Bergamot Polyphenols Boost Therapeutic Effects of the Diet on Non-Alcoholic Steatohepatitis (NASH) Induced by “Junk Food”: Evidence for Anti-Inflammatory Activity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Procedures
2.2. Experimental Design
2.3. Diet and Supplementation
2.4. Blood and Tissue Collection
2.5. Blood Analysis
2.6. Histochemistry and Digital Image Analysis of LDs in Rat Liver Sections
2.7. Total Liver Lipid Assay
2.8. Histology and Histological Examination
2.8.1. Toluidine Blue Staining
2.8.2. Silver Impregnation (SI)
2.8.3. Morphological Evaluation
2.9. Analysis of Cytokine Gene Expression
2.10. Data Analysis and Statistical Procedures
3. Results
3.1. Supplementation of SC Diet with BPF Has a Powerful Effect on Levels of Blood TGL
3.2. BPF Augments LDs Loss and Reduces Hepatic Inflammation When Supplemented to SC Diet during Recovery from NASH
3.3. Analysis of Plasmatic Levels of Insulin and Leptin in SC/SC, CAF/CAF, CAF/SC and CAF/SC+BPF Diet Fed Rats
3.4. Anti-Inflammatory Effect of BPF in CAF/SC Diet Treated Livers
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hannah, W.N., Jr.; Harrison, S.A. Lifestyle and dietary interventions in the management of nonalcoholic fatty liver disease. Dig. Dis. Sci. 2016, 61, 1365–1374. [Google Scholar] [CrossRef] [PubMed]
- Haslam, D.W.; James, W.P. Obesity. Lancet 2005, 366, 1197–1209. [Google Scholar] [CrossRef]
- Mouzaki, M.; Allard, J.P. The role of nutrients in the development, progression, and treatment of nonalcoholic fatty liver disease. J. Clin. Gastroenterol. 2012, 46, 457–467. [Google Scholar] [CrossRef] [PubMed]
- Oseini, A.M.; Sanyal, A.J. Therapies in non-alcoholic steatohepatitis (nash). Liver Int. 2017, 37, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Della Corte, C.; Carpino, G.; De Vito, R.; De Stefanis, C.; Alisi, A.; Cianfarani, S.; Overi, D.; Mosca, A.; Stronati, L.; Cucchiara, S.; et al. Docosahexanoic acid plus vitamin d treatment improves features of nafld in children with serum vitamin d deficiency: Results from a single centre trial. PLoS ONE 2016, 11, e0168216. [Google Scholar] [CrossRef] [PubMed]
- Marzuillo, P.; Del Giudice, E.M.; Santoro, N. Pediatric non-alcoholic fatty liver disease: New insights and future directions. World J. Hepatol. 2014, 6, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Wesolowski, S.R.; Kasmi, K.C.; Jonscher, K.R.; Friedman, J.E. Developmental origins of nafld: A womb with a clue. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 81–96. [Google Scholar] [CrossRef] [PubMed]
- Elmaogullari, S.; Demirel, F.; Hatipoglu, N. Risk factors that affect metabolic health status in obese children. J. Pediatr. Endocrinol. Metab. 2017, 30, 49–55. [Google Scholar] [CrossRef] [PubMed]
- Sampey, B.P.; Freemerman, A.J.; Zhang, J.; Kuan, P.F.; Galanko, J.A.; O’Connell, T.M.; Ilkayeva, O.R.; Muehlbauer, M.J.; Stevens, R.D.; Newgard, C.B.; et al. Metabolomic profiling reveals mitochondrial-derived lipid biomarkers that drive obesity-associated inflammation. PLoS ONE 2012, 7, e38812. [Google Scholar] [CrossRef] [PubMed]
- Gasparin, F.R.S.; Carreno, F.O.; Mewes, J.M.; Gilglioni, E.H.; Pagadigorria, C.L.S.; Natali, M.R.M.; Utsunomiya, K.S.; Constantin, R.P.; Ouchida, A.T.; Curti, C.; et al. Sex differences in the development of hepatic steatosis in cafeteria diet-induced obesity in young mice. Biochim. Biophys. Acta. Mol. Basis Dis. 2018, 1864, 2495–2509. [Google Scholar] [CrossRef] [PubMed]
- Sampey, B.P.; Vanhoose, A.M.; Winfield, H.M.; Freemerman, A.J.; Muehlbauer, M.J.; Fueger, P.T.; Newgard, C.B.; Makowski, L. Cafeteria diet is a robust model of human metabolic syndrome with liver and adipose inflammation: Comparison to high-fat diet. Obesity 2011, 19, 1109–1117. [Google Scholar] [CrossRef] [PubMed]
- Parafati, M.; Lascala, A.; Morittu, V.M.; Trimboli, F.; Rizzuto, A.; Brunelli, E.; Coscarelli, F.; Costa, N.; Britti, D.; Ehrlich, J.; et al. Bergamot polyphenol fraction prevents nonalcoholic fatty liver disease via stimulation of lipophagy in cafeteria diet-induced rat model of metabolic syndrome. J. Nutr. Biochem. 2015, 26, 938–948. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, Y.; Sugimoto, K.; Inui, H.; Fukusato, T. Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World J. Gastroenterol. 2015, 21, 3777–3785. [Google Scholar] [CrossRef] [PubMed]
- Della Pepa, G.; Vetrani, C.; Lombardi, G.; Bozzetto, L.; Annuzzi, G.; Rivellese, A.A. Isocaloric dietary changes and non-alcoholic fatty liver disease in high cardiometabolic risk individuals. Nutrients 2017, 9, PMC5691682. [Google Scholar] [CrossRef] [PubMed]
- Dongiovanni, P.; Lanti, C.; Riso, P.; Valenti, L. Nutritional therapy for nonalcoholic fatty liver disease. J. Nutr. Biochem. 2016, 29, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Abenavoli, L.; Milic, N.; Luzza, F.; Boccuto, L.; De Lorenzo, A. Polyphenols treatment in patients with nonalcoholic fatty liver disease. J. Transl. Int. Med. 2017, 5, 144–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Son, C.G.; Wei, Z.; Raghavendran, H.B.; Wang, J.H.; Janda, E. Medicinal herbs and their active compounds for fatty liver diseases. Evid. Based Complement. Alternat. Med. 2017, 2017, 3612478. [Google Scholar] [CrossRef] [PubMed]
- Janda, E.; Lascala, A.; Martino, C.; Ragusa, S.; Nucera, S.; Walker, R.; Gratteri, S.; Mollace, V. Molecular mechanisms of lipid- and glucose-lowering activities of bergamot flavonoids. Pharma Nutr. 2016, 4, S8–S18. [Google Scholar] [CrossRef]
- Janda, E.; Salerno, R.; Martino, C.; Lascala, A.; La Russa, D.; Oliverio, M. Qualitative and quantitative analysis of the proautophagic activity of citrus flavonoids from bergamot polyphenol fraction. Data Brief 2018, 19, 1327–1334. [Google Scholar] [CrossRef] [PubMed]
- Lascala, A.; Martino, C.; Parafati, M.; Salerno, R.; Oliverio, M.; Pellegrino, D.; Mollace, V.; Janda, E. Analysis of proautophagic activities of citrus flavonoids in liver cells reveals the superiority of a natural polyphenol mixture over pure flavones. J. Nutr. Biochem. 2018, 58, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.S.; Cha, B.Y.; Choi, S.S.; Choi, B.K.; Yonezawa, T.; Teruya, T.; Nagai, K.; Woo, J.T. Nobiletin improves obesity and insulin resistance in high-fat diet-induced obese mice. J. Nutr. Biochem. 2013, 24, 156–162. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Jung, U.J.; Cho, S.J.; Jung, H.K.; Shim, S.; Choi, M.S. Citrus unshiu peel extract ameliorates hyperglycemia and hepatic steatosis by altering inflammation and hepatic glucose- and lipid-regulating enzymes in db/db mice. J. Nutr. Biochem. 2013, 24, 419–427. [Google Scholar] [CrossRef] [PubMed]
- Gliozzi, M.; Walker, R.; Muscoli, S.; Vitale, C.; Gratteri, S.; Carresi, C.; Musolino, V.; Russo, V.; Janda, E.; Ragusa, S; et al. Bergamot polyphenolic fraction enhances rosuvastatin-induced effect on ldl-cholesterol, lox-1 expression and protein kinase b phosphorylation in patients with hyperlipidemia. Int. J. Cardiol. 2013, 170, 140–145. [Google Scholar] [CrossRef] [PubMed]
- Mollace, V.; Sacco, I.; Janda, E.; Malara, C.; Ventrice, D.; Colica, C.; Visalli, V.; Muscoli, S.; Ragusa, S.; Muscoli, C.; et al. Hypolipemic and hypoglycaemic activity of bergamot polyphenols: From animal models to human studies. Fitoterapia 2011, 82, 309–316. [Google Scholar] [CrossRef] [PubMed]
- Ehrlich, J.; Gliozzi, M.; Janda, E.; Walker, R.; Romeo, F.; Mollace, V. Effect of citrus bergamot polyphenol extract on patients with nonalcoholic fatty liver disease. Am. J. Gastroenterol. 2014, 109, S152–S153. [Google Scholar]
- Navarra, M.; Mannucci, C.; Delbo, M.; Calapai, G. Citrus bergamia essential oil: From basic research to clinical application. Front. Pharmacol. 2015, 6, 36. [Google Scholar] [CrossRef] [PubMed]
- Spigoni, V.; Mena, P.; Fantuzzi, F.; Tassotti, M.; Brighenti, F.; Bonadonna, R.C.; Del Rio, D.; Dei Cas, A. Bioavailability of bergamot (citrus bergamia) flavanones and biological activity of their circulating metabolites in human pro-angiogenic cells. Nutrients 2017, 9, PMC5748778. [Google Scholar] [CrossRef] [PubMed]
- Salerno, R.; Casale, F.; Calandruccio, C.; Procopio, A. Characterization of flavonoids in citrus bergamia (Bergamot) polyphenolic fraction by liquid chromatography–high resolution mass spectrometry (LC/HRMS). Pharma Nutr. 2016, 4, S1–S7. [Google Scholar] [CrossRef]
- Leopoldini, M.; Malaj, N.; Toscano, M.; Sindona, G.; Russo, N. On the inhibitor effects of bergamot juice flavonoids binding to the 3-hydroxy-3-methylglutaryl-coa reductase (hmgr) enzyme. J. Agric. Food Chem. 2010, 58, 10768–10773. [Google Scholar] [CrossRef] [PubMed]
- Walker, R.; Janda, E.; Mollace, V. Chapter 84—The use of bergamot-derived polyphenol fraction in cardiometabolic risk prevention and its possible mechanisms of action. Polyphen Hum. Health Dis. 2014, 2, 1087–1105. [Google Scholar]
- Impellizzeri, D.; Bruschetta, G.; Di Paola, R.; Ahmad, A.; Campolo, M.; Cuzzocrea, S.; Esposito, E.; Navarra, M. The anti-inflammatory and antioxidant effects of bergamot juice extract (Bje) in an experimental model of inflammatory bowel disease. Clin. Nutr. 2015, 34, 1146–1154. [Google Scholar] [CrossRef] [PubMed]
- Impellizzeri, D.; Cordaro, M.; Campolo, M.; Gugliandolo, E.; Esposito, E.; Benedetto, F.; Cuzzocrea, S.; Navarra, M. Anti-inflammatory and antioxidant effects of flavonoid-rich fraction of bergamot juice (Bje) in a mouse model of intestinal ischemia/reperfusion injury. Front. Pharmacol. 2016, 7, 203. [Google Scholar] [CrossRef] [PubMed]
- Promrat, K.; Kleiner, D.E.; Niemeier, H.M.; Jackvony, E.; Kearns, M.; Wands, J.R.; Fava, J.L.; Wing, R.R. Randomized controlled trial testing the effects of weight loss on nonalcoholic steatohepatitis. Hepatology 2010, 51, 121–129. [Google Scholar] [CrossRef] [PubMed]
- Khan, H.A. Calcdose: A software for drug dosage conversion using metabolically active mass of animals. Drug Chem. Toxicol. 2003, 26, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Antunes, L.C.; Elkfury, J.L.; Jornada, M.N.; Foletto, K.C.; Bertoluci, M.C. Validation of homa-ir in a model of insulin-resistance induced by a high-fat diet in wistar rats. Arch. Endocrinol. Metab. 2016, 60, 138–142. [Google Scholar] [CrossRef] [PubMed]
- Daniels, S.J.; Leeming, D.J.; Eslam, M.; Hashem, A.M.; Nielsen, M.J.; Krag, A.; Karsdal, M.A.; Grove, J.I.; Guha, I.N.; Kawaguchi, T.; et al. Adapt: An algorithm incorporating PRO-C3 accurately identifies patients with nafld and advanced fibrosis. Hepatology 2018. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30014517 (accessed on 25 October 2018).
- Asgharpour, A.; Cazanave, S.C.; Pacana, T.; Seneshaw, M.; Vincent, R.; Banini, B.A.; Kumar, D.P.; Daita, K.; Min, H.K.; Mirshahi, F.; et al. A diet-induced animal model of non-alcoholic fatty liver disease and hepatocellular cancer. J. Hepatol. 2016, 65, 579–588. [Google Scholar] [CrossRef] [PubMed]
- Peinnequin, A.; Mouret, C.; Birot, O.; Alonso, A.; Mathieu, J.; Clarencon, D.; Agay, D.; Chancerelle, Y.; Multon, E. Rat pro-inflammatory cytokine and cytokine related mrna quantification by real-time polymerase chain reaction using sybr green. BMC Immunol. 2004, 5, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lackner, C. Hepatocellular ballooning in nonalcoholic steatohepatitis: The pathologist’s perspective. Expert Rev. Gastroenterol. Hepatol. 2011, 5, 223–231. [Google Scholar] [CrossRef] [PubMed]
- Williams, K.H.; Shackel, N.A.; Gorrell, M.D.; McLennan, S.V.; Twigg, S.M. Diabetes and nonalcoholic fatty liver disease: A pathogenic duo. Endocr. Rev. 2013, 34, 84–129. [Google Scholar] [CrossRef] [PubMed]
- Bravo, E.; Palleschi, S.; Aspichueta, P.; Buque, X.; Rossi, B.; Cano, A.; Napolitano, M.; Ochoa, B.; Botham, K.M. High fat diet-induced non alcoholic fatty liver disease in rats is associated with hyperhomocysteinemia caused by down regulation of the transsulphuration pathway. Lipids Health Dis. 2011, 10, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roza, N.A.; Possignolo, L.F.; Palanch, A.C.; Gontijo, J.A. Effect of long-term high-fat diet intake on peripheral insulin sensibility, blood pressure, and renal function in female rats. Food Nutr. Res. 2016, 60, 28536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Amato, A.; Caldara, G.F.; Nuzzo, D.; Baldassano, S.; Picone, P.; Rizzo, M.; Mule, F.; Di Carlo, M. Nafld and atherosclerosis are prevented by a natural dietary supplement containing curcumin, silymarin, guggul, chlorogenic acid and inulin in mice fed a high-fat diet. Nutrients 2017, 9, 492. [Google Scholar] [CrossRef] [PubMed]
- Belemets, N.; Kobyliak, N.; Virchenko, O.; Falalyeyeva, T.; Olena, T.; Bodnar, P.; Savchuk, O.; Galenova, T.; Caprnda, M.; Rodrigo, L.; et al. Effects of polyphenol compounds melanin on nafld/nash prevention. Biomed. Pharmacother. 2017, 88, 267–276. [Google Scholar] [CrossRef] [PubMed]
- Kim, B.; Farruggia, C.; Ku, C.S.; Pham, T.X.; Yang, Y.; Bae, M.; Wegner, C.J.; Farrell, N.J.; Harness, E.; Park, Y.K.; et al. Astaxanthin inhibits inflammation and fibrosis in the liver and adipose tissue of mouse models of diet-induced obesity and nonalcoholic steatohepatitis. J. Nutr. Biochem. 2017, 43, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Morrison, M.C.; Liang, W.; Mulder, P.; Verschuren, L.; Pieterman, E.; Toet, K.; Heeringa, P.; Wielinga, P.Y.; Kooistra, T.; Kleemann, R. Mirtoselect, an anthocyanin-rich bilberry extract, attenuates non-alcoholic steatohepatitis and associated fibrosis in ApoE(*)3Leiden mice. J. Hepatol. 2015, 62, 1180–1186. [Google Scholar] [CrossRef] [PubMed]
- Seo, E.; Oh, Y.S.; Jun, H.S. Psoralea corylifolia L. Seed extract attenuates nonalcoholic fatty liver disease in high-fat diet-induced obese mice. Nutrients 2016, 8, 83. [Google Scholar] [CrossRef] [PubMed]
- Glass, L.M.; Dickson, R.C.; Anderson, J.C.; Suriawinata, A.A.; Putra, J.; Berk, B.S.; Toor, A. Total body weight loss of >/= 10% is associated with improved hepatic fibrosis in patients with nonalcoholic steatohepatitis. Dig. Dis. Sci. 2015, 60, 1024–1030. [Google Scholar] [CrossRef] [PubMed]
- Cheng, D.M.; Pogrebnyak, N.; Kuhn, P.; Poulev, A.; Waterman, C.; Rojas-Silva, P.; Johnson, W.D.; Raskin, I. Polyphenol-rich rutgers scarlet lettuce improves glucose metabolism and liver lipid accumulation in diet-induced obese c57bl/6 mice. Nutrition 2014, 30, S52–S58. [Google Scholar] [CrossRef] [PubMed]
- Chang, H.C.; Peng, C.H.; Yeh, D.M.; Kao, E.S.; Wang, C.J. Hibiscus sabdariffa extract inhibits obesity and fat accumulation, and improves liver steatosis in humans. Food Funct. 2014, 5, 734–739. [Google Scholar] [CrossRef] [PubMed]
- Chang, W.C.; Jia, H.; Aw, W.; Saito, K.; Hasegawa, S.; Kato, H. Beneficial effects of soluble dietary jerusalem artichoke (Helianthus tuberosus) in the prevention of the onset of type 2 diabetes and non-alcoholic fatty liver disease in high-fructose diet-fed rats. Br. J. Nutr. 2014, 112, 709–717. [Google Scholar] [CrossRef] [PubMed]
- Ham, J.R.; Lee, H.I.; Choi, R.Y.; Sim, M.O.; Seo, K.I.; Lee, M.K. Anti-steatotic and anti-inflammatory roles of syringic acid in high-fat diet-induced obese mice. Food Funct. 2016, 7, 689–697. [Google Scholar] [CrossRef] [PubMed]
- Barr, V.A.; Malide, D.; Zarnowski, M.J.; Taylor, S.I.; Cushman, S.W. Insulin stimulates both leptin secretion and production by rat white adipose tissue. Endocrinology 1997, 138, 4463–4472. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.J.; Fried, S.K. Multilevel regulation of leptin storage, turnover, and secretion by feeding and insulin in rat adipose tissue. J. Lipid Res. 2006, 47, 1984–1993. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cohen, B.; Novick, D.; Rubinstein, M. Modulation of insulin activities by leptin. Science 1996, 274, 1185–1188. [Google Scholar] [CrossRef] [PubMed]
- Perez-Cano, F.J.; Castell, M. Flavonoids, inflammation and immune system. Nutrients 2016, 8, 659. [Google Scholar] [CrossRef] [PubMed]
- Ferlazzo, N.; Cirmi, S.; Calapai, G.; Ventura-Spagnolo, E.; Gangemi, S.; Navarra, M. Anti-inflammatory activity of citrus bergamia derivatives: Where do we stand? Molecules 2016, 21, 1273. [Google Scholar] [CrossRef] [PubMed]
- Mulvihill, E.E.; Burke, A.C.; Huff, M.W. Citrus flavonoids as regulators of lipoprotein metabolism and atherosclerosis. Annu. Rev. Nutr. 2016, 36, 275–299. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, P.S.; Spolidorio, L.C.; Manthey, J.A.; Cesar, T.B. Citrus flavanones prevent systemic inflammation and ameliorate oxidative stress in C57BL/6J mice fed high-fat diet. Food Funct. 2016, 7, 2675–2681. [Google Scholar] [CrossRef] [PubMed]
- Felgines, C.; Texier, O.; Morand, C.; Manach, C.; Scalbert, A.; Regerat, F.; Remesy, C. Bioavailability of the flavanone naringenin and its glycosides in rats. Am. J. Physiol. Gastrointest. Liver Physiol. 2000, 279, G1148–G1154. [Google Scholar] [CrossRef] [PubMed]
- Kay, C.D.; Pereira-Caro, G.; Ludwig, I.A.; Clifford, M.N.; Crozier, A. Anthocyanins and flavanones are more bioavailable than previously perceived: A review of recent evidence. Annu. Rev. Food Sci. Technol. 2017, 8, 155–180. [Google Scholar] [CrossRef] [PubMed]
- Akiyoshi, H.; Terada, T. Centrilobular and perisinusoidal fibrosis in experimental congestive liver in the rat. J. Hepatol. 1999, 30, 433–439. [Google Scholar] [CrossRef]
- Tokunaga, Y.; Osawa, Y.; Ohtsuki, T.; Hayashi, Y.; Yamaji, K.; Yamane, D.; Hara, M.; Munekata, K.; Tsukiyama-Kohara, K.; Hishima, T.; et al. Selective inhibitor of Wnt/beta-catenin/CBP signaling ameliorates hepatitis C virus-induced liver fibrosis in mouse model. Sci. Rep. 2017, 7, 325. [Google Scholar] [CrossRef] [PubMed]
- Lozano, I.; Van der Werf, R.; Bietiger, W.; Seyfritz, E.; Peronet, C.; Pinget, M.; Jeandidier, N.; Maillard, E.; Marchioni, E.; Sigrist, S.; et al. High-fructose and high-fat diet-induced disorders in rats: Impact on diabetes risk, hepatic and vascular complications. Nutr. Metab. 2016, 13, 15. [Google Scholar] [CrossRef] [PubMed]
- Zeeni, N.; Dagher-Hamalian, C.; Dimassi, H.; Faour, W.H. Cafeteria diet-fed mice is a pertinent model of obesity-induced organ damage: A potential role of inflammation. Inflamm. Res. 2015, 64, 501–512. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequences (5′-3′) | |
---|---|---|
Il1b | Forward Reverse | CACCTCTCAAGCAGAGCACAG GGGTTCCATGGTGAAGTCAAC |
Il6 | Forward Reverse | TCCTACCCCAACTTCCAATGCTC TTGGATGGTCTTGGTCCTTAGCC |
Il10 | Forward Reverse | GTTGCCAAGCCTTGTCAGAAA TTTCTGGGCCATGGTTCTCT |
Tnfa | Forward Reverse | AAATGGGCTCCCTCTCATCAGTTC TCTGCTTGGTGGTTTGCTACGAC |
Hrpt | Forward Reverse | CTCATGGACTGATTATGGACAGGAC GCAGGTCAGCAAAGAACTTATAGCC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Parafati, M.; Lascala, A.; La Russa, D.; Mignogna, C.; Trimboli, F.; Morittu, V.M.; Riillo, C.; Macirella, R.; Mollace, V.; Brunelli, E.; et al. Bergamot Polyphenols Boost Therapeutic Effects of the Diet on Non-Alcoholic Steatohepatitis (NASH) Induced by “Junk Food”: Evidence for Anti-Inflammatory Activity. Nutrients 2018, 10, 1604. https://doi.org/10.3390/nu10111604
Parafati M, Lascala A, La Russa D, Mignogna C, Trimboli F, Morittu VM, Riillo C, Macirella R, Mollace V, Brunelli E, et al. Bergamot Polyphenols Boost Therapeutic Effects of the Diet on Non-Alcoholic Steatohepatitis (NASH) Induced by “Junk Food”: Evidence for Anti-Inflammatory Activity. Nutrients. 2018; 10(11):1604. https://doi.org/10.3390/nu10111604
Chicago/Turabian StyleParafati, Maddalena, Antonella Lascala, Daniele La Russa, Chiara Mignogna, Francesca Trimboli, Valeria Maria Morittu, Concetta Riillo, Rachele Macirella, Vincenzo Mollace, Elvira Brunelli, and et al. 2018. "Bergamot Polyphenols Boost Therapeutic Effects of the Diet on Non-Alcoholic Steatohepatitis (NASH) Induced by “Junk Food”: Evidence for Anti-Inflammatory Activity" Nutrients 10, no. 11: 1604. https://doi.org/10.3390/nu10111604