Next Article in Journal
A Qualitative Analysis of Corporate Social Responsibility in Saudi Arabia’s Service Sector-Practices and Company Performance
Previous Article in Journal
Influence of Dry-Wet Cycles on the Structure and Shear Strength of Loess
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Sustainability
Volume 15
Issue 12
10.3390/su15129285
sustainability-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of p-Hydroxyphenylacetic Acid and p-Hydroxybenzoic Acid on Soil Bacterial and Fungal Communities

by
Chunge Li
1,*,
Ye Deng
1,
Jingguo Wang
2,
Weibin Ruan
3,
Shang Wang
1 and
Weidong Kong
4
1
Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China
2
College of Agricultural Resources and Environmental Sciences, China Agricultural University, Beijing 100094, China
3
College of Life Sciences, Nankai University, Tianjin 300350, China
4
Institute of Tibetan Plateau Research, Chinese Academy of Sciences, Beijing 100101, China
*
Author to whom correspondence should be addressed.
Sustainability 2023, 15(12), 9285; https://doi.org/10.3390/su15129285
Submission received: 30 April 2023 / Revised: 5 June 2023 / Accepted: 6 June 2023 / Published: 8 June 2023
Browse Figures
Versions Notes

Abstract

:
Soil phenolic acids mainly come from crop residue and root exudates, which are often reported as allelochemicals affecting crop growth and soil microbial community. Here, two phenolic acid compounds, p-hydroxyphenylacetic acid (HPA) and p-hydroxybenzoic acid (HBA) were amended to the soils and were incubated under room conditions, and the soil samples were collected from soybean and corn fields separately. The soil microbial community was determined by PCR-DGGE (polymerase chain reaction-denatured gradient gel electrophoresis) and clone methods. Microbial biomass carbon (MBC) was measured based on the fumigation–extraction method. The result revealed that HPA/HBA amendment significantly affected soil bacterial and fungal community structures. HPA/HBA enriched some distinct bacteria and fungi. The induced bacteria were mainly Gemmatimonas, Bacillus, and Acidobacteria, while the induced fungi were mainly Penicillium and Aspergillus. HPA amendment enhanced the more bacterial quantities of corn and soybean soils than HBA. The fungal diversity in corn and soybean soils treated with HBA was higher than that treated with HPA. It was speculated that the diversity of degrading HBA fungi was higher than that of degrading HPA. This study comprehensively analyzed the effects of phenolic acids on soil microbial community and increased the understanding of the monoculture barrier to agricultural production.

1. Introduction

Monoculture soybean barrier is a common phenomenon which is caused by biological factors such as the increasing plant pathogens and the decreasing soil enzyme activities, abiotic factors such as damaged soil structure and properties, and the lack of N, P, and Mo nutrients [1,2]. Although the monoculture barrier of corn was not as serious as that of soybean, high-concentration phenolic acids inhibited corn seedling growth markedly [3]. Phenolic acids in soil mostly come from the plant root exudates and residue degradation, which is considered a main factor causing monoculture crop barrier and soil microbial community imbalance [1,4].
p-hydroxybenzoic acid (HBA) and p-hydroxyphenylacetic acid (HPA) are the common phenolic acids extracted from root exudates of some crops such as soybean, corn, rice, and wheat. Especially HBA can be detected from most crop exudates [5,6]. Previous reports showed that HBA and HPA, as allelochemicals, inhibited crop growth [4,7]. As the years of monoculture increased, HPA and HBA accumulated in monoculture crop soils, poisoned crop roots, and damaged soil antioxidant enzyme activities [4]. The effects of phenolic acids such as HBA on microorganisms are considered negative. It was implicated that the phenolic acids from monoculture crop soil made the microbial community change from bacteria type to fungal type [1,8], but the results were too general to distinguish the effects of the different phenolic acid types on microbial community, and also lacked specific descriptions of microbial species.
Here, the study compared HPA and HBA effects on bacterial and fungal communities separately, analyzed the soil microbial response mechanism to HPA/HBA addition, and evaluated the effects of phenolic acids on crop monoculture obstacles.

2. Material and Methods

2.1. Experiment Background and Sampling

The black soils used in this experiment were obtained from the Heilongjiang Academy of Agricultural Sciences research station in Harbin in northeastern China (47°26′ N and 126°38′ E). This area has an average annual precipitation of 550 mm and 100–140 frost-free days a year, where the climate is suitable for growing soybeans. Here, soybeans are generally sown before May 10, and the maturity period of soybeans is in mid- to late September. Appropriate irrigation is applied as needed. This research station set a long-term experimental field with randomly distributed plots (each plot the size of 7 × 10 m). Monocultural corn and soybean were sown in different plots, 10 rows in each plot, with each row spacing of 0.67 m. The soils described in this study were collected after corn and soybean were harvested. Corn soils were sampled (1–15 cm depth) from five random sites within a plot where corn was continuously planted for 3 years. Soybean soils were sampled (1–15 cm depth) from five random sites within a plot where soybean was continuously planted for 2 years. The soil samples were air-dried and sieved through a 2 mm mesh screen and were then incubated for 2 weeks at 25 °C before chemical compound addition. Soil samples were mixed separately with p-hydroxyphenylacetic acid (HPA) and p-hydroxybenzoic acid (HBA) in a concentration of 2% (20 mg g−1) referring to the monoculture barrier literature [9]. The water content of the soil was adjusted to 0.205 g·g−1 soil by adding distilled water. The amended soil and control soil (non-amended) were divided into triplicate samples separately and incubated in containers with screw-cap lids in the dark at 25 °C. The soil source and abbreviation for each treatment are listed in Table 1, and the soil chemical parameters are listed in Table 2.
Soil samples were taken in triplicate at days 7, 14, 21, and 35 of incubation. Approximately 85 g of each sample was kept at 4 °C for the microbial biomass carbon (MBC) measurement and approximately 20 g at −20 °C for DNA analysis. Throughout the incubation, lids were removed weekly to aerate the soils and adjust the soil moisture if needed.

2.2. Microbial Biomass Carbon

MBC was measured according to the chloroform fumigation–extraction method [10] for the soils sampled at days 7, 14, 21, and 35, respectively. Two parts equal to 20 g of oven-dry soil were taken, one part was fumigated for 24 h with chloroform and the other was not fumigated. A total of 80 mL of a 0.5 M K2SO4 was added to the soil and then shaken for 30 min, and the organic carbon of soil extracts was measured by potassium dichromate oxidation. MBC was calculated based on equation MBC (mg kg−1) = 2.64 × Ec, where Ec is the difference between the organic carbon of fumigated and unfumigated soil extracts.

2.3. DNA Extraction, PCR-DGGE and Cloning

Total DNA was extracted from 500 mg soil samples (fresh weight of known moisture content) at days 7, 14, and 35 of the incubation with the Fast DNA Spin kit for soil (MP, USA). The extracted DNA samples were stored at −20 °C for further analysis. Bacterial 16S rDNA was amplified using the universal bacterial primer pair F357 with GC clamp (5’-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCC TACGGGAGGCAGCAG-3’) and R518 (5’-ATTACCGCGGCTGCTGG-3’) [11]. Fungal 18S rDNA was amplified using the primer pair NS1 (5’-GTAGTCATATGCTTGTCTC-3’) and FUNG with GC clamp (5’-CGCCCGCCG CGCCCCGCGCCCGGCCCGCCGCCCCCGCCCCATTCCCCGTTACCCGTTG-3’) [12]. PCR product of each sample was separated by DGGE (denatured gradient gel electrophoresis) using 7.5% acrylamide gels containing a denaturing gradient (15–35% for bacteria and 35–50% for fungi) in a 1 × TAE buffer at 60 °C and 120 V for 6.5 h (BIO-RAD Dcode system, Hercules, CA, USA). The detailed procedures of PCR amplification and DGGE implementation were described by Li et al. [13].
The distinct bands were excised from the DGGE gel, cut, and soaked in a 50 µL 1 × TAE buffer overnight. The band extracts as DNA templates were amplified using the above primer pair without the GC clamp. PCR products were extracted by the Takara purification kit, and the purified concentrate was ligated to the pMD 18-T Vector and cloned to the competent cells following the manufacturer’s instruction. Positive clones were sent to the company of Sangon Biotech for Sanger sequencing (ABI Prism™ 3730 × 1 DNA sequencer). The clone sequences were analyzed by the NCBI Blast program.

2.4. Statistical Analysis

Based on DGGE band patterns and quantity one Software (BIO-RAD), the diversities of bacterial and fungal communities were calculated using the Shannon–Wiener diversity index [14]. The diversity index refers to the species diversity. The equation is calculated as follows: Shannon index (H) = −Σ Pi × In Pi, where Pi is the ratio of the specific band intensity to the total intensity of all bands in a lane. Each band represents a bacterial or fungal species or a small group of species with 16S rDNA or 18S rDNA sequences with similar melting characteristics [15]. In this study, the band intensity represented the numbers of this species or this group of microbes, and band position in DGGG gel indicated the 16S rDNA or 18S rDNA amplification product migration position in DGGE conditions. Migration to the same horizontal position in different lanes represented the same microbes.
Soil resilience index was calculated based on MBC [16]. The analysis of variance (ANOVA) and correlation of sample diversities were assessed by Origin software. Dice coefficient among the different samples generated from the DGGE pattern was analyzed using principal component analysis (PCA).

3. Results

3.1. Microbial Biomass Carbon

The MBC measure of all soil samples at 7, 14, 21, and 35 days showed that HPA/HBA-amended soils had a higher MBC level compared to control soils since day 14 (Figure 1). It is worth noting that bacterial band 2 in Figure 2 and fungal band 10 in Figure 3 appeared since the 14th day of incubation. HPA/HBA amendment improved the MBC of corn and soybean soils. The enhanced MBC came from the transformation of HPA and HBA by microorganisms.
The MBC in control corn or soybean soils decreased during the incubation period, the control corn soil became 9.2 times smaller (from 605 to 66 mg C kg−1 of soil), and the control soybean soil became 3.6 times smaller (from 108 to 30 mg C kg−1 of soil). The MBC in HBA-amended soils showed a decreased trend from 7 days to 35 days: CB became 0.30 smaller, from 216.12 to 166.28 mg C kg−1 of soil, SB became 1.54 times smaller (from 351.11 to 138.10 mg C kg−1 of soil). However, the MBC in HPA-amended soils showed an increased trend from 7 days to 35 days, especially for the significant increase in SP. CP increased slightly from 127 to 139 mg C kg−1 soil, SP increased significantly from 25 to 314 mg C kg−1 soil (11.36 times greater). The soybean soils amended with HPA had higher MBC than the soils added with HBA except for SP at 7 days.

3.2. Species Shift in Bacterial Community

Bacterial community structure was monitored for all soil samples at days 7, 14, and 35 by the DGGE profile of the amplified 16S rDNA products based on primer pair F341GC/R518 (Figure 2). The results showed that the amendment of HBA and HPA significantly affected soil bacterial community structure. Bands 1–6 occurred as prominent bands in the HPA/HBA amended soil DGGE patterns. However, these bands were weak or non-existent in the control treatments. Among these highly abundant bands, bands 1, 3, and 4 occurred in each of the HPA- or HBA-treated soils across the whole incubation periods, and band 2 occurred until day 14. Band 5 was enriched only in CP soil at 35 days, and band 6 was only enriched at 35 days of CB, CP, and SB soils, and bands 5 and 6 were not present at 35 days of SP.
Clone sequences of six bands were submitted to GenBank (accession numbers EF458661–EF458666). The most similar species were selected by the GenBank blast program. Band 1 showed a 98% similarity to Bacillus sp. (accession number KF447395). Most members of Bacillus were beneficial for soil and plants via directly enhancing crop growth and indirectly increasing crop resistance to pathogens [17]. Bands 2, 3, and 4 showed a 98–100% similarity to uncultured Gemmatimonadetes bacteria (the corresponding accession numbers are EU297893, GU047592, and EU299774). Gemmatimonadetes were one of the common bacteria in a variety of soil types. Band 5 showed a 98% similarity to Cohnella sp. (accession number KY660620), which was reported as nitrogen-fixing related bacteria [18]. Bands 1 and 5 both belonged to Firmicutes.
Band 6 had a 100% similarity with Acidicapsa (accession number NR_148580, belonging to Acidobacteria), which is the main phylum of soil bacteria distributed widely in soils, accounting for up to more than 50% in some forest soils [19]. Acidobacteria were speculated to be competitive in terms of colonization in soil and establish a beneficial relationship with the plant, playing an important role in plant growth and ecological balance [20,21].

3.3. Species Shift in Fungal Community

Fungal primer pair NS1-FUNGGC was used to amplify the 18S rDNA fragments to determine the effects of HBA and HPA on soil fungi. The results of the DGGE patterns showed the two types of phenolic acids significantly influenced soil fungal community structure. Bands shifted in the fungal DGGE pattern, absent in control soils and occurred in phenolic-acid-treated soils (Figure 3). Bands 7–10 were excised and cloned, and the clone sequences were submitted to GenBank (accession numbers EU086596–EU086599). Bands 7, 8, and 10 only occurred in the HPA-amended soils and were not detected in the HBA-treated or control soils. Bands 7 and 8 were detected from 7 to 35 days, and band 10 appeared until day 14. Bands 7 and 10 belonged to Aspergillus (100% sequence similarities), bands 8 and 9 belonged to Penicillium, with 99–100% sequence similarities. Aspergillus and Penicillium were induced by HBA and HPA, but weak or undetected in the control soils.

3.4. Comparison of Bacterial and Fungal Communities

Digital images of the DGGE patterns were further analyzed by the Shannon index (Table 3). During the incubation period, no significant difference was found among the HPA/HBA amended corn and soybean bacterial diversity, but the bacterial diversities of SB at 14 and 35 days and CB at 14 days showed a decreased trend compared to the respective control soils. At any incubation time, the bacterial intensity of the HPA-amended soils was higher than that of the HBA-amended ones (Table 4), indicating that HPA had more bacterial abundance than HBA. This also can be observed from Figure 1; in addition, lane CP or SP had more dominant bands than lane CB or SB.
The fungal intensity did not show an obvious difference between HPA- and HBA-amended soils. However, there was a reverse trend for fungal diversity. The HBA-amended soil had a significant increase in fungal diversity than the HPA-amended soil (p < 0.05, Table 3). The fungal diversity of CB and SB at days 14 and 35 was higher than that of CP and SP, respectively.
Bacterial and fungal diversities had a significant negative relationship (r = −0.44, p < 0.01). Bacterial and fungal diversity at the same treatments had a reverse trend (Figure 4).
Therefore, the HPA/HBA amendment changed soil bacterial and fungal communities. The differentiation between HPA and HBA addition in the soil microbial community had not been previously reported.
PCA analysis based on the Dice similarity coefficient is shown in Figure 5. Dice coefficient was calculated by band, absent or present. The PCA revealed the similarity or difference in treatments in bacterial and fungal community compositions. The figure shows that phenolic acid addition was the first main factor determining the bacterial and fungal communities, as the PC1 axis distinguished control soils from HPA/HBA-amended soils; crop type was still the second factor determining the bacterial and fungal communities, as the PC2 axis distinguished corn soils from soybean soils. Bacterial SP and SB at 14–35 days were closed separately based on incubation time rather than phenolic acid type. Fungal SB and SP at 7–35 days were close together, and fungal CB and CP at 7–14 days were close together.

3.5. Soil Resilience

The resilience index was calculated according to MBC. The results showed that SP resilience at 35 days was much lower than that of CP, SB, and SP (Figure 6), because the MBC of SP at 35 days was dramatically higher than those of the other soils. Compared to the control soil, the MBC of SP became 11.36 times greater, and the variation in the range of other soils (SB, CP, and CB) was between 0.09 and 1.54 times.
The resilience of SP was the lowest among the HPA/HBA-treated soils, which was measured in negative values. The other soils (SB, CP, and CB) produced values above zero. The resilience of CP and CB was higher than that of SB. Therefore, it was speculated that under phenolic acid pressure, the 3-year corn monoculture soil had a higher resilience than the 2-year soybean monoculture soil.

4. Discussion

For the bacterial pattern, first, HPA and HBA-induced Bacillus (band 1) and Gemmatimonadetes (bands 2–4) were dominant in the amendment soils. Previous studies reported that Gemmatimonadetes and Acidobacteria were listed as the most abundant phyla in monocultural tobacco soils [22]. Gemmatimonadetes was positively correlated with available phosphorus [23]. Bacillus was proven as the dominant and common bacterium species in crop soil with diverse functions from nutrient cycling to stress resistance [24]. Based on the enriched bacterial species, this suggested that the response of the bacterial community to HPA/HBA amendment showed a positive effect on soil restoration and crop growth. Combining the analyses in Figure 2 and Table 4, it was determined that the bacteria numbers induced by HPA were higher than those induced by HBA. According to Table 4, the bacterial intensity ratio of SP/S at 35 days was 1.38-fold, however, the fungal intensity ratio of SP/S at 35 days was 0.99-fold. Therefore, it was speculated that the MBC increase in HPA at 35 days could mainly be caused by bacterial contribution. Bacteria could have a more important role in degrading HPA than fungi.
Bacterial band 5 with a 98% similarity to Cohnella sp., reported as relative nitrogen-fixing bacteria, was induced in the CP-35-day soil, not in the SP-35-day soil. Band 6 belonging to Acidobacterias colonized in CP-35-days, CB-35-days, and SB-35-days, not in SP-35-days. It was reported that these components were abundant in forest soil and played an important role in ecological functions [19]. Band 5 and band 6 were not present in SP soils, which indicated that the nutrient nitrogen transformation and ecological function of SP soil were lower than those of CP. CB and CP had higher resilience at 35 days than SB and SP. This suggested that 2 years of soybean monoculture could potentially have poorer resilience than 3 years of monoculture corn soils under high concentration amendment of phenolic acids, which could be one of major reasons why the monoculture barrier of soybean was more severe than that of corn.
The amplified primers often had a certain bias to some extent [13]. Except for the NS1/FUNGI primers listed in this study, EF390/FR1 primers [25] were also used to detect the soil fungal samples. It is worth noting that one prominent fungal species was detected using EF390/FR1 primers. This fungus was dominant in control corn and soybean soils but absent in phenolic-acid-amended soils whose 18S rDNA was cloned and assigned a GenBank number (EF458667) showing a 100% similarity to one uncultured Chaetomium clone (KU961815), which was reported to be the biocontrol fungus to plant pathogen and also was helpful for the biological nitrogen fixation [26]. Olk et al. [27] reported that the phenols accumulated by continuous cropping inhibited nitrogen mineralization and affected crop N uptake. This study showed that the addition of HPA/HBA resulted in the disappearance of the beneficial fungi and also induced a large number of molds such as Aspergillus and Penicillium, which was consistent with the previous publication. Some researchers reported the increased saprophytic fungi reduced soil fertility and quality [8]. However, others thought Aspergillus and Penicillium could play an important role in suppressing soil-borne diseases by competing with pathogens for nutrition [28].
Phenolic acids as the secondary metabolites of plants were biosynthesized mainly by the shikimate pathway [29]. The phenolic compounds were accumulated in monocultural crops and were reported to inhibit crop growth, which had been considered as one of the barrier factors for continuous cropping [2]. Phenol function groups also inhibited microbial respiration [30]. This study determined that HPA and HBA with carboxyl and phenol groups can be degraded and utilized by microorganisms. In other words, this allelopathy can be relieved by the combination of some special bacteria and fungi. It was inferred that Aspergillus and Penicillium could prefer to degrade HBA/HPA as the carbon source and could survive in high-concentration pressure of phenolic acids. As the fungal diversities of CB and SB were higher than those of CP and SP, respectively, the fungal community degrading HBA was more diverse than that degrading HPA. Previous studies also reported Aspergillus and Penicillium having a high ability to degrade soil phenolic acids [31,32].
The study showed that HPA recruited more bacteria than HBA. The microbial degradation pathway for HPA/HBA mainly included enzyme-catalyzed hydroxylation and ring cleavage [33,34]. Previous research works found that the structure and activity of hydroxylases changed with the different substrates [35]. Pseudomonas putida F6 degraded HPA faster than Dihydroxybenzoic acid (DHBA), and the rate of oxygen consumption of HPA as the reaction substrate was 40 times faster than that of DHBA as the substrate [33].
In this study, HPA and HBA changed soil microbial community structure. It can be speculated that the allelopathy of HPA and HBA was relieved by soil bacteria and fungi, which would be beneficial to crop growth. Soil microbes degraded phenolic acids and the released organic carbon was transformed into MBC. The progress was finished within a couple of days or 5 weeks according to the previous reports [4,36]. On the other hand, HPA/HBA addition caused some beneficial microbes to disappear such as Chaetomium, which could affect the biological nitrogen fixation and soil nutrient decrease. Furthermore, the loss of nitrogen cycle microorganisms could affect the nutrient absorption of crops and cause yield reduction.

5. Conclusions

The study analyzed the effects of phenolic acids on soil bacterial and fungal communities in corn and soybean cropping systems. HPA/HBA amendment had different effects on soybean and corn microbial communities. HPA induced more bacteria than HBA. The increased MBC of SP at 35 days was mainly caused by the bacterial contribution. The organic carbon transformation from HBA/HPA to soil MBC was important to maintain soil health and crop growth, demonstrating that the soil had a sustainable function under HPA/HBA pressure. HPA/HBA amendment enriched the bacteria such as Gemmatimonas, Bacillus, and Acidobacteria, and fungi such as Penicillium and Aspergillus. HBA-amended soybean and corn soils had a significantly higher fungal diversity than HPA-amended soils. The bacterial and fungal diversities had a significantly negative correlation. However, the bacterial diversity had no significant change. Assessment of the changed bacterial and fungal communities under the HPA/HBA pressure provided a better understanding of the monoculture barrier to crop production.

Author Contributions

Methodology, Y.D., W.R., S.W. and W.K.; Resources, J.W.; Writing—original draft, C.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China for supporting the work (No. 2022YFE0114000).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Xiaoming Li and Xiaohua Qu for the field and lab help.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, S.; Gao, Z.; Liu, H. Continuous cropping obstacle and rhizospheric microecology III. Soil phenolic acids and their biological effect. Chin. J. Appl. Ecol. 2000, 11, 741–744. Available online: https://d.wanfangdata.com.cn/periodical/ChlQZXJpb2RpY2FsQ0hJTmV3UzIwMjMwNDI2Eg95eXN0eGIyMDAwMDUwMjMaCHF0MXZlbmZn (accessed on 7 November 2022).
  2. Li, X.L.; Li, Z.; Li, Y.T.; Zhang, W.P.; Zeng, X.L. Advances on allelopathy of plants. Chin. Agric. Sci. Bull. 2009, 25, 142–146. Available online: https://www.webofscience.com/wos/alldb/full-record/CSCD:5456600 (accessed on 7 November 2022).
  3. Li, Y.G.; Wang, L.Y.; Zhang, S.Q.; Sun, L.P.; Zhao, T.X.; Xu, L.K. A preliminary analysis of main influencing factors on maize seedling growth under long term continuous maize cropping obstacle. J. Northest Agric. Sci. 2017, 42, 27–31. [Google Scholar] [CrossRef]
  4. Lv, F.J.; Xiao, Y.P.; Wei, L.G.; Wang, R.Q.; Yuan, Z.Q.; Lin, H.X.; Liu, R.G. Research progress in ecological effect of root exudates and its relationship with continuous cropping obstacle. Acta Agric. Jiangxi 2016, 28, 8–14. [Google Scholar] [CrossRef]
  5. Zhang, D.; Liang, X.; Wang, J. A review of plant root exudates. Chin. Agric. Sci. Bull. 2014, 30, 314–320. Available online: https://d.wanfangdata.com.cn/periodical/ChlQZXJpb2RpY2FsQ0hJTmV3UzIwMjMwNDI2Eg96Z254dGIyMDE0MzUwNTQaCDk1bDRqem43 (accessed on 7 November 2022).
  6. Liu, X.Y.; He, P.; Jin, J.Y. Effect of potassium chloride on the exudation of sugars and phenolic acids by maize root and its relation to growth of stalk rot pathogen. Plant Nutr. Fertil. Sci. 2008, 14, 929–934. [Google Scholar] [CrossRef]
  7. Ruan, W.B.; Liu, M.H.; Huang, B.; Yan, F.; Wang, J.G.; Gao, Y.B. Allelopathic effect of p-and m-hydroxy-phenylacetic acid on soybean (Glycine max L.) germination. germination. Chin. J. Appl. Ecol. 2003, 14, 785–788. Available online: https://d.wanfangdata.com.cn/periodical/ChlQZXJpb2RpY2FsQ0hJTmV3UzIwMjMwNDI2Eg95eXN0eGIyMDAzMDUwMzEaCGljenVjeXh2 (accessed on 7 November 2022).
  8. Zou, L.; Yuan, X.Y.; Li, L.; Wang, X.Y. Effects continuous cropping on soil microbes on soybean roots. J. Microbiol. 2005, 25, 27–30. [Google Scholar] [CrossRef]
  9. Zhan, X.M.; Han, X.R.; Yang, J.F.; Gao, Z.Q. The effect of succession cropping and soybean stubble on soybean root exudates. Chin. J. Soil Sci. 2004, 5, 631–635. [Google Scholar]
  10. Lin, Q.M.; Wu, Y.L.; Liu, H.L. Modification of fumigation extraction method for measuring soil microbial biomass carbon. Chin. J. Ecol. 1999, 18, 63–66. Available online: https://d.wanfangdata.com.cn/periodical/ChlQZXJpb2RpY2FsQ0hJTmV3UzIwMjMwNDI2Eg5RSzE5OTkwMTA2MzI2MBoIMW1qaGoxYTY= (accessed on 7 November 2022).
  11. Muyzer, G.; Dewaale, C.; Uitterlinden, A.G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. [Google Scholar] [CrossRef] [PubMed]
  12. May, L.A.; Smiley, B.; Schimidt, M.G. Comparative denaturing gradient gel electrophoresis analysis of fungal communities associated with whole plant corn silage. Can. J. Microbiol. 2001, 47, 829–841. [Google Scholar] [CrossRef] [PubMed]
  13. Li, C.G.; Li, X.M.; Kong, W.D.; Wu, Y.; Wang, J.G. Effect of monoculture soybean on soil microbial community in the Northeast China. Plant Soil. 2010, 330, 423–433. [Google Scholar] [CrossRef]
  14. Müller, A.K.; Westergaard, K.; Christensen, S.; Sørensen, S.J. The diversity and function of soil microbial communities exposed to different disturbances. Microb. Ecol. 2002, 44, 49–58. [Google Scholar] [CrossRef]
  15. Marschner, P.; Neumann, G.; Kania, A.; Weiskopf, L.; Lieberei, R. Spatial and temporal dynamics of the microbial community structure in the rhizosphere of cluster roots of white lupin (Lupinus albus L.). Plant Soil. 2002, 246, 167–174. [Google Scholar] [CrossRef]
  16. Orwin, K.H.; Wardle, D.A. New indices for quantifying the resistance and resilience of soil biota to exogenous disturbances. Soil Biol. Biochem. 2004, 36, 1907–1912. [Google Scholar] [CrossRef]
  17. Benhamou, N.; Belanger, R.R.; Paulitz, T.C. Induction of differential host responses by Pseudomonas fluorescens in Ri T-DNA-transformed pea roots after challenge with Fusarium oxysporum f. sp. pisi and Pythium ultimum. Phytopathology 1996, 86, 1174–1185. [Google Scholar] [CrossRef]
  18. Wang, L.Y.; Chen, S.F.; Wang, L.; Zhou, Y.G.; Liu, H.C. Cohnella plantaginis sp. nov., a novel nitrogen-fixing species isolated from plantain rhizosphere soil. Antonie Van Leeuwenhoek 2012, 102, 83–89. [Google Scholar] [CrossRef]
  19. Matsuo, H.; Kudo, C.; Li, J.; Tonouchi, A. Acidicapsa acidisoli sp. nov., from the acidic soil of a deciduous forest. Int. J. Syst. Evol. Microbiol. 2017, 67, 862–867. [Google Scholar] [CrossRef]
  20. Kalam, S.; Basu, A.; Ahmad, I.; Sayyed, R.Z.; El-Enshasy, H.A.; Dailin, D.J.; Suriani, N.L. Recent understanding of soil acidobacteria and their Ecological significance: A critical review. Front. Microbiol. 2020, 11, 580024. [Google Scholar] [CrossRef]
  21. Liu, C.X.; Dong, Y.H.; Jiao, R.Z. Research progress in Acidobacteria diversity in forest soil. World For. Res. 2016, 29, 17–22. [Google Scholar] [CrossRef]
  22. Bai, Y.; Wang, G.; Cheng, Y.; Shi, P.; Yang, C.; Yang, H.; Xu, Z. Soil acidification in continuously cropped tobacco alters bacterial community structure and diversity via the accumulation of phenolic acids. Sci. Rep. 2019, 9, 12499. [Google Scholar] [CrossRef]
  23. Liu, J.L.; Ha, V.N.; Shen, Z.; Zhu, H.L.; Zhao, F.; Zhao, Z. Characteristics of bulk and rhizosphere soil microbial community in an ancient Platycladus orientalis forest. Appl. Soil Ecol. 2018, 132, 91–98. [Google Scholar] [CrossRef]
  24. Saxena, A.K.; Kumar, M.; Chakdar, H.; Anuroopa, N.; Bagyaraj, D.J. Bacillus species in soil as a natural resource for plant health and nutrition. J. Appl. Microbiol. 2020, 128, 1583–1594. [Google Scholar] [CrossRef]
  25. Vainio, E.J.; Hantula, J. Direct analysis of wood-inhabiting fungi using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Mycol. Res. 2000, 104, 927–936. [Google Scholar] [CrossRef]
  26. Wang, R.; Zhang, H.C.; Sun, L.G.; Qi, G.F.; Chen, S.; Zhao, X.Y. Microbial community composition is related to soil biological and chemical properties and bacterial wilt outbreak. Sci. Rep. 2017, 7, 343. [Google Scholar] [CrossRef] [PubMed]
  27. Olk, D.C.; Anders, M.M.; Filley, T.R.; Isbell, C. Crop nitrogen uptake and soil phenols accumulation under continuous rice cropping in Arkansas. Soil Sci. Soc. Am. J. 2009, 73, 952–960. [Google Scholar] [CrossRef]
  28. De Corato, U. Soil microbiota manipulation and its role in suppressing soil-borne plant pathogens in organic farming systems under the light of microbiome-assisted strategies. Chem. Biol. Technol. Agric. 2020, 7, 17. [Google Scholar] [CrossRef]
  29. Quideau, S.; Deffieux, D.; Douat-Casassus, C.; Pouységu, L. Plant polyphenols: Chemical properties, biological activities, and synthesis. Angew. Chem. Int. Ed. 2011, 50, 586–621. [Google Scholar] [CrossRef]
  30. Zwetsloot, M.J.; Kessler, A.; Bauerle, T.L. Phenolic root exudate and tissue compounds vary widely among temperate forest tree species and have contrasting effects on soil microbial respiration. New Phytol. 2018, 218, 530–541. [Google Scholar] [CrossRef]
  31. Liu, Y.L. Microbial Diversity and Degradation Mechanism of Phenolic Acid Degradtion Microbes in Soil of Coptis chinensis. Master’s Thesis, Southwest University, Chongqing, China, 2019; pp. 1–102. [Google Scholar]
  32. Wang, J.; Wang, B.B.; Shang, F.J.; Su, L.X.; Zhao, S.G.; Hong, S.; Zhao, Q.Y. Screening, identification and antimicrobial activity of microbial strains degrading autotoxic phenolic acids in the rhizosphere of vanilla. J. Trop. Biol. 2022, 13, 595–604. [Google Scholar] [CrossRef]
  33. O’connor, K.E.; Witholt, B.; Duetz, W. p-Hydroxyphenylacetic acid metabolism in Pseudomonas putida F6. J. Bacteriol. 2001, 183, 928–933. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, W.B.; Ma, X.S.; Donf, Y.F.; Wang, H.T.; Wang, Y.P.; Yi, W.H. Community characteristics and degradation metabolism regulation of soil phenolic acid degrading bacteria in poplar plantations under continuous cropping and crop rotation. Chin. J. Appl. Environ. Biol. 2016, 22, 0815–0822. [Google Scholar]
  35. Tongsook, C.; Sucharitakul, J.; Thotsaporn, K.; Chaiyen, P. Interactions with the Substrate Phenolic Group Are Essential for Hydroxylation by the Oxygenase Component of p-Hydroxyphenylacetate 3-Hydroxylase. J. Biol. Chem. 2011, 286, 44491–44502. [Google Scholar] [CrossRef]
  36. He, Z.L.; Yao, L.H.; Zhang, X.F.; Li, Y.; Wang, D.K.; Kang, L.; Cui, C.; Huang, A.; Yang, R.; Xiao, Q.; et al. Faba bean organs differed in their effects on maize seed germination rate and soil microbial activities as well as their decomposition patterns in a regosol soil. J. Soil. Sci. Plant Nutr. 2020, 20, 367–379. [Google Scholar] [CrossRef]
Sustainability 15 09285 g001 550
Figure 1. MBC during the incubation of (a) corn soils; (b) soybean soils.
Figure 1. MBC during the incubation of (a) corn soils; (b) soybean soils.
Sustainability 15 09285 g001
Sustainability 15 09285 g002 550
Figure 2. DGGE separation of partial 16SrDNA fragments. solid triangle, hollow triangle and solid diamond representing incubation at 7, 14, ad 35 days, separately.
Figure 2. DGGE separation of partial 16SrDNA fragments. solid triangle, hollow triangle and solid diamond representing incubation at 7, 14, ad 35 days, separately.
Sustainability 15 09285 g002
Sustainability 15 09285 g003 550
Figure 3. DGGE separation of partial 18SrDNA fragments. Solid triangle, hollow triangle and solid diamond representing incubation at 7, 14, and 35 days, separately.
Figure 3. DGGE separation of partial 18SrDNA fragments. Solid triangle, hollow triangle and solid diamond representing incubation at 7, 14, and 35 days, separately.
Sustainability 15 09285 g003
Sustainability 15 09285 g004 550
Figure 4. Diversities of bacterial and fungal community. Solid triangle, hollow triangle and solid diamond represent incubation at 7, 14, 35 days, separately.
Figure 4. Diversities of bacterial and fungal community. Solid triangle, hollow triangle and solid diamond represent incubation at 7, 14, 35 days, separately.
Sustainability 15 09285 g004
Sustainability 15 09285 g005 550
Figure 5. Principal component analysis (PCA) of bacterial community (left) and fungal community (right). Solid triangle, hollow triangle and solid diamond represent incubation at 7, 14, 35 days, separately.
Figure 5. Principal component analysis (PCA) of bacterial community (left) and fungal community (right). Solid triangle, hollow triangle and solid diamond represent incubation at 7, 14, 35 days, separately.
Sustainability 15 09285 g005
Sustainability 15 09285 g006 550
Figure 6. The resilience of HPA/HBA amended soils.
Figure 6. The resilience of HPA/HBA amended soils.
Sustainability 15 09285 g006
Table
Table 1. The abbreviations and sources of soil samples.
Table 1. The abbreviations and sources of soil samples.
Sample AbbreviationsSample Sources
C (or Corn)Corn control soil without HPA/HBA amendment
CPCorn soil amended with HPA in proportion of 20 mg g−1 soil
CBCorn soil amended with HBA in proportion of 20 mg g−1 soil
S (or Soybean)Soybean control soil without HPA/HBA amendment
SPSoybean soil amended with HPA in proportion of 20 mg g−1 soil
SBSoybean soil amended with HBA in proportion of 20 mg g−1 soil
Table
Table 2. Chemical parameters of soil samples.
Table 2. Chemical parameters of soil samples.
Soil SamplesTotal N (g kg−1)NH4Ac-K (mg kg−1)Olsen-P (mg kg−1)Organic Matter (%)
Corn soil1.11160.0521.473.00
Soybean soil1.05145.7818.262.73
Table
Table 3. The Shannon diversities of the soil samples.
Table 3. The Shannon diversities of the soil samples.
TreatmentsBacterial Shannon Diversity
(p = 0.54)		Fungal Shannon Diversity
(p = 0.04)
C▲3.38 ± 0.05 a3.39 ± 0.04 abcd
CP▲3.29 ± 0.12 ab3.47 ± 0.04 a
CB▲3.34 ± 0.06 ab3.45 ± 0.02 a
C◆3.43 ± 0.07 ab3.33 ± 0.01 abcd
CP◆3.30 ± 0.12 ab3.43 ± 0.02 ab
CB◆3.28 ± 0.08 ab3.46 ± 0.01 a
C△3.43 ± 0.02 ab3.26 ± 0.10 bcd
CP△3.30 ± 0.09 ab3.23 ± 0.03 cd
CB△3.25 ± 0.02 b3.45 ± 0.03 a
S▲3.37 ± 0.05 ab3.26 ± 0.18 bcd
SP▲3.35 ± 0.06 ab3.36 ± 0.02 abcd
SB▲3.41 ± 0.04 ab3.45 ± 0.02 a
S◆3.47 ± 0.03 a3.21 ± 0.04 d
SP◆3.29 ± 0.05 ab3.40 ± 0.11 abc
SB◆3.27 ± 0.06 b3.46 ± 0.07 a
S△3.39 ± 0.02 ab3.37 ± 0.03 abcd
SP△3.39 ± 0.08 ab3.29 ± 0.02 abcd
SB△3.27 ± 0.07 b3.44 ± 0.05 a
Values that do not share a letter are significantly different (p < 0.05). Solid triangle, hollow triangle and solid diamond represent incubation at 7, 14, 35 days, separately.
Table
Table 4. The intensity ratio of the amended soil to the control.
Table 4. The intensity ratio of the amended soil to the control.
The Bacterial Intensity Ratio of Addition to Control (p = 0.05)The Fungal Intensity Ratio of Addition to Control (p = 0.7)
CP▲/C▲1.23 ± 0.13 abcd1.24 ± 0.12 ab
CB▲/C▲0.95 ± 0.08 d1.34 ± 0.36 ab
CP◆/C◆1.39 ± 0.24 a1.09 ± 0.10 ab
CB◆/C◆1.13 ± 0.21 abcd1.19 ± 0.05 ab
CP△/C△1.20 ± 0.13 abcd1.16 ± 0.19 ab
CB△/C△1.07 ± 0.07 bcd1.41 ± 0.33 a
SP▲/S▲1.28 ± 0.05 abc1.14 ± 0.40 ab
SB▲/S▲1.01 ± 0.08 cd1.24 ± 0.28 ab
SP◆/S◆1.29 ± 0.29 ab1.24 ± 0.13 ab
SB◆/S◆1.09 ± 0.21 bcd1.20 ± 0.13 ab
SP△/S△1.38 ± 0.09 a0.99 ± 0.09 b
SB△/S△1.25 ± 0.13 abc1.13 ± 0.12 ab
Values that do not share a letter are significantly different (p < 0.05). Solid triangle, hollow triangle and solid diamond represent incubation at 7, 14, 35 days, separately.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, C.; Deng, Y.; Wang, J.; Ruan, W.; Wang, S.; Kong, W. Effects of p-Hydroxyphenylacetic Acid and p-Hydroxybenzoic Acid on Soil Bacterial and Fungal Communities. Sustainability 2023, 15, 9285. https://doi.org/10.3390/su15129285

AMA Style

Li C, Deng Y, Wang J, Ruan W, Wang S, Kong W. Effects of p-Hydroxyphenylacetic Acid and p-Hydroxybenzoic Acid on Soil Bacterial and Fungal Communities. Sustainability. 2023; 15(12):9285. https://doi.org/10.3390/su15129285

Chicago/Turabian Style

Li, Chunge, Ye Deng, Jingguo Wang, Weibin Ruan, Shang Wang, and Weidong Kong. 2023. "Effects of p-Hydroxyphenylacetic Acid and p-Hydroxybenzoic Acid on Soil Bacterial and Fungal Communities" Sustainability 15, no. 12: 9285. https://doi.org/10.3390/su15129285

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop