Peppers under Siege: Revealing the Prevalence of Viruses and Discovery of a Novel Potyvirus Species in Venezuela
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus Surveys
2.2. RNA Extraction, RT-PCR
2.3. Cloning and DNA Sequencing
2.4. Molecular Characterization of Putative Potyvirus Species
2.5. Mechanical Transmission of Putative Potyvirus Isolate
2.6. Analysis of Principal Coordinates (PCoA)
3. Results
3.1. Field Survey Results
3.2. Analysis of Principal Coordinates (PCoA)
3.3. Characterization of Potyvirus Isolates
4. Discussion
5. Conclusions and Prospects
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Virus Genus | Primer Name | Sequence (5’-3’) * | Amplicon Size (bp) | Reference |
---|---|---|---|---|
Ilarvirus | Ilar1F5/ | GCNGGWTGYGGDAARWCNAC | 300 | [16] |
Ilar1R7 | AMDGGWAYYTGYTYNGTRTCACC | |||
Nepovirus | Nepo-AF | GGHDTBCAKTMYSARRARTGG | 255 | [12] |
Nepo-AR | TGDCCASWVARYTCYCCATA | |||
Nepo-CF | TTRKDYTGGYKAAMYYCCA | 640 | [12] | |
Nepo0CR | TMATCSWASCRHGTGSKKGCCA | |||
Orthotospovirus | L1/ | AATTGCCTTGCAACCAATTC | 276 | [10] |
L2 | ATCAGTCGAAATGGTCGGCA | |||
Potexvirus | Potex 1RC/ | TCAGTRTTDGCRTCRAARGT | 584 | [17] |
Potex 5 | CAYCARCARGCMAARGAYGA | |||
Potyvirus | MJ1/ | TGGTHTGGTGYATHGARAAYGG | 327 | [14] |
MJ2 | TGCTGCKGCYTTCATYTG | |||
B1570/ | GGAGAGTCTTGGGCT | 1.200 | [11] | |
PY10 | GCAATGCTTGAGTCATGGGG | |||
PepSMoV-CP-F | GCAGATGACACAAGTAAAACT | 837 | This study | |
PepSMoV-CP-R | CATATTCTTCACCCCAAGCAA | |||
Tobamovirus | TobUni1/ | ATTTAAGTGGASGGAAAAVCAT | 750 | [15] |
TobUni2 | GTYGTTGATGAGTTCRTGGA | |||
Tobravirus | Tobra-F3/ | GGTGGKCAATGGTCTTWTTGG | 800 | [13] |
Tobra-R2 | GTCAGCTGYTGATCAGATAACC |
Virus/Acronym | Genbank Accession No. |
---|---|
agropyron mosaic virus | NC_005903.1 |
algerian watermelon mosaic virus | NC_010736.1 |
apium virus Y | NC_014905.1 |
arracacha mottle virus | NC_018176.1 |
artichoke latent virus isolate FR37 | NC_026759.1 |
asparagus virus 1 isolate DSMZ PV-0954 | NC_025821.1 |
banana bract mosaic virus | NC_009745.1 |
barley mild mosaic virus RNA 1 | NC_003483.1 |
barley mild mosaic virus RNA2 | NC_003482.1 |
barley yellow mosaic virus RNA 1 | NC_002990.1 |
barley yellow mosaic virus RNA 2 | NC_002991.1 |
basella rugose mosaic virus | NC_009741.1 |
bean common mosaic necrosis virus | NC_004047.1 |
bean common mosaic virus | NC_003397.1 |
bean yellow mosaic virus | NC_003492.1 |
beet mosaic virus | NC_005304.1 |
bidens mosaic virus isolate SP01 | NC_023014.1 |
bidens mottle virus | NC_014325.1 |
blackberry virus Y | NC_008558.1 |
blue squill virus A | NC_019415.1 |
brazilian weed virus Y isolate KLL097 | NC_030847.1 |
brome streak mosaic virus | NC_003501.1 |
brugmansia mosaic virus strain SK | NC_020105.1 |
brugmansia suaveolens mottle virus | NC_014536.1 |
caladenia virus A | NC_018572.1 |
calla lily latent virus strain m19 polyprotein gene | NC_021196.1 |
callistephus mottle virus isolate DJ | NC_030794.1 |
canna yellow streak virus | NC_013261.1 |
carrot thin leaf virus isolate CTLV-Cs | NC_025254.1 |
cassava brown streak virus | NC_012698.2 |
catharanthus mosaic virus isolate Mandevilla-US | NC_027210.1 |
celery mosaic virus | NC_015393.1 |
chilli ringspot virus | NC_016044.1 |
chilli veinal mottle virus | NC_005778.1 |
chinese yam necrotic mosaic virus | NC_018455.1 |
clover yellow vein virus | NC_003536.1 |
coccinia mottle virus isolate Su12-25 | NC_030840.1 |
cocksfoot streak virus | NC_003742.1 |
colombian datura virus | NC_020072.1 |
cowpea aphid-borne mosaic virus | NC_004013.1 |
cucumber vein yellowing virus | NC_006941.1 |
cucurbit vein banding virus isolate 3.1 | NC_035134.1 |
daphne mosaic virus | NC_008028.1 |
dasheen mosaic virus | NC_003537.1 |
donkey orchid virus A isolate SW3.1 polyprotein gene | NC_021197.1 |
east asian passiflora virus | NC_007728.1 |
endive necrotic mosaic virus strain ENMV-FR | NC_034273.1 |
ecuadorian rocoto virus isolate Rocoto | EU495234.1 |
euphorbia ringspot virus isolate PV-0902 | NC_031339.1 |
freesia mosaic virus | NC_014064.1 |
fritillary virus Y | NC_010954.1 |
habenaria mosaic virus genomic RNA | NC_021786.1 |
hardenbergia mosaic virus | NC_015394.2 |
hippeastrum mosaic virus | NC_017967.1 |
hordeum mosaic virus | NC_005904.1 |
hubei poty-like virus 1 strain SCM51506 polyprotein gene | NC_032912.1 |
impatiens flower break potyvirus isolate Asan | NC_030236.1 |
iranian johnsongrass mosaic virus | NC_018833.1 |
iris severe mosaic virus isolate BJ | NC_029076.1 |
japanese yam mosaic virus | NC_000947.1 |
jasmine ringspot virus | NC_029051.1 |
johnsongrass mosaic virus | NC_003606.1 |
keunjorong mosaic virus isolate Cheongwon | NC_016159.1 |
konjac mosaic virus | NC_007913.1 |
leek yellow stripe virus | NC_004011.1 |
lettuce italian necrotic virus | NC_027706.1 |
lettuce mosaic virus | NC_003605.1 |
lily mottle virus | NC_005288.1 |
longan witches broom-associated virus isolate Han1 | NC_034835.1 |
lupine mosaic virus | NC_014898.1 |
maize dwarf mosaic virus | NC_003377.1 |
moroccan watermelon mosaic virus | NC_009995.1 |
narcissus degeneration virus | NC_008824.1 |
narcissus late season yellows virus isolate Marijiiup8 | NC_023628.1 |
narcissus yellow stripe virus | NC_011541.1 |
oat mosaic virus RNA 1 | NC_004016.1 |
oat mosaic virus RNA 2 | NC_004017.1 |
oat necrotic mottle virus | NC_005136.1 |
onion yellow dwarf virus | NC_005029.1 |
ornithogalum mosaic virus | NC_019409.1 |
panax virus Y | NC_014252.1 |
papaya leaf distortion mosaic virus | NC_005028.1 |
papaya ringspot virus | NC_001785.1 |
passion fruit woodiness virus | NC_014790.2 |
pea seed-borne mosaic virus | NC_001671.1 |
peanut mottle virus | NC_002600.1 |
pecan mosaic-associated virus isolate LA | NC_030293.1 |
pennisetum mosaic virus | NC_007147.1 |
pepper mottle virus | NC_001517.1 |
pepper severe mosaic virus | NC_008393.1 |
pepper veinal mottle virus | NC_011918.1 |
pepper yellow mosaic virus | NC_014327.1 |
peru tomato mosaic virus | NC_004573.1 |
plum pox virus | NC_001445.1 |
pokeweed mosaic virus isolate PkMV-PA | NC_018872.2 |
potato virus A | NC_004039.1 |
potato virus V | NC_004010.1 |
potato virus Y | NC_001616.1 |
rice necrosis mosaic virus RNA 1 | NC_028144.1 |
rice necrosis mosaic virus RNA 2 | NC_028145.1 |
rose yellow mosaic virus | NC_019031.1 |
ryegrass mosaic virus | NC_001814.1 |
scallion mosaic virus | NC_003399.1 |
shallot yellow stripe virus | NC_007433.1 |
sorghum mosaic virus | NC_004035.1 |
soybean mosaic virus | NC_002634.1 |
squash vein yellowing virus | NC_010521.1 |
sugarcane mosaic virus | NC_003398.1 |
sugarcane streak mosaic virus | NC_014037.1 |
sunflower chlorotic mottle virus | NC_014038.1 |
sunflower mild mosaic virus isolate Entre Rios | NC_021065.1 |
sunflower ring blotch virus isolate Chaco | NC_034208.1 |
sweet potato feathery mottle virus | NC_001841.1 |
sweet potato latent virus | NC_020896.1 |
sweet potato mild mottle virus | NC_003797.1 |
sweet potato virus 2 | NC_017970.1 |
sweet potato virus C | NC_014742.1 |
sweet potato virus G isolate Jesus Maria | NC_018093.1 |
tall oatgrass mosaic virus isolate Benesov | NC_022745.1 |
tamarillo leaf malformation virus isolate A | NC_026615.1 |
telosma mosaic virus | NC_009742.1 |
thunberg fritillary virus | NC_007180.1 |
tobacco etch virus | NC_001555.1 |
tobacco mosqueado virus isolate RS-01 | NC_030118.1 |
References
- Tandukar, S.; Sherchan, S.P.; Haramoto, E. Applicability of crAssphage, pepper mild mottle virus, and tobacco mosaic virus as indicators of reduction of enteric viruses during wastewater treatment. Sci. Rep. 2020, 10, 3616. [Google Scholar] [CrossRef] [PubMed]
- Zayed, M.S.; Taha, E.-K.A.; Hassan, M.M.; Elnabawy, E.-S.M. Enhance Systemic Resistance Significantly Reduces the Silverleaf Whitefly Population and Increases the Yield of Sweet Pepper, Capsicum annuum L. var. annuum. Sustainability 2022, 14, 6583. [Google Scholar] [CrossRef]
- FAO. The FAO Statistical Database (FAOSTAT): Food and Agriculture Organization of the United Nations. 2023. Available online: http://faostat.fao.org/DesktopDefault.aspx?PageID=567#ancor (accessed on 7 August 2023).
- Rivera-Toro, D.M.; López-López, K.; Vaca-Vaca, J.C. First molecular characterization of pepper severe mottle virus infecting chili pepper crops in Colombia. J. Plant Pathol. 2021, 103, 321–325. [Google Scholar] [CrossRef]
- Nava, A.; Londoño, A.; Polston, J.E. Characterization and distribution of tomato yellow margin leaf curl virus, a begomovirus from Venezuela. Arch. Virol. 2013, 158, 399–406. [Google Scholar] [CrossRef]
- Pérez-Colmenares, Y.; Mejías, A.; Rodríguez-Román, E.; Avilán, D.; Gómez, J.C.; Olaechea, J.E.; Zambrano, K.; Marys, E. Identification of Tomato spotted wilt virus Associated with Fruit Damage During a Recent Virus Outbreak in Pepper in Venezuela. Plant Dis. 2015, 99, 896. [Google Scholar] [CrossRef]
- Rodríguez, Y.; Rangel, E.; Centeno, F.; Mendoza, O.; Parra, A. Detection of viral diseases affecting sweet pepper in Counties Iribarren, Jimenez and Torres of Lara State, Venezuela, using ELISA technique. Rev. Fac. Agron. (LUZ) 2004, 21, 93–103. [Google Scholar]
- Jaimez, R.; Costa, M.; Araque, O.; Palha, M.; Salazar, R.; Portugal, L. Greenhouses in Venezuela: Current status and development prospects. Rev. Fac. Agron. (LUZ) 2015, 32, 145–174. [Google Scholar]
- QGIS.org. QGIS Geographic Information System. QGIS Association. 2023. Available online: http://www.qgis.org (accessed on 7 August 2023).
- Chatzivassiliou, E.K.; Weekes, R.; Morris, J.; Wood, K.R.; Barker, I.; Katis, N.I. Tomato spotted wilt virus (TSWV) in Greece: Its incidence following the expansion of Frankliniella occidentalis, and characterisation of isolates collected from various hosts. Ann. Appl. Biol. 2000, 137, 127–134. [Google Scholar] [CrossRef]
- da Cunha, L.C.; Resende, R.D.O.; Nagata, T.; Inoue-Nagata, A.K. Distinct features of Pepper yellow mosaic virus isolates from tomato and sweetpepper. Fitol. Bras. 2004, 29, 663–667. [Google Scholar] [CrossRef]
- Digiaro, M.; Elbeaino, T.; Martelli, G. Development of degenerate and species specific primers for the differential and simultaneous RT-PCR detection of grapevine infecting nepoviruses of subgroups A, B and C. J. Virol. Methods 2007, 141, 34–40. [Google Scholar] [CrossRef]
- Jones, D.; Farreyrol, K.; Clover, G.R.G.; Pearson, M.N. Development of a generic PCR detection method for tobraviruses. Australas. Plant Pathol. 2008, 37, 132–136. [Google Scholar] [CrossRef]
- Marie-Jeanne, V.; Ioos, R.; Peyre, J.; Alliot, B.; Signoret, P. Differentiation of Poaceae potyviruses by reverse transcription-polymerase chain reaction and restriction analysis. J. Phytopathol. 2000, 148, 141–151. [Google Scholar] [CrossRef]
- Letschert, B.; Adam, G.; Lesemann, D.E.; Willingmann, P.; Heinze, C. Detection and differentiation of serologically cross-reacting tobamoviruses of economical importance by RT-PCR and RT-PCR-RFLP. J. Virol. Methods 2002, 106, 1–10. [Google Scholar] [CrossRef]
- Untiveros, M.; Perez-Egusquiza, Z.; Clover, G. PCR assays for the detection of members of the genus Ilarvirus and family Bromoviridae. J. Virol. Methods 2010, 165, 97–104. [Google Scholar] [CrossRef] [PubMed]
- van der Vlugt, R.A.; Berendsen, M. Development of a general potexvirus detection method. Eur. J. Plant Pathol. 2002, 108, 367. [Google Scholar] [CrossRef]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Austin, TX, USA, 2011; p. 1546. [Google Scholar]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Hepperle, D. DNA Dragon 1.5.2—DNA Sequence Contig Assembler Software. Version 2012. Available online: https://www.dna-dragon.com/ (accessed on 7 August 2023).
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef]
- Di Rienzo, J.A.; Casanoves, F.; Balzarini, M.G.; González, L.; Tablada, M.; Robledo, Y.C. InfoStat Versión 2011. Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina. 2011. Available online: http://www.infostat.com (accessed on 7 August 2023).
- Inoue-Nagata, A.; Fonseca, M.; Resende, R.; Boiteux, L.; Monte1, D.; Dusi, A.; de Avila, A.; van der Vlugt, A. Pepper yellow mosaic virus, a new potyvirus in sweetpepper, Capsicum annuum. Arch. Virol. 2001, 147, 849–855. [Google Scholar] [CrossRef] [PubMed]
- Inoue-Nagata, A.K.; Jordan, R.; Kreuze, J.; Li, F.; López-Moya, J.J.; Mäkinen, K.; ICTV Report Consortium. ICTV virus taxonomy profile: Potyviridae 2022. J. Gen. Virol. 2022, 103, 001738. [Google Scholar] [CrossRef]
- Scholthof, K.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P.; et al. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef]
- Dombrovsky, A.; Smith, E. Seed transmission of Tobamoviruses: Aspects of global disease distribution. Adv. Seed Biol. 2017, 12, 233–260. [Google Scholar] [CrossRef]
- Afouda, L.A.; Kotchofa, R.; Sare, R.; Zinsou, V.; Winter, S. Occurrence and distribution of viruses infecting tomato and pepper in Alibori in northern Benin. Phytoparasitica 2013, 1, 271–276. [Google Scholar] [CrossRef]
- Karuri, H.; Olago, D.; Neilson, R.; Neri, E.; Opere, A.; Ndegwa, P. Plant parasitic nematode assemblages associated with sweet potato in Kenya and their relationship with environmental variables. Trop. Plant Pathol. 2017, 42, 1–12. [Google Scholar] [CrossRef]
- Viloria, J.A.; Olivares, B.O.; García, P.; Paredes-Trejo, F.; Rosales, A. Mapping Projected Variations of Temperature and Precipitation Due to Climate Change in Venezuela. Hydrology 2023, 10, 96. [Google Scholar] [CrossRef]
- Khaled-Gasmi, W.; Souissi, R.; Boukhris-Bouhachem, S. Temporal distribution of three pepper viruses and molecular characterization of two cucumber mosaic virus isolates in Tunisia. Tunis. J. Plant Prot. 2020, 15, 1–17. [Google Scholar]
- Olivares, B.; Hernandez, R.; Arias, A.; Molina, J.C.; Pereira, Y. Eco-territorial adaptability of tomato crops for sustainable agricultural production in Carabobo, Venezuela. Idesia 2020, 38, 95–102. [Google Scholar] [CrossRef]
- Olivares, B.O.; Vega, A.; Calderón, M.A.R.; Rey, J.C.; Lobo, D.; Gómez, J.A.; Landa, B.B. Identification of Soil Properties Associated with the Incidence of Banana Wilt Using Supervised Methods. Plants 2022, 11, 2070. [Google Scholar] [CrossRef]
- Claflin, S.B.; Jones, L.E.; Thaler, J.S.; Power, A.G. Crop-dominated landscapes have higher vector-borne plant virus prevalence. J. Appl. Ecol. 2017, 54, 1190–1198. [Google Scholar] [CrossRef]
- Singhal, P.; Nabi, S.U.; Yadav, M.K.; Dubey, A. Mixed infection of plant viruses: Diagnostics, interactions and impact on host. J. Plant Dis. Prot. 2021, 128, 353–368. [Google Scholar] [CrossRef]
- Atreya, C.D.; Raccah, B.; Pirone, T.P. A point mutation in the coat protein abolishes aphid transmissibility of a potyvirus. Virology 1990, 178, 161–165. [Google Scholar] [CrossRef]
- Lucinda, N.; Da Rocha, W.B.; Inoue-Nagata, A.K.; Nagata, T. Complete genome sequence of pepper yellow mosaic virus, a potyvirus, occurring in Brazil. Arch. Virol. 2012, 157, 1397–1401. [Google Scholar] [CrossRef]
- Moura, M.F.; Mituti, T.; Marubayashi, J.M.; Gioria, R.; Kobori, R.; Pavan, M.; da Silva, N.; Krause-Sacate, R. A classification of Pepper yellow mosaic virus isolates into pathotypes. Eur. J. Plant Pathol. 2001, 131, 549. [Google Scholar] [CrossRef]
- Ma, Y.; Xing, F.; Che, H.; Gao, S.; Lin, Y.; Li, S. The virome of Piper nigrum: Identification, genomic characterization, prevalence, and transmission of three new viruses of black pepper in China. Plant Dis. 2022, 106, 2082–2089. [Google Scholar] [CrossRef] [PubMed]
- Khaled-Gasmi, W.; Souissi, R.; Boukhris-Bouhachem, S. Cucumber mosaic virus epidemiology in pepper: Aphid dispersal, transmission efficiency and vector pressure. Ann. Appl. Biol. 2023, 182, 101–111. [Google Scholar] [CrossRef]
- Giesbers, A.K.; Roenhorst, A.; Schenk, M.F.; Westenberg, M.; Botermans, M. African eggplant-associated virus: Characterization of a novel tobamovirus identified from Solanum macrocarpon and assessment of its potential impact on tomato and pepper crops. PLoS ONE 2023, 18, e0277840. [Google Scholar] [CrossRef] [PubMed]
Sampling State | Year | Localities | Farms | Number of Samples (n) |
---|---|---|---|---|
Lara | 2008 | Tintorero | F10 to F13 | 80 |
Lara | 2014 | Tintorero | F1 to F9 | 83 |
Miranda | 2014 | Pozo de Rosas San Pedro El Jarillo | F1 to F6 | 108 |
Miranda | 2022 | Pozo de Rosas, El Jarillo, Hoyo de La Puerta, La Reinosa | F7 to F10 | 92 |
Virus/Genbank Accession | Identity | Similarity |
---|---|---|
PepYMV (NC_008393.1) | 76.7 | 83.0 |
EcRV (EU495234.1) | 71.0 | 82.4 |
PeSMV (NC_008393.1) | 74.8 | 82.3 |
PTV (NC_004573.1) | 73.1 | 83.5 |
PepMoV (NC_001517.1) | 69.9 | 79.9 |
PVY (NC_001616.1) | 73.5 | 81.0 |
TEV (NC_001555.1) | 58.6 | 75.4 |
ChiRSV (NC_016044.1) | 57.0 | 74.9 |
ChiVMV (NC_005778.1) | 57.7 | 72.9 |
PVMV (NC_011918.1) | 58.4 | 76.3 |
WTMV (NC_009744.1) | 59.4 | 74.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodríguez-Román, E.; León, Y.; Perez, Y.; Amaya, P.; Mejías, A.; Montilla, J.O.; Ortega, R.; Zambrano, K.; Olivares, B.O.; Marys, E. Peppers under Siege: Revealing the Prevalence of Viruses and Discovery of a Novel Potyvirus Species in Venezuela. Sustainability 2023, 15, 14825. https://doi.org/10.3390/su152014825
Rodríguez-Román E, León Y, Perez Y, Amaya P, Mejías A, Montilla JO, Ortega R, Zambrano K, Olivares BO, Marys E. Peppers under Siege: Revealing the Prevalence of Viruses and Discovery of a Novel Potyvirus Species in Venezuela. Sustainability. 2023; 15(20):14825. https://doi.org/10.3390/su152014825
Chicago/Turabian StyleRodríguez-Román, Eduardo, Yrvin León, Yearlys Perez, Paola Amaya, Alexander Mejías, Jose Orlando Montilla, Rafael Ortega, Karla Zambrano, Barlin Orlando Olivares, and Edgloris Marys. 2023. "Peppers under Siege: Revealing the Prevalence of Viruses and Discovery of a Novel Potyvirus Species in Venezuela" Sustainability 15, no. 20: 14825. https://doi.org/10.3390/su152014825