatment and were able to maintain hemoglobin levels up to 8.5 g/dL (the threshold for transfusion), and as a result, they became transfusion-independent. Hence, they were classified as HU-R. Four subjects had a poor response to HU treatment with a hemoglobin level of less than 8.5 g/dL that remained dependent on regular blood transfusion and were considered as HU-NR.

2.2. Cell Culture

HEPs of the selected patients were cultured as described earlier [20,38,39]. Before sampling, HU-R patients stopped taking HU for at least two weeks and HU-NR had no blood transfusion for at least 30 days. The peripheral blood mononuclear cells (PBMCs) were separated from a 40 mL blood sample using ficol density. The blood samples were diluted 1:1 in 1× PBS and mixed gently by inversion. Then, the diluted blood was added to the falcons containing the same original blood volume of Ficoll and centrifuged for 30 min at 2000 rpm, without a break and at room temperature. Then, the isolated buffy coats that contained PBMCs were washed twice with PBS and centrifuged at 1800 rpm for 5 min. In the first phase, the culture was initiated by maintaining the purified PBMCs in culture medium at a density of 1–2 × 106 cells/mL in a serum-free medium (StemSpan; Stem Cell Technologies, Vancouver, BC, Canada) enriched with lipids (40 ng/mL cholesterol-rich lipid mix; Sigma, Schnelldorf, Germany) and supplemented with erythropoietin (2 U/mL, Sigma), IL-3 (1 ng/mL; Sigma), dexamethasone (1 μM; Sigma), and Stem Cell Factor (50 ng/mL, Sigma). The cells were expanded until day 7 via partial daily medium changes. In the second phase and in order to remove lymphocytes, the erythroblasts were purified by density purification (Percoll, 1.075). The isolated cells were re-cultured in the differentiation medium without IL-3 and expanded until day 14. The cell densities were kept between 1.5 and 2 × 106 cells/mL by daily medium changes and the addition of the just-mentioned factors. On day 14 and in the differentiation phase, the cells were divided into two groups of untreated and treated cells with 50 μM/mL of resveratrol (Sigma, Schnelldorf, Germany) [40,41]. The cell culture process was continued for two days, and the cells were harvested for further analysis.

2.3. Erythroid Lineage Maturation and Apoptosis

The effect of resveratrol on erythroid lineage maturation and apoptosis was assessed using flow cytometry. Monitoring erythroid lineage maturation was applied by a dual color staining FITC conjugate Anti-CD71 (Cayman Chemical, Ann Arbor, MI, USA) and PE conjugate Anti-CD235a (Cayman Chemical, USA). Apoptosis-related cell death was examined by a dual-color FITC-labeled Annexin V/7-Amino-Actinomycin (7-AAD) apoptosis detection kit (Biolegend, San Diego, CA, USA), according to the manufacturer’s protocol and employing the same steps as the article. Primary human adult erythroid cells were labeled with the mentioned markers in phosphate-buffered saline (PBS) with 0.1% bovine serum albumin (BSA) at 25 °C for 20 min in the dark. Then, the cells were washed twice in PBS with 0.1% BSA, followed by resuspension with 1 mL PBS with 0.1% BSA. The cells were analyzed by BD FACS CaliburTM, USA.

2.4. Quantitative RT-PCR

RNAs were isolated from the cells by using RNeasy RNA Extraction Kit (Qiagen, Hilden, Germany). For cDNA synthesis, Revert Aid First Strand cDNA Synthesis (Thermo Fisher Scientific, Waltham, MA, USA) was carried out based on the manufacturer’s instructions.
Quantitative Real-Time PCR was accomplished on Rotor gene-6000 (Corbett Australia). For each reaction, 12.5 µL of SYBR green PCR master mix (RR820L, Takara, Japan), 10 pmol of each forward and reverse primer, and 2 µL of cDNA were applied in the final volume of 25 µL. The primers were designed spanning intron/exon junctions [20]. The expression of γ-globin, Foxo3, and Bclxl were investigated, while the human USP14 was used as a reference gene. The comparative 2−∆∆CT method was used for the enrichment of specific genes (15) (Table 1).

2.5. Statistical Analysis

Statistical analysis of the data was performed using SPSS Version 23.0 (Chicago, IL, USA). The Mann–Whitney test was used for comparing the quantitative data in Res-R and Res-NR groups. p-values of less than 0.05 were considered significant.

3. Results

3.1. Classifying the Patients as a Responder and Non-Responder to Resveratrol

Based on the results of γ-globin expression after resveratrol treatment, the patients were divided into two groups: Res-R (patients whose γ-globin expression increased by at least 15% after treatment with resveratrol in comparison to untreated cells) and Res-NR (patients whose γ-globin expression did not increased by at least 15% after resveratrol treatment in comparison to untreated cells) [42]. The expression of the γ-globin gene increased after resveratrol treatment in three cases, while five cases were non-responders. All of the Res-R patients were also HU responders. The erythroid progenitors of all four HU-NR patients did not also respond to resveratrol. There was just one case who was HU-R, for whom resveratrol could not increase γ-globin gene expression.

3.2. Gene Expression Analysis

The comparison of Foxo3 gene expression between the Res-R and the Res-NR groups showed that the expression of this gene was higher in Res-R group (p < 0.05). The investigation of Bclxl showed that its expression among Res-R members is significantly higher than its expression in Res-NR members (p < 0.001) (Figure 1).

3.3. Flow Cytometry Analysis of Erythroid Maturation and Apoptosis

The percentage of CD235a/CD71-positive cells in Res-R HEPs with treatment was higher than in Res-R patients without treatment; therefore, increased erythroid maturation was seen in Res-R with treatment. Although this difference was not statistically significant (p > 0.05), the analysis of Annexin-V/7-AAD markers showed that the rate of apoptosis in HEPs of Res-R patients without treatment was higher than that in HEPs of Res-R patients with treatment (p > 0.05) (Figure 2 and Figure 3). In the Res-NR group, no difference in the apoptosis rate was observed between treated and without-treatment patients.

4. Discussion

Several studies have tried to introduce different classes of pharmacological agents capable of increasing γ-globin synthesis in both in vitro and in vivo conditions [43,44,45,46]. However, there are concerns related to the toxicity and carcinogenicity of these agents. Studies have shown that resveratrol not only exhibits antioxidant activity but also is capable of stimulating the expression of the γ-globin gene [40]. Haghpanah et al. (2018) evaluated the efficacy and safety of resveratrol and HU in non-transfusion-dependent beta-thalassemia patients in the south of Iran. Resveratrol showed a similar efficacy to HU, but it was associated with a higher frequency of gastrointestinal adverse reactions (e.g., constipation, bowel obstruction, and diarrhea) which were not statistically significant [14]. Several serious adverse effect including leucopenia, thrombocytopenia, and potential reproductive toxicity were reported with HU [47,48]. These side effects have not been reported for resveratrol and, considering its natural origin, resveratrol may be a safer HbF inducer in β-thalassemia patients.
In addition to safety concerns, HU may not sufficiently induce γ-globin expression in all β-thalassemia patients, and several efforts were made to find effective and safer HbF inducers. Chou et al. (2015) assessed the γ-globin induction activity of HU and some heterocyclic compounds with an identical core structure (benzo[de]benzo[4,5]imidazole[2,1-a]isoquinolin-7-one) in normal primary adult erythroid cells. Gamma-globin gene expression was increased in 7 of 10 investigated cases after HU treatment [46]. Of the chemical agents investigated, only one compound increased γ-globin gene mRNA levels in all of 10 primary human erythroid cell cultures including HU-NR cases.
Unlike HU-NRs, the HEPs of HU-Rs are more adaptable to harsh stress conditions and can proceed to erythroid differentiation [20]. Here, we have investigated the HbF-inducing effect of resveratrol on HEPs of patients with different responses to HU therapy and the results showed that response to resveratrol was almost the same as with HU.
Foxo3 is a transcription factor that plays a pivotal role in expressing genes that enforce the cells to oxidative adaptation. Zhang et al. (2015) in an ex vivo model of erythroid differentiation from CD34+ cells isolated from peripheral blood of normal human donors showed that there is an association between Foxo3 level and endogenous HbF levels. They showed that γ-globin expression was reduced in response to Foxo3 knockdown while β-globin levels remained unchanged [49]. The same results were observed in zebrafish [50]. It seems that Foxo3 is a positive regulator of γ-globin expression and flow cytometry analysis of a primary erythroid culture indicated that the knockdown of Foxo3 also had delayed erythroid maturation. According to previous studies, it is proposed that Foxo3 is a viable therapeutic target for treating individuals with sickle cell disease and β-thalassemia. The results of the present study indicated that Foxo3 expression significantly increased in resveratrol responders, which is dependent on the activation of Foxo3 expression. Pourfarzad et al [20] have also observed the same results on the human HEP cells of β-thalassemia patients. They showed that Foxo3 expression was significantly higher in HEPs of HU-R patients than in HU-NR cases. Metformin can also induce HbF induction via Foxo3 activation, leading to erythroid maturation and HbF production [49]. The results of the present study showed that this is the same for resveratrol and that Foxo3 plays an important role in responsiveness to HbF-inducing agents.
Bclxl (BCL2L1) is an anti-apoptotic gene that protects erythroblasts from apoptosis. Bcl-2 family members like Bcl-2 and Bclxl form a network of protein–protein interactions that regulate apoptosis through the permeabilization of the mitochondrial outer membrane [51]. These genes can prevent ST kinase-induced cell death activity by interacting with the pro-apoptotic gene Bax [52]. In HEPs of HU-R patients, the expression of this gene is higher than in HEPs of HU-NR patients [20]. The results of the present study showed that the expression of Bclxl is higher in HEPs of Res-R patients, and the flow cytometry results using the Annexin V marker showed the same results. The apoptosis rate in Res-NR patients was also higher than in Res-R cases, even before resveratrol treatment. Based on these findings, it could be implied that like HU, the cells of Res-NR patients are more susceptible to apoptosis and did not mature to produce HbF. Based on our study results, all HU-NR patients were also Res-NR. The cells of these patients could not adapt to stress conditions and proceed to the erythroid differentiation program, and as a result cannot mature.
In conclusion, resveratrol increases γ-globin expression in HEPs of 75% of HU-NR with similar molecular pathways. Considering the major adverse side effects of HU such as cytopenias and also the probable safer toxicity profile of resveratrol, further studies with larger sample sizes and different concentrations of resveratrol are recommended to investigate the γ-globin induction effect of resveratrol, especially in patients who were non-responders to hydroxyl urea. Moreover, the long-term effects of resveratrol are recommended to be investigated in future clinical trial studies.

Author Contributions

Conceptualization, E.S. and H.J.; methodology, H.J.; software, M.R.M.; validation, A.N., M.K. and H.J.; formal analysis, E.S.; investigation, H.J.; resources, A.A.; data curation, A.N.; writing—original draft preparation, H.J; writing—review and editing, E.S.; visualization, M.R.M.; supervision, E.S.; project administration, M.K.; funding acquisition, M.R.M. All authors have read and agreed to the published version of the manuscript.

Funding

This project was approved by the Mazandaran University of Medical Sciences as a PhD by a re-search project (ID number: 95-1639). The authors would like to thank the deputy of research and technology, Mazandaran University of Medical Sciences, for the financial support.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by Ethics Committee of Mazandaran University of Medical Sciences (IR.MAZUMS.REC.1395.24111)” for studies involving humans.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to thanks the staffs of Fajr Medical Genetics Lab for their collaboration.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, L.; Gamez, A.; Sarkissian, C.N.; Straub, M.; Patch, M.G.; Han, G.W.; Striepeke, S.; Fitzpatrick, P.; Scriver, C.R.; Stevens, R.C. Structure-based chemical modification strategy for enzyme replacement treatment of phenylketonuria. Mol. Genet. Metab. 2005, 86, 134–140. [Google Scholar] [CrossRef] [PubMed]
  2. Ali, S.; Mumtaz, S.; Shakir, H.A.; Khan, M.; Tahir, H.M.; Mumtaz, S.; Mughal, T.A.; Hassan, A.; Kazmi, S.A.R.; Sadia; et al. Current status of beta-thalassemia and its treatment strategies. Mol. Genet. Genom. Med. 2021, 9, e1788. [Google Scholar]
  3. Khandros, E.; Kwiatkowski, J.L. Beta Thalassemia: Monitoring and New Treatment Approaches. Hematol. Oncol. Clin. N. Am. 2019, 33, 339–353. [Google Scholar] [CrossRef]
  4. Motta, I.; Bou-Fakhredin, R.; Taher, A.T.; Cappellini, M.D. Beta thalassemia: New therapeutic options beyond transfusion and iron chelation. Drugs 2020, 80, 1053–1063. [Google Scholar]
  5. Musallam, K.M.; Taher, A.T.; Cappellini, M.D.; Sankaran, V.G. Clinical experience with fetal hemoglobin induction therapy in patients with beta-thalassemia. Blood 2013, 121, 2199–2212; quiz 2372. [Google Scholar] [CrossRef]
  6. Porter, J.B.; Cappellini, M.D.; Kattamis, A.; Viprakasit, V.; Musallam, K.M.; Zhu, Z.; Taher, A.T. Iron overload across the spectrum of non-transfusion-dependent thalassaemias: Role of erythropoiesis, splenectomy and transfusions. Br. J. Haematol. 2017, 176, 288–299. [Google Scholar] [CrossRef]
  7. Chaichompoo, P.; Qillah, A.; Sirankapracha, P.; Kaewchuchuen, J.; Rimthong, P.; Paiboonsukwong, K.; Fucharoen, S.; Svasti, S.; Worawichawong, S. Abnormal red blood cell morphological changes in thalassaemia associated with iron overload and oxidative stress. J. Clin. Pathol. 2019, 72, 520–524. [Google Scholar] [CrossRef]
  8. Taher, A.T.; Saliba, A.N. Iron overload in thalassemia: Different organs at different rates. Hematol. Am. Soc. Hematol. Educ. Program 2017, 2017, 265–271. [Google Scholar] [CrossRef]
  9. Doerfler, P.A.; Feng, R.; Li, Y.; Palmer, L.E.; Porter, S.N.; Bell, H.W.; Crossley, M.; Pruett-Miller, S.M.; Cheng, Y.; Weiss, M.J. Activation of γ-globin gene expression by GATA1 and NF-Y in hereditary persistence of fetal hemoglobin. Nat. Genet. 2021, 53, 1177–1186. [Google Scholar]
  10. Platt, O.S.; Orkin, S.H.; Dover, G.; Beardsley, G.P.; Miller, B.; Nathan, D.G. Hydroxyurea enhances fetal hemoglobin production in sickle cell anemia. J. Clin. Investig. 1984, 74, 652–656. [Google Scholar] [CrossRef]
  11. el-Hazmi, M.A.; al-Momen, A.; Kandaswamy, S.; Huraib, S.; Harakati, M.; al-Mohareb, F.; Warsy, A.S. On the use of hydroxyurea/erythropoietin combination therapy for sickle cell disease. Acta Haematol. 1995, 94, 128–134. [Google Scholar] [PubMed]
  12. Lockamy, V.L.; Huang, J.; Shields, H.; Ballas, S.K.; King, S.B.; Kim-Shapiro, D.B. Urease enhances the formation of iron nitrosyl hemoglobin in the presence of hydroxyurea. Biochim. Biophys. Acta 2003, 1622, 109–116. [Google Scholar] [CrossRef] [PubMed]
  13. Youssry, I.; Abdel-Salam, A.; Ismail, R.; Bou-Fakhredin, R.; Mohamed Samy, R.; Ezz El-Deen, F.; Taher, A.T. Enhancing Effect of Hydroxyurea on Hb F in Sickle Cell Disease: Ten-Year Egyptian Experience. Hemoglobin 2017, 41, 267–273. [Google Scholar] [CrossRef] [PubMed]
  14. Haghpanah, S.; Zarei, T.; Eshghi, P.; Zekavat, O.; Bordbar, M.; Hoormand, M.; Karimi, M. Efficacy and safety of resveratrol, an oral hemoglobin F-augmenting agent, in patients with beta-thalassemia intermedia. Ann. Hematol. 2018, 97, 1919–1924. [Google Scholar] [CrossRef] [PubMed]
  15. Kosaryan, M.; Zafari, M.; Alipur, A.; Hedayatizadeh-Omran, A. The effect and side effect of hydroxyurea therapy on patients with beta-thalassemia: A systematic review to December 2012. Hemoglobin 2014, 38, 262–271. [Google Scholar] [CrossRef] [PubMed]
  16. Kosaryan, M.; Vahidshahi, K.; Karami, H.; Ehteshami, S. Effect of hydroxyurea on thalassemia major and thalassemia intermedia in Iranian patients. Pak. J. Med. Sci. 2009, 25, 74–78. [Google Scholar]
  17. Menzel, S.; Thein, S.L. Genetic Modifiers of Fetal Haemoglobin in Sickle Cell Disease. Mol. Diagn. Ther. 2019, 23, 235–244. [Google Scholar] [CrossRef]
  18. Hanif, T.B.; Ahmed, S.; Anwar, J.; Kazmi, S.K. XmnI polymorphism and disease severity in patients with beta thalassemia from northern Pakistan. J. Ayub Med. Coll. Abbottabad 2015, 27, 13–16. [Google Scholar]
  19. Motovali-Bashi, M.; Ghasemi, T. Role of XmnIgG Polymorphism in Hydroxyurea Treatment and Fetal Hemoglobin Level at Isfahanian Intermediate beta-Thalassemia Patients. Iran. Biomed. J. 2015, 19, 177–182. [Google Scholar]
  20. Pourfarzad, F.; von Lindern, M.; Azarkeivan, A.; Hou, J.; Kia, S.K.; Esteghamat, F.; van Ijcken, W.; Philipsen, S.; Najmabadi, H.; Grosveld, F. Hydroxyurea responsiveness in beta-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity. Haematologica 2013, 98, 696–704. [Google Scholar] [CrossRef]
  21. Fard, A.D.; Hosseini, S.A.; Shahjahani, M.; Salari, F.; Jaseb, K. Evaluation of Novel Fetal Hemoglobin Inducer Drugs in Treatment of beta-Hemoglobinopathy Disorders. Int. J. Hematol. Oncol. Stem Cell Res. 2013, 7, 47–54. [Google Scholar] [PubMed]
  22. Fibach, E.; Bianchi, N.; Borgatti, M.; Prus, E.; Gambari, R. Mithramycin induces fetal hemoglobin production in normal and thalassemic human erythroid precursor cells. Blood 2003, 102, 1276–1281. [Google Scholar] [CrossRef] [PubMed]
  23. Mischiati, C.; Sereni, A.; Lampronti, I.; Bianchi, N.; Borgatti, M.; Prus, E.; Fibach, E.; Gambari, R. Rapamycin-mediated induction of gamma-globin mRNA accumulation in human erythroid cells. Br. J. Haematol. 2004, 126, 612–621. [Google Scholar] [CrossRef] [PubMed]
  24. El-Beshlawy, A.; Hamdy, M.; El Ghamrawy, M. Fetal globin induction in beta-thalassemia. Hemoglobin 2009, 33 (Suppl. S1), S197–S203. [Google Scholar] [CrossRef]
  25. Birrell, M.A.; McCluskie, K.; Wong, S.; Donnelly, L.E.; Barnes, P.J.; Belvisi, M.G. Resveratrol, an extract of red wine, inhibits lipopolysaccharide induced airway neutrophilia and inflammatory mediators through an NF-kappaB-independent mechanism. FASEB J. 2005, 19, 840–841. [Google Scholar] [CrossRef]
  26. Pandey, K.B.; Rizvi, S.I. Protective effect of resveratrol on markers of oxidative stress in human erythrocytes subjected to in vitro oxidative insult. Phytother. Res. 2010, 24 (Suppl. S1), S11–S14. [Google Scholar] [CrossRef]
  27. Franco, S.S.; De Falco, L.; Ghaffari, S.; Brugnara, C.; Sinclair, D.A.; Matte, A.; Iolascon, A.; Mohandas, N.; Bertoldi, M.; An, X.; et al. Resveratrol accelerates erythroid maturation by activation of FoxO3 and ameliorates anemia in beta-thalassemic mice. Haematologica 2014, 99, 267–275. [Google Scholar] [CrossRef]
  28. Bosquesi, P.L.; Melchior, A.C.B.; Pavan, A.R.; Lanaro, C.; de Souza, C.M.; Rusinova, R.; Chelucci, R.C.; Barbieri, K.P.; dos Santos Fernandes, G.F.; Carlos, I.Z. Synthesis and evaluation of resveratrol derivatives as fetal hemoglobin inducers. Bioorganic Chem. 2020, 100, 103948. [Google Scholar]
  29. Akhavan-Niaki, H.; Derakhshandeh-Peykar, P.; Banihashemi, A.; Mostafazadeh, A.; Asghari, B.; Ahmadifard, M.R.; Azizi, M.; Youssefi, A.; Elmi, M.M. A comprehensive molecular characterization of beta thalassemia in a highly heterogeneous population. Blood Cells Mol. Dis. 2011, 47, 29–32. [Google Scholar] [CrossRef]
  30. Ansari, S.H.; Shamsi, T.S.; Munzir, S.; Khan, M.T.; Erum, S.; Perveen, K.; Farzana, T.; Ashraf, M.; Mehboob, T.; Moinuddin, M. Ggamma-Xmn I polymorphism: A significant determinant of beta-thalassemia treatment without blood transfusion. J. Pediatr. Hematol. Oncol. 2013, 35, e153–e156. [Google Scholar] [CrossRef]
  31. Miri-Moghaddam, E.; Bahrami, S.; Naderi, M.; Bazi, A.; Karimipoor, M. Xmn1-158 gammaGVariant in B-Thalassemia Intermediate Patients in South-East of Iran. Int. J. Hematol. Oncol. Stem Cell Res. 2017, 11, 165–171. [Google Scholar] [PubMed]
  32. Kumar, R.; Kaur, A.; Agarwal, S. Influence of Xmn 1(G)gamma (HBG2 c.-211 C --> T) Globin Gene Polymorphism on Phenotype of Thalassemia Patients of North India. Indian J. Hematol. Blood Transfus. 2014, 30, 286–290. [Google Scholar] [CrossRef] [PubMed]
  33. Jalali, H.; Mahdavi, M.R.; Roshan, P.; Kosaryan, M.; Karami, H.; Mahdavi, M. Alpha thalassemia gene mutations in neonates from Mazandaran, Iran, 2012. Hematology 2014, 19, 192–195. [Google Scholar] [CrossRef] [PubMed]
  34. Italia, K.Y.; Jijina, F.J.; Merchant, R.; Panjwani, S.; Nadkarni, A.H.; Sawant, P.M.; Nair, S.B.; Ghosh, K.; Colah, R.B. Response to hydroxyurea in beta thalassemia major and intermedia: Experience in western India. Clin. Chim. Acta 2009, 407, 10–15. [Google Scholar] [CrossRef]
  35. Dixit, A.; Chatterjee, T.C.; Mishra, P.; Choudhry, D.R.; Mahapatra, M.; Tyagi, S.; Kabra, M.; Saxena, R.; Choudhry, V.P. Hydroxyurea in thalassemia intermedia—A promising therapy. Ann. Hematol. 2005, 84, 441–446. [Google Scholar] [CrossRef]
  36. Panigrahi, I.; Dixit, A.; Arora, S.; Kabra, M.; Mahapatra, M.; Choudhry, V.P.; Saxena, R. Do alpha deletions influence hydroxyurea response in thalassemia intermedia? Hematology 2005, 10, 61–63. [Google Scholar] [CrossRef]
  37. Traeger-Synodinos, J.; Vrettou, C.; Sofocleous, C.; Zurlo, M.; Finotti, A.; Gambari, R. Impact of α-Globin Gene Expression and α-Globin Modifiers on the Phenotype of β-Thalassemia and Other Hemoglobinopathies: Implications for Patient Management. Int. J. Mol. Sci. 2024, 25, 3400. [Google Scholar] [CrossRef]
  38. Leberbauer, C.; Boulme, F.; Unfried, G.; Huber, J.; Beug, H.; Mullner, E.W. Different steroids co-regulate long-term expansion versus terminal differentiation in primary human erythroid progenitors. Blood 2005, 105, 85–94. [Google Scholar] [CrossRef]
  39. Mahdavi, M.R.; Pourfarzad, F.; Kosaryan, M.; Akbari, M.T. In Vitro Hb Production in B-thalassemia Patients Is Not a Predictor of Clinical Responsiveness to Hydroxyurea. Iran. J. Public Health 2017, 46, 948. [Google Scholar]
  40. Fibach, E.; Prus, E.; Bianchi, N.; Zuccato, C.; Breveglieri, G.; Salvatori, F.; Finotti, A.; Lipucci di Paola, M.; Brognara, E.; Lampronti, I.; et al. Resveratrol: Antioxidant activity and induction of fetal hemoglobin in erythroid cells from normal donors and beta-thalassemia patients. Int. J. Mol. Med. 2012, 29, 974–982. [Google Scholar] [CrossRef]
  41. Rodrigue, C.M.; Arous, N.; Bachir, D.; Smith-Ravin, J.; Romeo, P.H.; Galacteros, F.; Garel, M.C. Resveratrol, a natural dietary phytoalexin, possesses similar properties to hydroxyurea towards erythroid differentiation. Br. J. Haematol. 2001, 113, 500–507. [Google Scholar] [PubMed]
  42. Theodorou, A.; Phylactides, M.; Forti, L.; Cramarossa, M.R.; Spyrou, P.; Gambari, R.; Thein, S.L.; Kleanthous, M. The investigation of resveratrol and analogs as potential inducers of fetal hemoglobin. Blood Cells Mol. Dis. 2016, 58, 6–12. [Google Scholar] [CrossRef] [PubMed]
  43. Macari, E.R.; Schaeffer, E.K.; West, R.J.; Lowrey, C.H. Simvastatin and t-butylhydroquinone suppress KLF1 and BCL11A gene expression and additively increase fetal hemoglobin in primary human erythroid cells. Blood 2013, 121, 830–839. [Google Scholar] [CrossRef]
  44. Macari, E.R.; Lowrey, C.H. Induction of human fetal hemoglobin via the NRF2 antioxidant response signaling pathway. Blood 2011, 117, 5987–5997. [Google Scholar] [CrossRef]
  45. Qian, X.; Chen, J.; Zhao, D.; Guo, L.; Qian, X. Plastrum testudinis induces gamma-globin gene expression through epigenetic histone modifications within the gamma-globin gene promoter via activation of the p38 MAPK signaling pathway. Int. J. Mol. Med. 2013, 31, 1418–1428. [Google Scholar] [CrossRef]
  46. Chou, Y.C.; Chen, R.L.; Lai, Z.S.; Song, J.S.; Chao, Y.S.; Shen, C.K. Pharmacological Induction of Human Fetal Globin Gene in Hydroxyurea-Resistant Primary Adult Erythroid Cells. Mol. Cell Biol. 2015, 35, 2541–2553. [Google Scholar] [CrossRef]
  47. Grigg, A. Effect of hydroxyurea on sperm count, motility and morphology in adult men with sickle cell or myeloproliferative disease. Intern. Med. J. 2007, 37, 190–192. [Google Scholar] [CrossRef]
  48. Kinney, T.R.; Helms, R.W.; O’Branski, E.E.; Ohene-Frempong, K.; Wang, W.; Daeschner, C.; Vichinsky, E.; Redding-Lallinger, R.; Gee, B.; Platt, O.S.; et al. Safety of hydroxyurea in children with sickle cell anemia: Results of the HUG-KIDS study, a phase I/II trial. Pediatric Hydroxyurea Group. Blood 1999, 94, 1550–1554. [Google Scholar]
  49. Zhang, Y.; Paikari, A.; Sumazin, P.; Ginter Summarell, C.C.; Crosby, J.R.; Boerwinkle, E.; Weiss, M.J.; Sheehan, V.A. Metformin induces FOXO3-dependent fetal hemoglobin production in human primary erythroid cells. Blood 2018, 132, 321–333. [Google Scholar] [CrossRef]
  50. Wang, H.; Li, Y.; Wang, S.; Zhang, Q.; Zheng, J.; Yang, Y.; Qi, H.; Qu, H.; Zhang, Z.; Liu, F.; et al. Knockdown of transcription factor forkhead box O3 (FOXO3) suppresses erythroid differentiation in human cells and zebrafish. Biochem. Biophys. Res. Commun. 2015, 460, 923–930. [Google Scholar] [CrossRef]
  51. Renault, T.T.; Dejean, L.M.; Manon, S. A brewing understanding of the regulation of Bax function by Bcl-xL and Bcl-2. Mech. Ageing Dev. 2017, 161, 201–210. [Google Scholar] [CrossRef]
  52. Reshi, L.; Wang, H.V.; Hui, C.F.; Su, Y.C.; Hong, J.R. Anti-apoptotic genes Bcl-2 and Bcl-xL overexpression can block iridovirus serine/threonine kinase-induced Bax/mitochondria-mediated cell death in GF-1 cells. Fish. Shellfish Immunol. 2017, 61, 120–129. [Google Scholar] [CrossRef]
Thalassrep 14 00009 g001
Figure 1. The expression of Foxo3 (A) and Bclxl (B) genes among resveratrol-responsive (Res-R) and resveratrol-nonresponsive (Res-NR) patients. The expression of stress response (Foxo3) and anti-apoptotic (Bclxl) genes in Res-R patients were higher than in Res-NR patients (p < 0.05: * and p < 0.001: ***).
Figure 1. The expression of Foxo3 (A) and Bclxl (B) genes among resveratrol-responsive (Res-R) and resveratrol-nonresponsive (Res-NR) patients. The expression of stress response (Foxo3) and anti-apoptotic (Bclxl) genes in Res-R patients were higher than in Res-NR patients (p < 0.05: * and p < 0.001: ***).
Thalassrep 14 00009 g001
Thalassrep 14 00009 g002
Figure 2. Representative data of double staining for Annexin V and 7ADD uptake from HEPs of Res-R and Res-NR patients by fluorescence-activated cell sorting (FACS) with and without 48 h of treatment with Resveratrol. (A): HEPs of Res-R patient without treatment, (B): HEPs of Res-R patient with treatment, (C): HEPs of Res-NR patient without treatment, (D): HEPs of Res-NR patient with treatment (p > 0.05: ns).
Figure 2. Representative data of double staining for Annexin V and 7ADD uptake from HEPs of Res-R and Res-NR patients by fluorescence-activated cell sorting (FACS) with and without 48 h of treatment with Resveratrol. (A): HEPs of Res-R patient without treatment, (B): HEPs of Res-R patient with treatment, (C): HEPs of Res-NR patient without treatment, (D): HEPs of Res-NR patient with treatment (p > 0.05: ns).
Thalassrep 14 00009 g002
Thalassrep 14 00009 g003
Figure 3. Flow cytometry analysis of double staining for CD 71 and CD 235a uptake from HEPs of Res-R and Res-NR patients with and without 42 h of treatment with Resveratrol. (A): HEPs of Res-R patient without treatment, (B): HEPs of Res-R patient with treatment, (C): HEPs of Res-NR patient without treatment, (D): HEPs of Res-NR patient with treatment. Percentage of cells (CD71low CD235ahigh) represents matured erythroblasts and reticulocytes. Rate of cells expressing CD235a marker in HEPs of Res-R patient is higher than its expression on Res-NR patient (p > 0.05: ns).
Figure 3. Flow cytometry analysis of double staining for CD 71 and CD 235a uptake from HEPs of Res-R and Res-NR patients with and without 42 h of treatment with Resveratrol. (A): HEPs of Res-R patient without treatment, (B): HEPs of Res-R patient with treatment, (C): HEPs of Res-NR patient without treatment, (D): HEPs of Res-NR patient with treatment. Percentage of cells (CD71low CD235ahigh) represents matured erythroblasts and reticulocytes. Rate of cells expressing CD235a marker in HEPs of Res-R patient is higher than its expression on Res-NR patient (p > 0.05: ns).
Thalassrep 14 00009 g003
Table 1. Primer sequences used for qRT-PCR.
Table 1. Primer sequences used for qRT-PCR.
Primer NameSequence (5′→3′)Product Length (bp)
USP 14 FAACGCTAAAGGATGATGATTGGG103
USP 14 RTTTGGCTGAGGGTTCTTCTGG
γ-globin FAGGTGCTGACTTCCTTGGG174
γ-globin RGGGTGAATTCTTTGCCGAA
Foxo3 FCGTTGCGTGCCCTACTTC128
Foxo3 RCTCTTGCCAGTTCCCTCATTC
Bclxl FACCTGAATGACCACCTAGAGC121
Bclxl RCAGCGGTTGAAGCGTTCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jalali, H.; Mahdavi, M.R.; Kosaryan, M.; Najafi, A.; Aliasgharian, A.; Salehifar, E. The Effect of Resveratrol on Gamma Globin Gene Expression in Patients with Beta Thalassemia: The Role of Adaptation to Cellular Stress. Thalass. Rep. 2024, 14, 71-80. https://doi.org/10.3390/thalassrep14030009

AMA Style

Jalali H, Mahdavi MR, Kosaryan M, Najafi A, Aliasgharian A, Salehifar E. The Effect of Resveratrol on Gamma Globin Gene Expression in Patients with Beta Thalassemia: The Role of Adaptation to Cellular Stress. Thalassemia Reports. 2024; 14(3):71-80. https://doi.org/10.3390/thalassrep14030009

Chicago/Turabian Style

Jalali, Hossein, Mohammad Reza Mahdavi, Mehrnoush Kosaryan, Ahmad Najafi, Aily Aliasgharian, and Ebrahim Salehifar. 2024. "The Effect of Resveratrol on Gamma Globin Gene Expression in Patients with Beta Thalassemia: The Role of Adaptation to Cellular Stress" Thalassemia Reports 14, no. 3: 71-80. https://doi.org/10.3390/thalassrep14030009

Article Metrics

Back to TopTop