Lisosan G Protects the Retina from Neurovascular Damage in Experimental Diabetic Retinopathy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals
2.3. Preparation of LG
2.4. Ex-Vivo Mouse Retinal Explants
2.5. In Vivo Rat Experimental Diabetes and LG Administration
2.6. Quantitative Real-Time PCR
2.7. Western Blot
2.8. Immunofluorescence
2.9. Electroretinogram
2.10. Detection of Retinal Vascular Leakage by Evans Blue Dye
2.11. Statistical Analysis
3. Results
3.1. Effects of LG Treatment on OS-Stressed Mouse Retinal Explants
3.2. LG Treatment Does Not Affect Glycaemia and Body Weight of Diabetic Rats
3.3. LG Treatment Improves the Electroretinographic Responses of Diabetic Rats
3.4. LG Treatment Reduces Retinal Apoptosis, VEGF Expression, and VEGFR2 Activation in Diabetic Rats
3.5. LG Treatment Protects the BRB in Diabetic Rats
3.6. LG Treatment Modifies Nrf2 Immunostaining Patterns in the Retina of Diabetic Rats
3.7. LG Treatment Reduces Glial Activation and Inflammation in the Retina of Diabetic Rats
4. Discussion
4.1. LG-Induced Neuroprotection Reduces Vascular Damage
4.2. LG Antiapoptotic Effects Result in Functional Recovery
4.3. Antioxidant and Anti-Inflammatory Effects of LG
4.4. LG as an Appropriate Compound for the Treatment of DR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hernandez, C.; Dal Monte, M.; Simo, R.; Casini, G. Neuroprotection as a Therapeutic Target for Diabetic Retinopathy. J. Diabetes Res. 2016, 2016, 9508541. [Google Scholar] [CrossRef] [PubMed]
- Amato, R.; Catalani, E.; Dal Monte, M.; Cammalleri, M.; Di Renzo, I.; Perrotta, C.; Cervia, D.; Casini, G. Autophagy-mediated neuroprotection induced by octreotide in an ex vivo model of early diabetic retinopathy. Pharmacol. Res. 2018, 128, 167–178. [Google Scholar] [CrossRef] [PubMed]
- Amato, R.; Dal Monte, M.; Lulli, M.; Raffa, V.; Casini, G. Nanoparticle-Mediated Delivery of Neuroprotective Substances for the Treatment of Diabetic Retinopathy. Curr. Neuropharmacol. 2018, 16, 993–1003. [Google Scholar] [CrossRef] [PubMed]
- Dow, C.; Mancini, F.; Rajaobelina, K.; Boutron-Ruault, M.C.; Balkau, B.; Bonnet, F.; Fagherazzi, G. Diet and risk of diabetic retinopathy: A systematic review. Eur. J. Epidemiol. 2018, 33, 141–156. [Google Scholar] [CrossRef] [PubMed]
- Peddada, K.V.; Brown, A.; Verma, V.; Nebbioso, M. Therapeutic potential of curcumin in major retinal pathologies. Int. Ophthalmol. 2018, 5. [Google Scholar] [CrossRef] [PubMed]
- La Marca, M.; Beffy, P.; Pugliese, A.; Longo, V. Fermented wheat powder induces the antioxidant and detoxifying system in primary rat hepatocytes. PLoS ONE 2013, 8, e83538. [Google Scholar] [CrossRef] [PubMed]
- Lucchesi, D.; Russo, R.; Gabriele, M.; Longo, V.; Del Prato, S.; Penno, G.; Pucci, L. Grain and bean lysates improve function of endothelial progenitor cells from human peripheral blood: Involvement of the endogenous antioxidant defenses. PLoS ONE 2014, 9, e109298. [Google Scholar] [CrossRef]
- Longo, V.; Chirulli, V.; Gervasi, P.G.; Nencioni, S.; Pellegrini, M. Lisosan G, a powder of grain, does not interfere with the drug metabolizing enzymes and has a protective role on carbon tetrachloride-induced hepatotoxicity. Biotechnol. Lett. 2007, 29, 1155–1159. [Google Scholar] [CrossRef]
- Gabriele, M.; Pucci, L.; Arvay, J.; Longo, V. Anti-inflammatory and antioxidant effect of fermented whole wheat on TNF alpha-stimulated HT-29 and NF-kappa B signaling pathway activation. J. Funct. Foods 2018, 45, 392–400. [Google Scholar] [CrossRef]
- Longo, V.; Gervasi, P.G.; Lubrano, V. Cisplatin induced toxicity in rat tissues: The protective effect of Lisosan G. Food Chem. Toxicol. 2011, 49, 233–237. [Google Scholar] [CrossRef]
- Sacco, R.; Pucci, L.; Sivozhelezov, V.; Pellegrini, L.; Giacomelli, L.; Longo, V. Prevention of vascular damage with Lisosan G wheat extract: The in vitro basis for a clinical investigation. Eur. Rev. Med. Pharmacol. Sci. 2015, 19, 1517–1519. [Google Scholar] [PubMed]
- Giusti, L.; Gabriele, M.; Penno, G.; Garofolo, M.; Longo, V.; Del Prato, S.; Lucchesi, D.; Pucci, L. A Fermented Whole Grain Prevents Lipopolysaccharides-Induced Dysfunction in Human Endothelial Progenitor Cells. Oxid. Med. Cell Longev. 2017, 2017, 1026268. [Google Scholar] [CrossRef]
- Frassinetti, S.; Della Croce, C.M.; Caltavuturo, L.; Longo, V. Antimutagenic and antioxidant activity of Lisosan G in Saccharomyces cerevisiae. Food Chem. 2012, 135, 2029–2034. [Google Scholar] [CrossRef] [PubMed]
- Amato, R.; Biagioni, M.; Cammalleri, M.; Dal Monte, M.; Casini, G. VEGF as a Survival Factor in Ex Vivo Models of Early Diabetic Retinopathy. Investig. Ophthalmol. Vis. Sci. 2016, 57, 3066–3076. [Google Scholar] [CrossRef] [PubMed]
- Mazumder, B.; Sampath, P.; Seshadri, V.; Maitra, R.K.; DiCorleto, P.E.; Fox, P.L. Regulated release of L13a from the 60S ribosomal subunit as a mechanism of transcript-specific translational control. Cell 2003, 115, 187–198. [Google Scholar] [CrossRef]
- Robson, J.G.; Saszik, S.M.; Ahmed, J.; Frishman, L.J. Rod and cone contributions to the a-wave of the electroretinogram of the macaque. J. Physiol. 2003, 547, 509–530. [Google Scholar] [CrossRef] [PubMed]
- Cammalleri, M.; Locri, F.; Marsili, S.; Dal Monte, M.; Pisano, C.; Mancinelli, A.; Lista, L.; Rusciano, D.; De Rosa, M.; Pavone, V.; et al. The Urokinase Receptor-Derived Peptide UPARANT Recovers Dysfunctional Electroretinogram and Blood-Retinal Barrier Leakage in a Rat Model of Diabetes. Investig. Ophthalmol. Vis. Sci. 2017, 58, 3138–3148. [Google Scholar] [CrossRef]
- Di Marco, E.; Jha, J.C.; Sharma, A.; Wilkinson-Berka, J.L.; Jandeleit-Dahm, K.A.; de Haan, J.B. Are reactive oxygen species still the basis for diabetic complications? Clin. Sci. 2015, 129, 199–216. [Google Scholar] [CrossRef]
- Kim, J.; Kim, C.S.; Lee, Y.M.; Sohn, E.; Jo, K.; Kim, J.S. Vaccinium myrtillus extract prevents or delays the onset of diabetes—Induced blood-retinal barrier breakdown. Int. J. Food Sci. Nutr. 2015, 66, 236–242. [Google Scholar] [CrossRef]
- Sohn, E.; Kim, J.; Kim, C.S.; Lee, Y.M.; Kim, J.S. Extract of Polygonum cuspidatum Attenuates Diabetic Retinopathy by Inhibiting the High-Mobility Group Box-1 (HMGB1) Signaling Pathway in Streptozotocin-Induced Diabetic Rats. Nutrients 2016, 8, 140. [Google Scholar] [CrossRef]
- Bucolo, C.; Marrazzo, G.; Platania, C.B.; Drago, F.; Leggio, G.M.; Salomone, S. Fortified extract of red berry Ginkgo biloba, and white willow bark in experimental early diabetic retinopathy. J. Diabetes Res. 2013, 2013, 432695. [Google Scholar] [CrossRef] [PubMed]
- Duan, H.; Huang, J.; Li, W.; Tang, M. Protective effects of fufang xueshuantong on diabetic retinopathy in rats. Evid. Based Complement. Altern. Med. 2013, 2013, 408268. [Google Scholar] [CrossRef] [PubMed]
- Azzouz, M.; Ralph, G.S.; Storkebaum, E.; Walmsley, L.E.; Mitrophanous, K.A.; Kingsman, S.M.; Carmeliet, P.; Mazarakis, N.D. VEGF delivery with retrogradely transported lentivector prolongs survival in a mouse ALS model. Nature 2004, 429, 413–417. [Google Scholar] [CrossRef] [PubMed]
- Casini, G.; Dal Monte, M.; Fornaciari, I.; Filippi, L.; Bagnoli, P. The beta-adrenergic system as a possible new target for pharmacologic treatment of neovascular retinal diseases. Prog. Retin. Eye Res. 2014, 42, 103–129. [Google Scholar] [CrossRef] [PubMed]
- Foxton, R.H.; Finkelstein, A.; Vijay, S.; Dahlmann-Noor, A.; Khaw, P.T.; Morgan, J.E.; Shima, D.T.; Ng, Y.S. VEGF-A is necessary and sufficient for retinal neuroprotection in models of experimental glaucoma. Am. J. Pathol. 2013, 182, 1379–1390. [Google Scholar] [CrossRef] [PubMed]
- Hombrebueno, J.R.; Ali, I.H.; Xu, H.; Chen, M. Sustained intraocular VEGF neutralization results in retinal neurodegeneration in the Ins2(Akita) diabetic mouse. Sci. Rep. 2015, 5. [Google Scholar] [CrossRef]
- Murakami, T.; Felinski, E.A.; Antonetti, D.A. Occludin phosphorylation and ubiquitination regulate tight junction trafficking and vascular endothelial growth factor-induced permeability. J. Biol. Chem. 2009, 284, 21036–21046. [Google Scholar] [CrossRef]
- Wang, W.; Dentler, W.L.; Borchardt, R.T. VEGF increases BMEC monolayer permeability by affecting occludin expression and tight junction assembly. Am. J. Physiol. Heart Circ. Physiol. 2001, 280. [Google Scholar] [CrossRef]
- Antonetti, D.A.; Barber, A.J.; Hollinger, L.A.; Wolpert, E.B.; Gardner, T.W. Vascular endothelial growth factor induces rapid phosphorylation of tight junction proteins occludin and zonula occluden 1. A potential mechanism for vascular permeability in diabetic retinopathy and tumors. J. Biol. Chem. 1999, 274, 23463–23467. [Google Scholar] [CrossRef]
- Adams, A.J.; Bearse, M.A., Jr. Retinal neuropathy precedes vasculopathy in diabetes: A function-based opportunity for early treatment intervention? Clin. Exp. Optom. 2012, 95, 256–265. [Google Scholar] [CrossRef]
- Barber, A.J. A new view of diabetic retinopathy: A neurodegenerative disease of the eye. Prog. Neuropsychopharmacol. Biol. Psychiatry 2003, 27, 283–290. [Google Scholar] [CrossRef]
- Chang, J.S.; Lee, Y.J.; Wilkie, D.A.; Lin, C.T. The neuroprotective and antioxidative effects of submicron and blended Lycium barbarum in experimental retinal degeneration in rats. J. Vet. Med. Sci. 2018, 11. [Google Scholar] [CrossRef] [PubMed]
- Hashem, H.E.; Abd El-Haleem, M.R.; Amer, M.G.; Bor’i, A. Pomegranate protective effect on experimental ischemia/reperfusion retinal injury in rats (histological and biochemical study). Ultrastruct Pathol. 2017, 41, 346–357. [Google Scholar] [CrossRef] [PubMed]
- Ishihara, T.; Kaidzu, S.; Kimura, H.; Koyama, Y.; Matsuoka, Y.; Ohira, A. Protective Effect of Highly Polymeric A-Type Proanthocyanidins from Seed Shells of Japanese Horse Chestnut (Aesculus turbinata BLUME) against Light-Induced Oxidative Damage in Rat Retina. Nutrients 2018, 10, 593. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.; Yu, M. Protective effect of sulforaphane against retinal degeneration in the Pde6(rd10) mouse model of retinitis pigmentosa. Curr. Eye Res. 2017, 42, 1684–1688. [Google Scholar] [CrossRef] [PubMed]
- Otsuka, T.; Shimazawa, M.; Inoue, Y.; Nakano, Y.; Ojino, K.; Izawa, H.; Tsuruma, K.; Ishibashi, T.; Hara, H. Astaxanthin Protects Against Retinal Damage: Evidence from In Vivo and In Vitro Retinal Ischemia and Reperfusion Models. Curr. Eye Res. 2016, 41, 1465–1472. [Google Scholar] [CrossRef]
- Qi, S.; Wang, C.; Song, D.; Song, Y.; Dunaief, J.L. Intraperitoneal injection of (−)-Epigallocatechin-3-gallate protects against light-induced photoreceptor degeneration in the mouse retina. Mol. Vis. 2017, 23, 171–178. [Google Scholar]
- Song, D.; Song, J.; Wang, C.; Li, Y.; Dunaief, J.L. Berberine protects against light-induced photoreceptor degeneration in the mouse retina. Exp. Eye Res. 2016, 145, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Deliyanti, D.; Alrashdi, S.F.; Tan, S.M.; Meyer, C.; Ward, K.W.; de Haan, J.B.; Wilkinson-Berka, J.L. Nrf2 Activation Is a Potential Therapeutic Approach to Attenuate Diabetic Retinopathy. Investig. Ophthalmol. Vis. Sci. 2018, 59, 815–825. [Google Scholar] [CrossRef] [Green Version]
- Oeckinghaus, A.; Ghosh, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol. 2009, 1. [Google Scholar] [CrossRef]
- Sticozzi, C.; Belmonte, G.; Meini, A.; Carbotti, P.; Grasso, G.; Palmi, M. IL-1beta induces GFAP expression in vitro and in vivo and protects neurons from traumatic injury-associated apoptosis in rat brain striatum via NFkappaB/Ca(2)(+)-calmodulin/ERK mitogen-activated protein kinase signaling pathway. Neuroscience 2013, 252, 367–383. [Google Scholar] [CrossRef] [PubMed]
- Kan, E.; Alici, O.; Kan, E.K.; Ayar, A. Effects of alpha-lipoic acid on retinal ganglion cells, retinal thicknesses, and VEGF production in an experimental model of diabetes. Int. Ophthalmol. 2017, 37, 1269–1278. [Google Scholar] [CrossRef]
- Li, J.; Wang, P.; Ying, J.; Chen, Z.; Yu, S. Curcumin Attenuates Retinal Vascular Leakage by Inhibiting Calcium/Calmodulin-Dependent Protein Kinase II Activity in Streptozotocin-Induced Diabetes. Cell. Physiol. Biochem. 2016, 39, 1196–1208. [Google Scholar] [CrossRef]
- Mahmoud, A.M.; Abd El-Twab, S.M.; Abdel-Reheim, E.S. Consumption of polyphenol-rich Morus alba leaves extract attenuates early diabetic retinopathy: The underlying mechanism. Eur. J. Nutr. 2017, 56, 1671–1684. [Google Scholar] [CrossRef]
- Obrosova, I.G.; Minchenko, A.G.; Marinescu, V.; Fathallah, L.; Kennedy, A.; Stockert, C.M.; Frank, R.N.; Stevens, M.J. Antioxidants attenuate early up regulation of retinal vascular endothelial growth factor in streptozotocin-diabetic rats. Diabetologia 2001, 44, 1102–1110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tzeng, T.F.; Liu, W.Y.; Liou, S.S.; Hong, T.Y.; Liu, I.M. Antioxidant-Rich Extract from Plantaginis Semen Ameliorates Diabetic Retinal Injury in a Streptozotocin-Induced Diabetic Rat Model. Nutrients 2016, 8. [Google Scholar] [CrossRef] [PubMed]
- Soccio, M.; Laus, M.N.; Alfarano, M.; Pastore, D. The soybean lipoxygenase-fluorescein reaction may be used to assess antioxidant capacity of phytochemicals and serum. Anal. Methods 2016, 8, 4354–4362. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | |
---|---|---|---|
Mouse | Caspase-3 | GCACTGGAATGTCATCTCGCTCTG | GCCCATGAATGTCTCTCTGAGGTTG |
GCLC | GGGGTGACGAGGTGGAGTA | GTTGGGGTTTGTCCTCTCCC | |
HO-1 | AAGCCGAGAATGCTGAGTTCA | GCCGTGTAGATATGGTACAAGGA | |
Rpl13a | CACTCTGGAGGAGAAACGGAAGG | GCAGGCATGAGGCAAACAGTC | |
SOD2 | CAGACCTGCCTTACGACTATGG | CTCGGTGGCGTTGAGATTGTT | |
VEGF | GCACATAGGAGAGATGAGCTTCC | CTCCGCTCTGAACAAGGCT | |
Rat | Caspase-3 | CCTTTCCTCTCCACCGTAGA | AGATGCCACCTCTCCTTTCC |
GFAP | TGACGCCTCCACTCCCTGCC | CATCTCCGCACGCTCGCTGG | |
Occludin | TTTCATGCCTTGGGGATTGAG | GACTTCCCAGAGTGCAGAGT | |
Rpl13a | GGATCCCTCCACCCTATGACA | CTGGTACTTCCACCCGACCTC | |
VEGF | TGTGAGCCTTGTTCAGAGCGG | ACTCAAGCTGCCTCGCCTTGC | |
ZO-1 | AGTCTCGGAAAAGTGCCAGG | GGGCACCATACCAACCATCA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Amato, R.; Rossino, M.G.; Cammalleri, M.; Locri, F.; Pucci, L.; Dal Monte, M.; Casini, G. Lisosan G Protects the Retina from Neurovascular Damage in Experimental Diabetic Retinopathy. Nutrients 2018, 10, 1932. https://doi.org/10.3390/nu10121932
Amato R, Rossino MG, Cammalleri M, Locri F, Pucci L, Dal Monte M, Casini G. Lisosan G Protects the Retina from Neurovascular Damage in Experimental Diabetic Retinopathy. Nutrients. 2018; 10(12):1932. https://doi.org/10.3390/nu10121932
Chicago/Turabian StyleAmato, Rosario, Maria Grazia Rossino, Maurizio Cammalleri, Filippo Locri, Laura Pucci, Massimo Dal Monte, and Giovanni Casini. 2018. "Lisosan G Protects the Retina from Neurovascular Damage in Experimental Diabetic Retinopathy" Nutrients 10, no. 12: 1932. https://doi.org/10.3390/nu10121932