Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota In Vivo (Gallus gallus)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Polyphenols Analysis
2.2.1. Polyphenol Extraction
2.2.2. Ultra Performance Liquid Chromatography—Mass Spectrometry (UPLC—MS) Analysis of Polyphenols
2.3. Phytate Analysis
2.4. Iron Content of Bean Flour, Serum and Liver
2.5. Protein and Dietary Fiber Analysis in the Bean Flour
2.6. In Vitro Iron Bioavailability Assessment
2.7. Harvesting of Caco-2 Cells for Ferritin Analysis
2.8. Animals, Diets and Study Design
2.9. Blood Analysis, Hemoglobin (Hb) Determination, and Tissue Collection
2.10. Isolation of Total RNA from Chicken Duodenum and Liver
2.11. Real Time Polymerase Chain Reaction (RT-PCR)
2.12. 16S rRNA Gene Amplification and Sequencing
2.13. 16S rRNA Gene Sequence Analysis
2.14. Morphological Examination
2.15. Statistical Analyses
3. Results
3.1. Phytate Concentration and Polyphenol Profile in the Bean Flours
3.2. Dietary Fiber and Protein Concentration in the Bean Flours
3.3. In Vitro Assay (Caco-2 Cell Ferritin Formation)
3.4. In Vivo Assay (Gallus Gallus Model)
3.4.1. Growth Rates, Hb, Hb-Fe, and HME
3.4.2. Gene Expression of Fe—Related and BBM Functional Proteins
3.4.3. Morphometric Measurements
3.4.4. Microbial Analysis
4. Discussion
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Wegmüller, R.; Bah, A.; Kendall, L.; Goheen, M.M.; Mulwa, S.; Cerami, C.; Moretti, D.; Prentice, A.M. Efficacy and safety of hepcidin-based screen-and-treat approaches using two different doses versus a standard universal approach of iron supplementation in young children in rural Gambia: A double-blind randomised controlled trial. BMC Pediatr. 2016, 16, 149. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. The Global Prevalence of Anaemia in 2011. WHO Rep. 2011, 48. [Google Scholar] [CrossRef]
- Allen, L.; Benoist, B.; Dary, O.; Hurrell, R. Guidelines on Food Fortification With Micronutrients; WHO Press: Rome, Italy, 2006; p. 341. [Google Scholar]
- Tako, E.; Reed, S.; Anandaraman, A.; Beebe, S.E.; Hart, J.J.; Glahn, R.P. Studies of cream seeded carioca beans (Phaseolus vulgaris L.) from a Rwandan efficacy trial: In vitro and in vivo screening tools reflect human studies and predict beneficial results from iron Biofortified beans. PLoS ONE 2015, 10, 1–15. [Google Scholar] [CrossRef]
- WHO. Guideline: Use of multiple Micronutrient Powders for Home Fortification of Foods Consumed by Infants and Children 6–23 Months of Age; WHO: Geneva, Switzerland, 2011; pp. 1–30. [Google Scholar]
- Bouis, H.E.; Saltzman, A. Improving nutrition through biofortification: A review of evidence from HarvestPlus, 2003 through 2016. Glob. Food Secur. 2017, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Nestel, P.; Bouis, H.E.; Meenakshi, J.V.; Pfeiffer, W. Symposium: Food Fortification in Developing Countries Biofortification of Staple Food Crops. J. Nutr. 2006, 136, 1064–1067. [Google Scholar] [CrossRef] [PubMed]
- Bhargava, A.; Bouis, H.E.; Scrimshaw, N.S. Dietary Intakes and Socioeconomic Factors Are Associated with the Hemoglobin Concentration of Bangladeshi Women. Econ. Stat. Comput. Approaches Food Health Sci. 2006, 105–111. [Google Scholar] [CrossRef]
- Lozoff, B.; Jimenez, E.; Wolf, A.W. Long-term developmental outcome of infants with iron deficiency. N. Engl. J. Med. 1991, 352, 687–694. [Google Scholar] [CrossRef]
- Broughton, W.J.; Hernandez, G.; Blair, M.; Beebe, S.; Gepts, P.; Vanderleyden, J. Beans (Phaseolus spp.) model food legumes. Plant Soil. 2003, 252, 55–128. [Google Scholar] [CrossRef]
- Glahn, R.; Tako, E.; Hart, J.; Haas, J.; Lung’aho, M.; Beebe, S. Iron Bioavailability Studies of the First Generation of Iron-Biofortified Beans Released in Rwanda. Nutrients 2017, 9, 787. [Google Scholar] [CrossRef]
- White, P.J.; Broadley, M.R. Biofortifying crops with essential mineral elements. Trends Plant Sci. 2005, 10, 586–593. [Google Scholar] [CrossRef]
- HarvestPlus. Biofortification Progress Briefs. 2014, (August): 82. Available online: https://www.harvestplus.org/sites/default/files/Biofortification_Progress_Briefs_August2014_WEB_2.pdf (accessed on 2 September 2016).
- Petry, N.; Boy, E.; Wirth, J.P.; Hurrell, R.F. Review: The potential of the common bean (Phaseolus vulgaris) as a vehicle for iron biofortification. Nutrients 2015, 7, 1144–1173. [Google Scholar] [CrossRef]
- Blair, M.W.; González, L.F.; Kimani, P.M.; Butare, L. Genetic diversity, inter-gene pool introgression and nutritional quality of common beans (Phaseolus vulgaris L.) from Central Africa. Theor. Appl. Genet. 2010, 121, 237–248. [Google Scholar] [CrossRef] [PubMed]
- Moura, F.F.; Palmer, A.C.; Finkelstein, J.L.; Haas, J.D.; Murray-Kolb, L.E.; Wenger, M.J.; Birol, E.; Boy, E.; Pena-Rosas, J.P. Are Biofortified Staple Food Crops Improving Vitamin A and Iron Status in Women and Children? New Evidence from Ef fi cacy Trials. Adv. Nutr. 2014, 568–570. [Google Scholar] [CrossRef]
- Petry, N.; Egli, I.; Gahutu, J.B.; Tugirimana, P.L.; Boy, E.; Hurrell, R. Phytic Acid Concentration Influences Iron Bioavailability from Biofortified Beans in Rwandese Women with Low Iron Status. J. Nutr. 2014, 144, 1681–1687. [Google Scholar] [CrossRef] [Green Version]
- Haas, J.; Luna, S.; Lung’aho, M.; Ngabo, F.; Wenger, M.; Murray-Kolb, L.; Beebe, S.; Gahutu, J. Iron biofortificatified beans improve bean status in Rwandan university women: Results of a feeding trial. FASEB J. 2014, 28, 646.1. [Google Scholar]
- Tako, E.; Beebe, S.E.; Reed, S.; Hart, J.J.; Glahn, R.P. Polyphenolic compounds appear to limit the nutritional benefit of biofortified higher iron black bean (Phaseolus vulgaris L.). Nutr. J. 2014, 13. [Google Scholar] [CrossRef] [PubMed]
- Hart, J.J.; Tako, E.; Glahn, R.P. Characterization of Polyphenol Effects on Inhibition and Promotion of Iron Uptake by Caco-2 Cells. J. Agric. Food Chem. 2017, 65, 3285–3294. [Google Scholar] [CrossRef] [PubMed]
- Hart, J.J.; Tako, E.; Kochian, L.V.; Glahn, R.P. Identification of Black Bean (Phaseolus vulgaris L.) Polyphenols That Inhibit and Promote Iron Uptake by Caco-2 Cells. J. Agric. Food Chem. 2015, 63, 5950–5956. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Reed, S.M.; Budiman, J.; Hart, J.J.; Glahn, R.P. Higher iron pearl millet (Pennisetum glaucum L.) provides more absorbable iron that is limited by increased polyphenolic content. Nutr. J. 2015, 14, 1–9. [Google Scholar] [CrossRef]
- Tako, E.; Glahn, R.P. White beans provide more bioavailable iron than red beans: Studies in poultry (Gallus gallus) and an in vitro digestion/Caco-2 model. Int. J. Vitam. Nutr. Res. 2010, 80, 416–429. [Google Scholar] [CrossRef]
- Petry, N.; Egli, I.; Zeder, C.; Walczyk, T.; Hurrell, R. Polyphenols and phytic acid contribute to the low iron bioavailability from common beans in young women. J. Nutr. 2010, 140, 1977–1982. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Glahn, R.P.; Knez, M.; Stangoulis, J.C. The effect of wheat prebiotics on the gut bacterial population and iron status of iron deficient broiler chickens. Nutr. J. 2014, 13, 58. [Google Scholar] [CrossRef] [PubMed]
- Pacifici, S.; Song, J.; Zhang, C.; Wang, Q.; Glahn, R.P.; Kolba, N.; Tako, E. Intra amniotic administration of raffinose and stachyose affects the intestinal brush border functionality and alters gut microflora populations. Nutrients 2017, 9, 304. [Google Scholar] [CrossRef]
- Wong, J.M.W.; Souza, R.; Kendall, C.W.C.; Emam, A.; Jenkins, D.J.A. Colonic Health: Fermentation and Short Chain Fatty Acids. J. Clin. Gastroenterol. 2006, 40, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Tuohy, K.M.; Rouzaud, G.C.M.; Brück, W.M.; Gibson, G.R. Modulation of the human gut microflora towards improved health using prebiotics--assessment of efficacy. Curr. Pharm. Des. 2005, 11, 75–90. [Google Scholar] [CrossRef]
- Welch, R.M.; Graham, R.D. Breeding for micronutrients in staple food crops from a human nutrition perspective. J. Exp. Bot. 2004, 55, 353–364. [Google Scholar] [CrossRef] [Green Version]
- Dwivedi, S.; Sahrawat, K.; Puppala, N.; Ortiz, R. Plant prebiotics and human health: Biotechnology to breed prebiotic-rich nutritious food crops. Electron. J. Biotechnol. 2014, 17, 238–245. [Google Scholar] [CrossRef] [Green Version]
- Tako, E.; Glahn, R.P.; Welch, R.M.; Lei, X.; Yasuda, K.; Miller, D.D. Dietary inulin affects the expression of intestinal enterocyte iron transporters, receptors and storage protein and alters the microbiota in the pig intestine. Br. J. Nutr. 2008, 99, 472–480. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, M.B.; Chassard, C.; Rohner, F.; N’goran, E.K.; Nindjin, C.; Dostal, A.; Utzinger, J.; Ghattas, H.; Lacroix, C.; Hurrell, R.F. The effects of iron fortification on the gut microbiota in African children: A randomized controlled trial in Cote d’Ivoire. Am. J. Clin. Nutr. 2010, 92, 1406–1415. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Kim, C.Y.; Kaur, A.; Lamothe, L.; Shaikh, M.; Keshavarzian, A.; Hamaker, B.R. Dietary fibre-based SCFA mixtures promote both protection and repair of intestinal epithelial barrier function in a Caco-2 cell model. Food Funct. 2017, 8, 1166–1173. [Google Scholar] [CrossRef] [PubMed]
- Duda-Chodak, A.; Tarko, T.; Satora, P.; Sroka, P. Interaction of dietary compounds, especially polyphenols, with the intestinal microbiota: A review. Eur J Nutr. 2015, 54, 325–341. [Google Scholar] [CrossRef]
- Blair, M.W. Mineral biofortification strategies for food staples: The example of common bean. J. Agric. Food Chem. 2013, 61, 8287–8294. [Google Scholar] [CrossRef] [PubMed]
- Bouis, H.E.; Hotz, C.; McClafferty, B.; Meenakshi, J.V.; Pfeiffer, W.H. Biofortification: A New Tool to Reduce Micronutrient Malnutrition. Food Nutr. Bull. 2014, 32, S31–S40. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Blair, M.W.; Glahn, R.P. Biofortified red mottled beans (Phaseolus vulgaris L.) in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus) and an in vitro digestion/Caco-2 model. Nutr. J. 2011, 10, 113. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Hoekenga, O.; Kochian, L.V.; Glahn, R.P. High bioavailablilty iron maize (Zea mays L.) developed through molecular breeding provides more absorbable iron in vitro (Caco-2 model) and in vivo (Gallus gallus). Nutr. J. 2013, 12, 3. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Rutzke, M.A.; Glahn, R.P. Using the domestic chicken (Gallus gallus) as an in vivo model for iron bioavailability. Poult. Sci. 2010, 89, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Dias, D.M.; Castro, M.E.M.; Gomes, M.J.C.; Lopes Toledo, R.C.; Nutti, M.R.; Pinheiro Sant’Ana, H.M.; Martino, H.S. Rice and bean targets for biofortification combined with high carotenoid content crops regulate transcriptional mechanisms increasing iron bioavailability. Nutrients 2015, 7, 9683–9696. [Google Scholar] [CrossRef] [PubMed]
- AOAC. Appendix J. In Proceedings of the AOAC INTERNATIONAL Methods Committee Guidelines for Validation of Microbiological Methods for Food and Environmental Surfaces; AOAC Off. Methods Anal.: Rockville, MD, USA, 2012; pp. 1–21. [Google Scholar]
- Glahn, R.P.; Lee, O.A.; Yeung, A.; Goldman, M.I.; Miller, D.D. Caco-2 cell ferritin formation predicts nonradiolabeled food iron availability in an in vitro digestion/Caco-2 cell culture model. J. Nutr. 1998, 128, 1555–1561. [Google Scholar] [CrossRef]
- Tako, E.; Bar, H.; Glahn, R.P. The combined application of the Caco-2 cell bioassay coupled with in vivo (Gallus gallus) feeding trial represents an effective approach to predicting fe bioavailability in humans. Nutrients 2016, 8, 732. [Google Scholar] [CrossRef]
- Tako, E.; Glahn, R.P.; Laparra, J.M.; Welch, R.M.; Lei, X.; Kelly, J.D.; Rutzke, M.A.; Miller, D.D. Iron and zinc bioavailabilities to pigs from red and white beans (Phaseolus vulgaris L.) are similar. J. Agric. Food Chem. 2009, 57, 3134–3140. [Google Scholar] [CrossRef]
- IBGE. Instituto Brasileiro de Geografia e Estatística, Coordenação de Trabalho e Rendimento. In Pesquisa de Orçamentos Familiares: 2008–2009. Análise Do Consumo Alimentar Pessoal No Brasil; IBGE: Rio de Janeiro, Brazil, 2011. [Google Scholar]
- Hou, T.; Kolba, N.; Glahn, R.; Tako, E. Intra-Amniotic Administration (Gallus gallus) of Cicer arietinum and Lens culinaris Prebiotics Extracts and Duck Egg White Peptides Affects Calcium Status and Intestinal Functionality. Nutrients 2017, 9, 785. [Google Scholar] [CrossRef]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Huntley, J.; Fierer, N.; Owens, S.M.; Betley, J.; Fraser, L.; Bauer, M.; et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012, 6, 1621–1624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caporaso, G.J.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. Correspondence QIIME allows analysis of high- throughput community sequencing data Intensity normalization improves color calling in SOLiD sequencing. Nat. Publ. Gr. 2010, 7, 335–336. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. High-resolution sample inference from Illumina amplicon data. Nat Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
- DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie, E.L.; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 2006, 72, 5069–5072. [Google Scholar] [CrossRef] [PubMed]
- Faith, D.P. Conservation evaluation and phylogentic diversity. Biol. Conserv. 1992, 61, 1–10. [Google Scholar] [CrossRef]
- Lozupone, C.; Knight, R. UniFrac : A New Phylogenetic Method for Comparing Microbial Communities. Appl. Environ. Microbiol. 2005, 71, 8228–8235. [Google Scholar] [CrossRef] [PubMed]
- Segata, N.; Izard, J.; Waldron, L.; Gevers, D.; Miropolsky, L.; Garrett, W.S.; Huttenhower, C. LEfSe-Metagenomic biomarker discovery and explanation. Genome Biol. 2011, 12, R60. [Google Scholar] [CrossRef]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Thurber, R.L.V.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef] [Green Version]
- Mead, G. Bacteria in the gastrointestinal tract of birds. Gastrointest. Microbiol. 1997, 2, 216–240. [Google Scholar]
- Eckburg, P.B.; Bik, E.M.; Bernstein, C.N.; Purdom, E.; Dethlefsen, L.; Sargent, M.; Gill, S.R.; Nelson, K.E.; Relman, D.A. Diversity of the Human Intestinal Microbial Flora. Science 2011, 1635, 1635–1639. [Google Scholar] [CrossRef]
- Wei, S.; Morrison, M.; Yu, Z. Bacterial census of poultry intestinal microbiome. Poult. Sci. 2013, 92, 671–683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.Y.; Liu, S.B.; Lu, L.; Li, S.F.; Xie, J.J.; Zhang, L.Y.; Zhang, J.H.; Luo, X.G. Relative bioavailability of iron proteinate for broilers fed a casein-dextrose diet. Am. Hist. Rev. 2014, 119, 556–563. [Google Scholar] [CrossRef]
- Hurrell, R.F.; Juillerat, M.A.; Reddy, M.B.; Lynch, S.R.; Dassenko, S.A.; Cook, J.D. Soy protein, phytate, and iron absorption in humans. Am. J. Clin. Nutr. 1992, 56, 573–578. [Google Scholar] [CrossRef] [PubMed]
- Anton, A.A.; Ross, K.A.; Beta, T.; Gary, F.R.; Arntfield, S.D. Effect of pre-dehulling treatments on some nutritional and physical properties of navy and pinto beans (Phaseolus vulgaris L.). LWT Food Sci. Technol. 2008, 41, 771–778. [Google Scholar] [CrossRef]
- Petry, N.; Egli, I.; Campion, B.; Nielsen, E.; Hurrell, R. Genetic Reduction of Phytate in Common Bean (Phaseolus vulgaris L.) Seeds Increases Iron Absorption in Young Women 1–4. J. Nutr. 2013, 143, 1219–1224. [Google Scholar] [CrossRef] [PubMed]
- Reed, S.; Neuman, H.; Glahn, R.P.; Koren, O.; Tako, E. Characterizing the gut (Gallus gallus) microbiota following the consumption of an iron biofortified Rwandan cream seeded carioca (Phaseolus vulgaris L.) bean-based diet. PLoS ONE 2017, 12, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Lesjak, M.; Hoque, R.; Balesaria, S.; Skinner, V.; Debnam, E.S.; Srai, S.K.S.; Sharp, P.A. Quercetin inhibits intestinal iron absorption and ferroportin transporter expression in vivo and in vitro. PLoS ONE 2014, 9, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Laparra, J.M.; Glahn, R.P.; Welch, R.M.; Lei, X.G.; Beebe, S.; Miller, D.D. Biofortified black beans in a maize and bean diet provide more bioavailable iron to piglets than standard black beans. J. Nutr. 2009, 139, 305–309. [Google Scholar] [CrossRef]
- Zhu, X.Y.; Zhong, T.; Pandya, Y.; Joerger, R.D. 16S rRNA-based analysis of microbiota from the cecum of broiler chickens. Appl. Environ. Microbiol. 2002, 68, 124–137. [Google Scholar] [CrossRef]
- Yegani, M.; Korver, D.R. Factors Affecting Intestinal Health in Poultry. Poult. Sci. 2008, 87, 2052–2063. [Google Scholar] [CrossRef] [Green Version]
- Qin, J.; Li, R.; Raes, J.; Arumugam, M.; Burgdorf, K.S.; Manichanh, C.; Nielsen, T.; Pons, N.; Levenez, F.; Yamada, T.; et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 2010, 464, 59–65. [Google Scholar] [CrossRef] [Green Version]
- Sakata, T. Stimulatory effect of short-chain fatty acids on epithelial cell proliferation in the rat intestine: A possible explanation for trophic effects of fermentable fibre, gut microbes and luminal trophic factors. Br. J. Nutr. 1987, 58, 95–103. [Google Scholar] [CrossRef]
- Ding, X.M.; Li, D.D.; Bai, S.P.; Wang, J.P.; Zeng, Q.F.; Su, Z.W.; Xuan, Y.; Zhang, K.Y. Effect of dietary xylooligosaccharides on intestinal characteristics, gut microbiota, cecal short-chain fatty acids, and plasma immune parameters of laying hens. Poult. Sci. 2018, 97, 874–881. [Google Scholar] [CrossRef]
- Adam, C.L.; Williams, P.A.; Garden, K.E.; Thomson, L.M.; Ross, A.W. Dose-dependent effects of a soluble dietary fibre (pectin) on food intake, adiposity, gut hypertrophy and gut satiety hormone secretion in rats. PLoS ONE 2015, 10, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Song, P.; Fan, P.; He, T.; Jacobs, D.; Levesque, C.L.; Johnston, L.J.; Ji, L.; Ma, N.; Chen, Y.; et al. Moderate Dietary Protein Restriction Optimized Gut Microbiota and Mucosal Barrier in Growing Pig Model. Front. Cell. Infect. Microbiol. 2018, 8, 246. [Google Scholar] [CrossRef] [PubMed]
- Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.; Mackay, C.; Macia, L. The role of short-chain fatty acids in health and disease. Adv. Immunol. 2014, 121, 91–119. [Google Scholar] [CrossRef] [PubMed]
- Tremaroli, V.; Bäckhed, F. Functional interactions between the gut microbiota and host metabolism. Nature 2012, 489, 242–249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Backhed, F.; Ding, H.; Wang, T.; Hooper, L.V.; Koh, G.Y.; Nagy, A.; Semenkovich, C.F.; Gordon, J.I. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. USA 2004, 101, 15718–15723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Connor, A.; Quizon, P.M.; Albright, J.E.; Lin, F.T.; Bennett, B.J. Responsiveness of cardiometabolic-related microbiota to diet is influenced by host genetics. Mamm. Genome 2014, 25, 583–599. [Google Scholar] [CrossRef] [Green Version]
- Hijova, E.; Chmelarova, A. Short chain fatty acids and colonic health. Bratisl. Lek. List. 2007, 108, 354–358. [Google Scholar] [CrossRef]
- Kutschera, M.; Engst, W.; Blaut, M.; Braune, A. Isolation of catechin-converting human intestinal bacteria. J. Appl. Microbiol. 2011, 111, 165–175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Larrosa, M.; Luceri, C.; Vivoli, E.; Pagliuca, C.; Lodovici, M.; Moneti, G.; Dolara, P. Polyphenol metabolites from colonic microbiota exert anti-inflammatory activity on different inflammation models. Mol. Nutr. Food Res. 2009, 53, 1044–1054. [Google Scholar] [CrossRef] [PubMed]
- Weiss, G. Dietary iron supplementation: A proinflammatory attack on the intestine? Gut 2015, 64, 696–697. [Google Scholar] [CrossRef] [PubMed]
- Kortman, G.A.M.; Raffatellu, M.; Swinkels, D.W.; Tjalsma, H. Nutritional iron turned inside out: Intestinal stress from a gut microbial perspective. FEMS Microbiol. Rev. 2014, 38, 1202–1234. [Google Scholar] [CrossRef] [PubMed]
- Jaeggi, T.; Kortman, G.A.M.; Moretti, D.; Chassard, C.; Holding, P.; Dostal, A.; Boekhorst, J.; Timmerman, H.M.; Swinkels, D.W.; Tjalsma, H.; et al. Iron fortification adversely affects the gut microbiome, increases pathogen abundance and induces intestinal inflammation in Kenyan infants. Gut 2015, 64, 731–742. [Google Scholar] [CrossRef] [PubMed]
Ingredient | Fe Content (μg Fe/g Sample) | Fe-Standard Carioca Based Diet (SC) (g/kg by Formulation) | Fe-Biofortified Carioca Bean Based Diet (BC) (g/kg by Formulation) |
---|---|---|---|
BRS Perola (Fe-standard bean) | 64.3 ± 0.54 | 420 | - |
BRS Cometa (Fe-biofortified bean) | 84.97 ± 2 | - | 420 |
Potato | 12.89 ± 0.43 | 320 | 320 |
Corn | 31.36 ± 4.74 | 70 | 70 |
Pasta (non-enriched) | 13.82 ± 1.04 | 70 | 70 |
Rice | 4.21 ± 0.8 | 50 | 50 |
Vitamin/mineral premix (no Fe) | 0.0 | 70 | 70 |
dl-Methionine | 0.0 | 2.5 | 2.5 |
Vegetable oil | 0.0 | 30 | 30 |
Choline chloride Total (g) | 0.0 | 0.75 | 0.75 |
Total (g) | |||
Selected components | |||
Dietary Fe concentration (μg/g) | - | 40.47 ± 1.84 | 47.04 ± 1.52 * |
Phytic acid (μg/g) | - | 1.71 ± 0.16 * | 1.15 ± 0.053 |
Phytate:Fe molar ratio | - | 35.76 | 20.84 |
Analyte | Forward Primer (5′-3′) (Nucleotide Position) | Reverse Primer (5′-3′) | Base Pairs Length | GI Identifier |
---|---|---|---|---|
Iron metabolism | ||||
DMT1 | TTGATTCAGAGCCTCCCATTAG | GCGAGGAGTAGGCTTGTATTT | 101 | 206597489 |
Ferroportin | CTCAGCAATCACTGGCATCA | ACTGGGCAACTCCAGAAATAAG | 98 | 61098365 |
DcytB | CATGTGCATTCTCTTCCAAAGTC | CTCCTTGGTGACCGCATTAT | 103 | 20380692 |
Hepcidin | AGACGACAATGCAGACTAACC | CTGCAGCAATCCCACATTTC | 132 | |
TRCP1 | GAGCAAGCCATGTCAAGATTTC | GTCTGGGCCAAGTCTGTTATAG | 122 | 015291382.1 |
BBM functionality | ||||
SI | CCAGCAATGCCAGCATATTG | CGGTTTCTCCTTACCACTTCTT | 95 | 2246388 |
SGLT1 | GCATCCTTACTCTGTGGTACTG | TATCCGCACATCACACATCC | 106 | 8346783 |
AP | CGTCAGCCAGTTTGACTATGTA | CTCTCAAAGAAGCTGAGGATGG | 138 | 45382360 |
18S rRNA | GCAAGACGAACTAAAGCGAAAG | TCGGAACTACGACGGTATCT | 100 | 7262899 |
Food Flours | Phytate (g/100 g) | Polyphenol Profile | ||||
---|---|---|---|---|---|---|
Kaempferol 3-Glucoside | Catechin | Epicatechin | Procyanidin B1 | Quercetin 3-Glucoside | ||
BRS Perola (Fe-standard) | 1.05 ± 0.03 | 17.3 ± 1 | 26.1 ± 1.3 | 12.8 ± 1.7 * | 1.4 ± 0.2 | 0.2 ± 0.1 |
BRS Cometa (Fe-biofortified) | 1.08 ± 0.005 | 16.2 ± 1.1 | 25.9 ± 4.6 | 11 ± 1.4 | 1.2 ± 0.2 | - |
Beans | Insoluble Fiber | Soluble Fiber | Total Fiber | Total Protein |
---|---|---|---|---|
BRS Perola (Fe-standard) | 20.80 ± 0.02 | 3.77 ± 1.03 | 24.56 ± 1.05 | 24.15 ± 0.44 |
BRS Cometa (Fe-biofortified) | 18.71 ± 0.94 | 4.85 ± 0.33 | 23.55 ± 1.27 | 29.01 * ± 0.29 |
Tested Sample | Ferritin (ng/mg of Protein) |
---|---|
Tested Diets | |
Standard Fe diet (SC) (40.4 ± 1.8 µg/g diet) | 5.04 ± 0.37 |
Biofortified Fe diet (BC) (47.0 ± 1.5 µg/g diet) | 6.10 ± 0.29 * |
Ingredients | |
BRS Perola (Fe-standard bean) (64.3 ± 0.5 µg/g bean) | 7.87 ± 1.15 d |
BRS Cometa (Fe-biofortified bean) (84.9 ± 2 µg/g bean) | 5.74 ± 0.34 d |
Potato flour (12.8 ± 0.4 µg/g flour) | 21.74 ± 0.83 a |
Pasta flour (13.8 ± 1.0 µg/g flour) | 12.79 ± 0.60 b |
Corn flour (31.3 ± 4.7 µg/g flour) | 10.38 ± 0.94 c |
Rice flour (4.2 ± 0.8 µg/g flour) | 6.12 ± 1.02 d |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dias, D.M.; Kolba, N.; Binyamin, D.; Ziv, O.; Regini Nutti, M.; Martino, H.S.D.; Glahn, R.P.; Koren, O.; Tako, E. Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota In Vivo (Gallus gallus). Nutrients 2018, 10, 1970. https://doi.org/10.3390/nu10121970
Dias DM, Kolba N, Binyamin D, Ziv O, Regini Nutti M, Martino HSD, Glahn RP, Koren O, Tako E. Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota In Vivo (Gallus gallus). Nutrients. 2018; 10(12):1970. https://doi.org/10.3390/nu10121970
Chicago/Turabian StyleDias, Desirrê Morais, Nikolai Kolba, Dana Binyamin, Oren Ziv, Marilia Regini Nutti, Hércia Stampini Duarte Martino, Raymond P. Glahn, Omry Koren, and Elad Tako. 2018. "Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota In Vivo (Gallus gallus)" Nutrients 10, no. 12: 1970. https://doi.org/10.3390/nu10121970