Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus)
Abstract
1. Introduction
2. Material and Methods
2.1. Sample Preparation
2.2. Polyphenols Analysis
2.2.1. Chia Sample Preparation
2.2.2. Liquid Chromatography–Mass Spectrometry (LC-MS) Analysis
2.3. Extraction of Soluble Extracts from Chia
2.4. Phytate, Dietary Fiber, Iron and Zinc Analysis in Chia Seeds and Chia Extract
2.5. Animals and Design
Intra Amniotic Administration
2.6. Iron and Zinc Content in Serum and Liver
2.7. Isolation of Total RNA from Duodenum and Liver
2.8. Real Time Polymerase Chain Reaction (RT-PCR)
2.9. Primer Design
2.10. Real-Time qPCR Design
2.11. Collection of Microbial Samples and Intestinal Content DNA Isolation
2.12. Primer Design and PCR Amplification of Bacterial 16S rDNA
2.13. Glycogen Analysis
2.14. Morphological Examination
2.15. Statistical Analysis
3. Results
3.1. Concentration of Iron, Zinc, Phytic Acid and Dietary Fiber and the Phytate:Iron Ratio in Chia Flour and in Chia Extract
3.2. Polyphenol Profile in Chia Flour
3.3. In Ovo Assay (Gallus Gallus Model)
3.3.1. Hb Concentration
3.3.2. Iron and Zinc Concentration in Liver and Serum
3.3.3. Gene Expression of Fe- and Zn-Related Genes
3.3.4. Gene Expression of BBM Functional Proteins
3.3.5. Gene Expression of Lipids Metabolism Protein
3.3.6. Cecum-to-Body-Weight Ratio
3.3.7. Microbial Analysis
3.3.8. Glycogen Analysis
3.3.9. Morphometric Data for Villi, Depth of Crypts and Goblet Cell
3.3.10. Hepatic Morphometric Measurement
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Wegmüller, R.; Bah, A.; Kendall, L.; Goheen, M.M.; Mulwa, S.; Cerami, C.; Moretti, D.; Prentice, A.M. Efficacy and safety of hepcidin-based screen-and-treat approaches using two different doses versus a standard universal approach of iron supplementation in young children in rural Gambia: A double-blind randomised controlled trial. BMC Pediatr. 2016, 149, 1–9. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. WHO Guideline: Infants and Young Children Aged 6–23 Months and Children Aged 2–12 Years for Point-of-Use Fortification of Foods Consumed by Use of Multiple Micronutrient Powders; WHO: Geneva, Switzerland, 2016; p. 52. [Google Scholar]
- Bailey, R.L.; West, K.P., Jr.; Black, R.E. The epidemiology of global micronutrient deficiencies. Ann. Nutr. Metab. 2015, 66, 22–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Black, R.E.; Victora, C.G.; Walker, S.P.; Bhutta, Z.A.; Christian, P.; Onis, M.; Ezzati, M.; Grantham-McGregor, S.; Katz, J.; Martorell, R.; et al. Maternal and Child Nutrition 1 Maternal and child undernutrition and overweight in low-income and middle-income countries. Lancet 2013, 382, 3–9. [Google Scholar] [CrossRef] [Scilit]
- Hess, S.Y. National Risk of Zinc Deficiency as Estimated by National Surveys. Food Nutr. Bull. 2017, 38, 3–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouis, H.E.; Saltzman, A. Improving nutrition through biofortifcation: A review of evidence from HarvestPlus, 2003 through 2016. Glob. Food Sec. 2017, 12, 49–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tako, E.; Reed, S.; Anandaraman, A.; Beebe, S.E.; Hart, J.J.; Glahn, R.P. Studies of Cream Seeded Carioca Beans (Phaseolus vulgaris L.) from a Rwandan Efficacy Trial: In Vitro and In Vivo Screening Tools Reflect Human Studies and Predict Beneficial Results from Iron Biofortified Beans. PLoS ONE 2015, 10, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wintergerst, E.S.; Maggini, S.; Hornig, D.H. Contribution of Selected Vitamins and Trace Elements to Immune Function. Ann. Nutr. Metab. 2007, 51, 301–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tako, E.; Rutzke, M.A.; Glahn, R.P. Using the domestic chicken (Gallus gallus) as an in vivo model for iron bioavailability. Poult. Sci. 2010, 89, 514–521. [Google Scholar] [CrossRef] [Scilit]
- Pacifici, S.; Song, J.; Zhang, C.; Wang, Q.; Glahn, R.P.; Kolba, N.; Tako, E. Intra Amniotic Administration of Raffinose and Stachyose Affects the Intestinal Brush Border Functionality and Alters Gut Microflora Populations. Nutrients 2017, 9, 304. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Kolba, N.; Liang, J.; Tako, E. Alterations in gut microflora populations and brush border functionality following intra-amniotic administration (Gallus gallus) of wheat bran prebiotic extracts. Food Funct. 2019. [Google Scholar] [CrossRef] [Scilit]
- Dias, D.M.; Kolba, N.; Hart, J.J.; Ma, M.; Sybil, T.S.; Lakshmanan, N.; Nutti, M.R.; Martino, H.S.D.; Glahn, R.P.; Tako, E. Soluble extracts from carioca beans (Phaseolus vulgaris L.) affect the gut microbiota and iron related brush border membrane protein expression in vivo (Gallus gallus). Food Res. Int. 2019, 123, 172–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, T.; Kolba, N.; Glahn, R.P.; Tako, E. Intra-amniotic administration (Gallus gallus) of cicer arietinum and lens culinaris prebiotics extracts and duck egg white peptides affects calcium status and intestinal functionality. Nutrients 2017, 9, 785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tako, E.; Glahn, R.P.; Knez, M.; Stangoulis, J.C.R. The effect of wheat prebiotics on the gut bacterial population and iron status of iron deficient broiler chickens. Nutr. J. 2014, 13, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tako, E.; Glahn, R.P. Intra-amniotic administration and dietary inulin affect the iron status and intestinal functionality of iron-deficient broiler chickens. Poult. Sci. 2012, 91, 1361–1370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, X.Y.; Zhong, T.; Pandya, Y.; Joerger, R.D. 16S rRNA-Based Analysis of Microbiota from the Cecum of Broiler Chickens. Appl. Environ. Microbiol. 2002, 68, 124–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hillier, L.W.; Miller, W.; Birney, E.; Warren, W.; Hardison, R.C.; Ponting, C.P. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 2004, 432, 695–716. [Google Scholar]
- Reed, S.; Neuman, H.; Moscovich, S.; Glahn, R.P.; Koren, O.; Tako, E. Chronic zinc deficiency alters chick gut microbiota composition and function. Nutrients 2015, 7, 9768–9784. [Google Scholar] [CrossRef] [Scilit]
- Conlon, M.A.; Bird, A.R. The Impact of Diet and Lifestyle on Gut Microbiota and Human Health. Nutrients 2015, 7, 17–44. [Google Scholar] [CrossRef] [Scilit]
- Markowiak, P.; Slizewska, K. Effects of Probiotics, Prebiotics, and Synbiotics on Human Health. Nutrients 2017, 9, 1021. [Google Scholar] [CrossRef] [Scilit]
- Sarao, L.K.; Arora, M. Probiotics, prebiotics, and microencapsulation: A review. Crit. Rev. Food Sci. Nutr. 2017, 57, 344–371. [Google Scholar] [CrossRef] [Scilit]
- Lindsay, J.O.; Whelan, K.; Stagg, A.J.; Gobin, P.; Al-Hassi, H.O.; Rayment, N.; Kamm, M.A.; Knight, S.C.; Forber, A. Clinical, microbiological, and immunological effects of fructo-oligosaccharide in patients with Crohn’s disease. Gut 2006, 55, 348–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kellow, N.J.; Coughlan, M.T.; Reid, C.M. Metabolic benefits of dietary prebiotics in human subjects: A systematic review of randomised controlled trials. Br. J. Nutr. 2014, 111, 1147–1161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berrocoso, J.D.; Kida, R.; Singh, A.K.; Kim, Y.S.; Jha, R. Effect of in ovo injection of raffinose on growth performance and gut health parameters of broiler chicken. Poult. Sci. 2017, 96, 1573–1580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miśta, D.; Króliczewska, B.; Pecka-Kiełb, E.; Kapuśniak, V.; Zawadzki, W.; Graczyk, S.; Kowalczyk, A.; Łukaszewic, E.; Bednarczyk, M. Effect of in ovo injected prebiotics and synbiotics on the caecal fermentation and intestinal morphology of broiler chickens. Anim. Prod. Sci. 2017, 57, 1884–1892. [Google Scholar] [CrossRef] [Scilit]
- Yeung, C.K.; Glahn, R.E.; Welch, R.M.; Miller, D.D. Prebiotics and Iron Bioavailability—Is There a Connection? J. Food Sci. 2005, 70, 88–92. [Google Scholar] [CrossRef] [Scilit]
- Hartono, K.; Reed, S.; Ankrah, N.A.; Glahn, R.P.; Tako, E. Alterations in gut microflora populations and brush border functionality following intra-amniotic daidzein administration. RSC Adv. 2015, 5, 6407–6412. [Google Scholar] [CrossRef] [Scilit]
- Dias, D.; Kolba, N.; Binyamin, D.; Ziv, O.; Nutti, M.R.; Martino, H.S.D.; Glahn, R.P.; Koren, O.; Tako, E. Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota in vivo (Gallus gallus). Nutrients 2018, 10, 1970. [Google Scholar] [CrossRef] [Scilit]
- Silva, B.P.; Dias, D.M.; Moreira, M.E.C.; Toledo, R.C.L.; da Matta, S.L.P.; Della Lucia, C.M.; Matino, H.S.D.; Pinheiro-Sant’Ana, H.M. Chia Seed Shows Good Protein Quality, Hypoglycemic Effect and Improves the Lipid Profile and Liver and Intestinal Morphology of Wistar Rats. Plant Foods Hum. Nutr. 2016, 71, 225–230. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Conesa, D.; López, G.; Ros, G. Effect of Probiotic, Prebiotic and Synbiotic Follow-up Infant Formulas on Iron Bioavailability in Rats. Food Sci. Technol. Int. 2007, 13, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Weinborn, V.; Valenzuela, C.; Olivares, M.; Arredondo, M.; Pizarro, F. Prebiotics increase heme iron bioavailability and do not affect non-heme iron bioavailability in humans. Food Funct. 2017, 8, 1994–1999. [Google Scholar] [CrossRef] [Scilit]
- Steed, H.; Macfarlane, S. Mechanisms of Prebiotic Impact on Health. Prebiotics Probiotics Sci. Technol. 2009, 2, 135–161. [Google Scholar]
- Baye, K.; Guyot, J.; Mouquet-Rivier, C. The unresolved role of dietary fibers on mineral absorption. Crit. Rev. Food Sci. Nutr. 2017, 57, 949–957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holscher, H.D. Dietary fiber and prebiotics and the gastrointestinal microbiota. Gut Microbes 2017, 8, 172–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, B.P.; Anunciação, P.C.; Matyelka, J.C.S.; Della Lucia, C.M.; Martino, H.S.D.; Pinheiro-Sant’Ana, H.M. Chemical composition of Brazilian chia seeds grown in different places. Food Chem. 2017, 221, 1709–1716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jafari, S.M.; Mcclements, D.J. Nanotechnology Approaches for Increasing Nutrient Bioavailability. Adv. Food Nutr. Res. 2017, 81, 1–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ullah, R.; Nadeem, M.; Khalique, A.; Imran, M.; Mehmood, S.; Javid, A. Nutritional and therapeutic perspectives of Chia (Salvia hispanica L.): A review. J. Food Sci. Technol. 2016, 53, 1750–1758. [Google Scholar] [CrossRef] [Scilit]
- AOAC-Association of Official Analytical Chemistry. Official Methods of Analysis; AOAC-Association of Official Analytical Chemistry: Gaithersburg, MD, USA, 2012; p. 19. [Google Scholar]
- Tako, E.; Glahn, R.P.; Welch, R.M.; Lei, X.; Yasuda, K.; Miller, D.D. Dietary inulin affects the expression of intestinal enterocyte iron transporters, receptors and storage protein and alters the microbiota in the pig intestine. Br. J. Nutr. 2008, 99, 472–480. [Google Scholar] [CrossRef] [Scilit]
- Dreiling, C.E.; Brown, D.E.; Casale, L.; Kelly, L. Muscle Glycogen: Comparison of Iodine Binding and Enzyme Digestion Assays and Application to Meat Samples. Meat Sci. 1987, 20, 167–177. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Ferket, P.R.; Uni, Z. Changes in chicken intestinal zinc exporter mRNA expression and small intestinal functionality following intra-amniotic zinc-methionine administration. J. Nutr. Biochem. 2005, 16, 339–346. [Google Scholar] [CrossRef] [Scilit]
- Uni, Z.; Noy, Y.; Sklan, D. Posthatch Development of Small Intestinal Function in the Poult. Metab. Nutr. 1999, 78, 215–222. [Google Scholar] [CrossRef] [Scilit]
- Andrews, N.C. A genetic view of iron homeostasis. Semin. Hematol. 2002, 39, 227–234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sangkhae, V.; Nemeth, E. Regulation of the Iron Homeostatic Hormone Hepcidin. Adv. Nutr. 2017, 8, 126–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abboud, S.; Haile, D.J. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J. Biol. Chem. 2000, 275, 19906–19912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Canali, S.; Bayer, A.; Dev, S.; Agarwal, A.; Babitt, J.L. Iron, erythropoietin, and inflammation regulate hepcidin in Bmp2 -deficient mice, but serum iron fails to induce hepcidin in Bmp6 -deficient mice. Am. J. Hematol. 2019, 240–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vela, D. The Dual Role of Hepcidin in Brain Iron Load and Inflammation. Front. Neurosci. 2018, 12, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Hara, T.; Takeda, T.A.; Takagishi, T.; Fukue, K.; Kambe, T.; Fukada, T. Physiological roles of zinc transporters: Molecular and genetic importance in zinc homeostasis. J. Physiol. Sci. 2017, 67, 283–301. [Google Scholar] [CrossRef] [Scilit]
- Langmade, S.J.; Ravindra, R.; Daniels, P.J.; Andrews, G.K. The Transcription Factor MTF-1 Mediates Metal Regulation of the Mouse ZnT1 Gene. J. Biol. Chem. 2000, 275, 34803–34809. [Google Scholar] [CrossRef] [Scilit]
- Patterson, J.K.; Lei, X.G.; Miller, D.D. The Pig as an Experimental Model for Elucidating the Mechanisms Governing Dietary Influence on Mineral Absorption. Exp. Biol. Med. 2008, 233, 651–664. [Google Scholar] [CrossRef] [Scilit]
- Sobolewska, A.; Elminowska-Wenda, G.; Bogucka, J.; Dankowiakowska, A.; Kułakowska, A.; Szczerba, A.; Stadnicka, K.; Szpinda, M.; Bednarczyk, M. The influence of in ovo injection with the prebiotic DiNovo® on the development of histomorphological parameters of the duodenum, body mass and productivity in large-scale poultry production conditions. J. Anim. Sci. Biotechnol. 2017, 8, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Bogucka, J.; Dankowiakowska, A.; Elminowska-Wenda, G.; Sobolewska, A.; Szczerba, A.; Bednarczyk, M. Effects of prebiotics and synbiotics delivered in ovo on broiler small intestine histomorphology during the first days after hatching. Folia Biol. 2016, 64, 131–146. [Google Scholar] [CrossRef] [Scilit]
- Akbarian, A.; Golian, A.; Kermanshahi, H.; Farhoosh, R.; Raji, A.R. Growth performance and gut health parameters of finishing broilers supplemented with plant extracts and exposed to daily increased temperature. Span. J. Agric. Res. 2013, 11, 109–119. [Google Scholar] [CrossRef] [Scilit]
- Viveros, A.; Chamorro, S.; Pizarro, M.; Arija, I.; Centeno, C.; Brenes, A. Effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. Poult. Sci. 2011, 90, 566–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, J.; Rubin, B.K.; Voynow, J.A. Mucins, Mucus, and Goblet Cells. Chest 2017, 154, 169–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, T.; Tako, E. The in ovo feeding administration (Gallus gallus)—An emerging in vivo approach to assess bioactive compounds with potential nutritional benefits. Nutrients 2018, 10, 418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, H.Y.; Zhang, K.Y.; Ding, X.M.; Bai, S.P.; Luo, Y.H.; Wang, J.P.; Zeng, Q.F. Effect of dietary fiber levels on performance, gizzard development, intestinal morphology, and nutrient utilization in meat ducks from 1 to 21 days of age. Poult. Sci. 2017, 96, 4333–4341. [Google Scholar] [CrossRef] [Scilit]
- Smirnov, A.; Tako, E.; Ferket, P.R.; Uni, Z. Mucin gene expression and mucin content in the chicken intestinal goblet cells are affected by in ovo feeding of carbohydrates. Poult. Sci. 2006, 85, 669–673. [Google Scholar] [CrossRef] [Scilit]





| Analyte | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Base Pair | GI Identifier |
|---|---|---|---|---|
| DMT1 | TTGATTCAGAGCCTCCCATTAG | GCGAGGAGTAGGCTTGTATTT | 101 | 206597489 |
| Ferroportin | CTCAGCAATCACTGGCATCA | ACTGGGCAACTCCAGAAATAAG | 98 | 61098365 |
| Dcytb | CATGTGCATTCTCTTCCAAAGTC | CTCCTTGGTGACCGCATTAT | 103 | 20380692 |
| Hepcidin * | GAGCAAGCCATGTCAAGATTTC | GTCTGGGCCAAGTCTGTTATAG | 132 | 8056490 |
| ZnT1 | GGTAACAGAGCTGCCTTAACT | GGTAACAGAGCTGCCTTAACT | 105 | 54109718 |
| SI | CCAGCAATGCCAGCATATTG | CGGTTTCTCCTTACCACTTCTT | 95 | 2246388 |
| AP | CGTCAGCCAGTTTGACTATGTA | CTCTCAAAGAAGCTGAGGATGG | 138 | 45382360 |
| SGLT1 | GCATCCTTACTCTGTGGTACTG | TATCCGCACATCACACATCC | 106 | 8346783 |
| LPL * | TGCTCAGATGCCCTACAAAG | TCTCGTCTAGAGTGCCATACA | 119 | 396219 |
| CEL * | ATGCTGCTGACATCGACTAC | TTCTGAAGTGGACGGTTGATAG | 97 | 417165 |
| 18S rRNA * | GCAAGACGAACTAAAGCGAAAG | TCGGAACTACGACGGTATCT | 100 | 7262899 |
| Treatment Group | Iron (µg/g) | Zinc (µg/g) | Insoluble Fiber (g/100g) | Soluble Fiber (g/100g) | Phytic Acid (g/100g) | Phytic Acid: Iron Ratio |
|---|---|---|---|---|---|---|
| Chia seed | 110.25 ± 4.97 a | 57.82 ± 0.40 a | 34.67 ± 1.84 a | 4.01 ± 0.21 b | 0.71 ± 0.02 a | 5.47 a |
| Chia extract | 41.46 ± 0.89 b | 31.29 ± 0.89 b | 23.53 ± 1.74 b | 19.68 ± 0.76 a | 0.08 ± 0.00 b | 1.60 b |
| Polyphenolic Compounds | Mean Peak Area (mAU-min/106) |
|---|---|
| Rosmarinic acid | 42.30 ± 1.90 |
| Rosmarinyl glucoside | 57.70 ± 0.02 |
| Ferulic acid | 1.19 ± 0.06 |
| Caffeic acid | 0.76 ± 0.38 |
| Protocatechuic acid | 0.21 ± 0.03 |
| Treatment Group | Hb (g/dL) |
|---|---|
| Non-injected | 5.93 ± 0.00 b |
| 18 Ω H2O | 5.52 ± 1.49 b |
| Inulin | 7.76 ± 1.16 a,b |
| 0.5% Chia | 7.08 ± 1.16 a,b |
| 1.0% Chia | 9.51 ± 1.34 a,b |
| 2.5% Chia | 10.41 ± 1.37 a |
| 5.0% Chia | 10.06 ± 2.48 a,b |
| Treatment Group | Liver | Serum | ||
|---|---|---|---|---|
| Iron (µg/g) | Zinc (µg/g) | Iron (µg/g) | Zinc (µg/g) | |
| Non-injected | 35.28 ± 2.52 a | 14.77 ± 1.26 b | 3.14 ± 0.25 a,b,c | 0.001 ± 0.000 a |
| 18 Ω H2O | 41.00 ± 3.24 a | 16.10 ± 1.57 a,b | 4.04 ± 0.52 a,b | 0.002 ± 0.000 a |
| Inulin | 40.92 ± 3.32 a | 16.39 ± 2.43 a,b | 4.24 ± 0.96 a | 0.001 ± 0.000 a |
| 0.5% Chia | 35.57 ± 3.16 a | 18.45 ± 1.13 a,b | 2.99 ± 0.44 a,b,c | 0.002 ± 0.000 a |
| 1.0% Chia | 43.17 ± 4.08 a | 21.63 ± 2.59 a | 2.36 ± 0.24 a,b | 0.003 ± 0.001 a |
| 2.5% Chia | 33.52 ± 1.67 a | 16.60 ± 1.41 a,b | 3.23 ± 0.63 a,b,c | 0.001 ± 0.000 a |
| 5.0% Chia | 35.88 ± 2.81 a | 17.87 ± 2.52 a,b | 1.59 ± 0.29 c | 0.002 ± 0.000 a |
| Treatment Group | Glycogen Concentration (mg/g) |
|---|---|
| Non-injected | 0.17 ± 0.04 a |
| 18 Ω H2O | 0.21 ± 0.05 a |
| Inulin | 0.29 ± 0.06 a |
| 0.5% Chia | 0.13 ± 0.03 a |
| 1.0% Chia | 0.31 ± 0.06 a |
| 2.5% Chia | 0.26 ± 0.08 a |
| 5.0% Chia | 0.29 ± 0.15 a |
| Treatment Group | Villus Surface Area (mm2) | Villus Length (µM) | Villus Width (µM) | Depth of Crypts (µM) | Mucus Layer Width (µM) |
|---|---|---|---|---|---|
| Non-injected | 170.29 ± 5.33 c | 248.64 ± 2.83 c | 43.26 ± 0.42 c | 12.76 ± 0.10 a | 2.21 ± 0.27 a |
| 18 Ω H2O | 127.13 ± 8.16 c | 204.30 ± 3.40 d | 39.24 ± 0.37 d | 12.60 ± 0.09 a | 2.32 ± 0.15 a |
| Inulin | 130.00 ± 9.42 c | 208.90 ± 3.63 d | 41.20 ± 0.56 c,d | 13.01 ± 0.10 a | 2.36 ± 0.1 a |
| 0.5% Chia | 237.53 ± 7.98 b | 323.85 ± 3.51 b | 46.42 ± 0.40 b | 12.49 ± 0.08 a | 2.41 ± 0.25 a |
| 1.0% Chia | 234.78 ± 7.36 b | 298.82 ± 2.43 b | 49.70 ± 0.51 b | 13.08 ± 0.09 a | 2.22 ± 0.10 a |
| 2.5% Chia | 264.95 ± 2.74 b | 334.44 ± 5.62 b | 50.15 ± 0.57 b | 12.83 ± 0.10 a | 2.20 ± 0.13 a |
| 5.0% Chia | 343.93 ± 9.38 a | 374.47 ± 5.50 a | 58.18 ± 0.59 a | 12.71 ± 0.11 a | 2.15 ± 0.14 a |
| Treatment Group | Goblet Cell Diameter (µM) | Total Goblet Cell Number (Unit) | Villus Goblet Cell Number (Unit) | Crypts Goblet Cell Number (Unit) | ||||
|---|---|---|---|---|---|---|---|---|
| Neutral | Acid | Mixed | Neutral | Acid | Mixed | |||
| Non-injected | 4.20 ± 0.03 c | 21.23 ± 0.24 c | 2.50 ± 0.33 a,b | 8.77 ± 0.23 b | 9.11 ± 0.33 c | 0.01 ± 0.00 b | 10.36 ± 0.57 a | 0.47 ± 0.15 c |
| 18 Ω H2O | 4.10 ± 0.03 c | 20.18 ± 0.26 c | 2.14 ± 0.24 b | 8.05 ± 0.74 c | 9.62 ± 0.47 c | 0.10 ± 0.00 b | 9.69 ± 0.55 a | 1.64 ± 0.16 a |
| Inulin | 4.89 ± 0.06 b | 24.88 ± 0.20 b | 3.90 ± 0.99 a | 8.67 ± 0.48 b | 11.02 ± 1.02 b,c | 0.01 ± 0.00 b | 10.32 ± 0.36 a | 0.43 ± 0.14 c |
| 0.5% Chia | 5.48 ± 0.03 a,b | 28.59 ± 0.32 a | 3.63 ± 0.25 a,b | 10.76 ± 0.71 a,b | 14.26 ± 0.51 a | 0.46 ± 0.12 a | 10.02 ± 0.91 a | 0.89 ± 0.06 b,c |
| 1.0% Chia | 5.36 ± 0.05 a,b | 29.19 ± 0.29 a | 2.07 ± 0.17 b | 11.43 ± 0.61 a,b | 15.55 ± 0.71 a | 0.09 ± 0.05 b | 9.65 ± 1.05 a | 1.30 ± 0.11 a,b |
| 2.5% Chia | 5.61 ± 0.02 a | 29.61 ± 0.40 a | 1.63 ± 0.16 c | 13.70 ± 1.53 a | 13.72 ± 1.35 a | 0.05 ± 0.02 b | 9.45 ± 0.49 a | 1.45 ± 0.30 a |
| 5.0% Chia | 5.42 ± 0.06 a,b | 29.91 ± 0.39 a | 2.55 ± 0.43 a,b | 13.13 ± 1.35 a | 13.20 ± 1.51 a,b | 0.18 ± 0.06 a,b | 9.88 ± 0.13 a | 0.82 ± 0.21 b,c |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pereira da Silva, B.; Kolba, N.; Stampini Duarte Martino, H.; Hart, J.; Tako, E. Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus). Nutrients 2019, 11, 2457. https://doi.org/10.3390/nu11102457
Pereira da Silva B, Kolba N, Stampini Duarte Martino H, Hart J, Tako E. Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus). Nutrients. 2019; 11(10):2457. https://doi.org/10.3390/nu11102457
Chicago/Turabian StylePereira da Silva, Bárbara, Nikolai Kolba, Hércia Stampini Duarte Martino, Jonathan Hart, and Elad Tako. 2019. "Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus)" Nutrients 11, no. 10: 2457. https://doi.org/10.3390/nu11102457
APA StylePereira da Silva, B., Kolba, N., Stampini Duarte Martino, H., Hart, J., & Tako, E. (2019). Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus). Nutrients, 11(10), 2457. https://doi.org/10.3390/nu11102457

