Abeliophyllum distichum Ameliorates High-Fat Diet-Induced Obesity in C57BL/6J Mice by Upregulating the AMPK Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diet
2.2. Analysis of Serum Biochemical Markers
2.3. Micro-Computed Tomography (Micro-CT)
2.4. Histological Analysis
2.5. RT-PCR and Western Blot
2.6. Statistical Analysis
3. Results
3.1. AE Consumption Improved High-Fat Diet-Induced Body Weight Gain
3.2. AE Improved Serum Lipid Profile, Serum Glucose Levels, and Hepatotoxicity Markers
3.3. AE Reduced Subcutaneous and Visceral Fat Volumes and Decreased Ectopic Lipid Accumulation
3.4. AE Suppressed the mRNA Expression of Lipogenic Genes in Epididymal Fat Tissue
3.5. AE Upregulated AMPK Activation in Epididymal Fat Tissue
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Seo, M.H.; Lee, W.Y.; Kim, S.S.; Kang, J.H.; Kang, J.H.; Kim, K.K.; Kim, B.Y.; Kim, Y.H.; Kim, W.J.; Kim, E.M.; et al. 2018 Korean society for the study of obesity guideline for the management of obesity in Korea. J. Obes. Metab. Syndr. 2019, 28, 40–45. [Google Scholar] [CrossRef] [PubMed]
- Luhar, S.; Timæus, I.M.; Jones, R.; Cunningham, S.; Patel, S.A.; Kinra, S.; Clarke, L.; Houben, R. Forecasting the prevalence of overweight and obesity in India to 2040. PLoS ONE 2020, 15, e0229438. [Google Scholar] [CrossRef] [PubMed]
- Chang, E.; Kim, C.Y. Natural Products and Obesity: A focus on the regulation of mitotic clonal expansion during adipogenesis. Molecules 2019, 24, 1157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Payab, M.; Hasani-Ranjbar, S.; Shahbal, N.; Qorbani, M.; Aletaha, A.; Haghi-Aminjan, H.; Soltani, A.; Khatami, F.; Nikfar, S.; Hassani, S.; et al. Effect of the herbal medicines in obesity and metabolic syndrome: A systematic review and meta-analysis of clinical trials. Phytother. Res. 2020, 34, 526–545. [Google Scholar] [CrossRef]
- Choe, S.S.; Huh, J.Y.; Kim, J.I.; KIM, J.B. Adipose tissue remodeling: Its role in energy metabolism and metabolic disorders. Front. Endocrinol. 2016, 7, 30. [Google Scholar] [CrossRef] [Green Version]
- Coelho, M.; Oliveira, T.; Fernandes, R. Biochemistry of adipose tissue: An endocrine organ. Arch. Med. Sci. 2013, 9, 191–200. [Google Scholar] [CrossRef] [Green Version]
- Longo, M.; Zatterale, F.; Naderi, J.; Parrillo, L.; Formisano, P.; Raciti, G.G.; Beguinot, F.; Miele, C. Adipose tissue dysfunction as determinant of obesity-associated metabolic complications. Int. J. Mol. Sci. 2019, 20, 2358. [Google Scholar] [CrossRef] [Green Version]
- Park, G.H.; Park, J.H.; Ji Eo, H.J.; Song, H.M.; Lee, M.H.; Lee, J.R.; Jeong, J.B. Anti-inflammatory effect of the extracts from Abeliophyllum distichum Nakai in LPS-stimulated RAW264. 7 cells. Korean J. Plant Res. 2014, 27, 209–214. [Google Scholar] [CrossRef]
- Lee, J.W.; Kang, Y.J. Anti-inflammatory effects of Abeliophyllum distichum flower extract and associated MAPKs and NF-κB pathway in raw264. 7 cells. Korean J. Plant Res. 2018, 31, 202–210. [Google Scholar]
- Kim, E.Y.; Kim, J.H.; Kim, M.; Park, J.H.; Sohn, Y.; Jung, H.S. Abeliophyllum distichum Nakai alleviates postmenopausal osteoporosis in ovariectomized rats and prevents RANKL-induced osteoclastogenesis in vitro. J. Ethnopharmacol. 2020, 257, 112828. [Google Scholar] [CrossRef]
- Kopelman, P.G. Obesity as a medical problem. Nature 2000, 404, 635–643. [Google Scholar] [CrossRef]
- Zhang, J.; Zhao, Y.; Xu, C.; Hong, Y.; Lu, H.; Wu, J.; Chen, Y. Association between serum free fatty acid levels and nonalcoholic fatty liver disease: A cross-sectional study. Sci. Rep. 2014, 4, 5832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.K.; Lee, J.-J.; Kim, Y.-K.; Lee, Y.; Ha, J.-H. Stachys sieboldii Miq. root attenuates weight gain and dyslipidemia in rats on a high-fat and high-cholesterol diet. Nutrients 2020, 12, 2063. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Sun, M.; Yao, H.; Liu, Y.; Gao, R. Herbal medicine for the treatment of obesity: An overview of scientific evidence from 2007 to 2017. Evid. Based Complement. Alternat. Med. 2017, 2017, 8943059. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Smith, D.L., Jr.; Keating, K.D.; Allison, D.B.; Nagy, T.R. Variations in body weight, food intake and body composition after long-term high-fat diet feeding in C57BL/6J mice. Obesity 2014, 22, 2147–2155. [Google Scholar] [CrossRef]
- Kakimoto, P.A.; Kowaltowski, A.J. Effects of high fat diets on rodent liver bioenergetics and oxidative imbalance. Redox Biol. 2016, 8, 216–225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carr, M.C.; Brunzell, J.D. Abdominal obesity and dyslipidemia in the metabolic syndrome: Importance of type 2 diabetes and familial combined hyperlipidemia in coronary artery disease risk. J. Clin. Endocrinol. Metab. 2004, 89, 2601–2607. [Google Scholar] [CrossRef] [Green Version]
- Martyn, J.A.; Kaneki, M.; Yasuhara, S. Obesity-induced insulin resistance and hyperglycemia: Etiologic factors and molecular mechanisms. Anesthesiology 2008, 109, 137–148. [Google Scholar] [CrossRef] [Green Version]
- Gómez-Hernández, A.; Beneit, N.; Díaz-Castroverde, S.; Escribano, O. Differential role of adipose tissues in obesity and related metabolic and vascular complications. Int. J. Endocrinol. 2016, 2016, 1216783. [Google Scholar] [CrossRef] [Green Version]
- Sam, S.; Mazzone, T. Adipose tissue changes in obesity and the impact on metabolic function. Transl. Res. 2014, 164, 284–292. [Google Scholar] [CrossRef]
- Kubota, N.; Terauchi, Y.; Miki, H.; Tamemoto, H.; Yamauchi, T.; Komeda, K.; Satoh, S.; Nakano, R.; Ishii, C.; Sugiyama, T.; et al. PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol. Cell 1999, 4, 597–609. [Google Scholar] [CrossRef]
- Jones, J.R.; Barrick, C.; Kim, K.A.; Lindner, J.; Blondeau, B.; Fujimoto, Y.; Shiota, M.; Kesterson, R.A.; Kahn, B.B.; Magnuson, M.A. Deletion of PPARgamma in adipose tissues of mice protects against high fat diet-induced obesity and insulin resistance. Proc. Natl. Acad. Sci. USA 2005, 102, 6207–6212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, T.; Gao, J.; Du, M.; Song, J.; Mao, X. Milk fat globule membrane attenuates high-fat diet-induced obesity by inhibiting adipogenesis and increasing uncoupling protein 1 expression in white adipose tissue of mice. Nutrients 2018, 10, 331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Crewe, C.; Zhu, Y.; Paschoal, V.A.; Joffin, N.; Ghaben, A.L.; Gordillo, R.; Oh, D.Y.; Liang, G.; Horton, J.D.; Scherer, P.E. SREBP-regulated adipocyte lipogenesis is dependent on substrate availability and redox modulation of mTORC1. JCI Insight 2019, 4, e129397. [Google Scholar] [CrossRef]
- Song, Z.; Xiaoli, A.M.; Yang, F. Regulation and metabolic significance of de novo lipogenesis in adipose tissues. Nutrients 2018, 10, 1383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, L.; Zhang, L.; Li, B.; Jiang, H.; Duan, Y.; Xie, Z.; Shuai, L.; Li, J.; Li, J. AMP-Activated Protein Kinase (AMPK) regulates energy metabolism through modulating thermogenesis in adipose tissue. Front. Physiol. 2018, 9, 122. [Google Scholar] [CrossRef] [Green Version]
- Jeon, S.M. Regulation and function of AMPK in physiology and diseases. Exp. Mol. Med. 2016, 48, e245. [Google Scholar] [CrossRef]
- Yoo, T.K.; Kim, J.S.; Hyun, T.K. Polyphenolic composition and anti-melanoma activity of white forsythia (Abeliophyllum distichum nakai) organ extracts. Plants 2020, 9, 757. [Google Scholar] [CrossRef]
- Herranz-López, M.; Barrajón-Catalán, E.; Segura-Carretero, A.; Menéndez, J.A.; Joven, J.; Micol, V. Lemon verbena (Lippia citriodora) polyphenols alleviate obesity-related disturbances in hypertrophic adipocytes through AMPK-dependent mechanisms. Phytomedicine 2015, 22, 605–614. [Google Scholar] [CrossRef]
- Seo, S.; Lee, M.S.; Chang, E.; Shin, Y.; Oh, S.; Kim, I.H.; Kim, Y. Rutin increases muscle mitochondrial biogenesis with ampk activation in high-fat diet-induced obese rats. Nutrients 2015, 7, 8152–8169. [Google Scholar] [CrossRef] [Green Version]
- Sudhakar, M.; Sasikumar, J.S.; Silambanan, S.; Natarajan, D.; Ramakrishan, R.; Nair, A.J.; Kiran, M.S. Chlorogenic acid promotes development of brown adipocyte-like phenotype in 3T3-L1 adipocytes. J. Funct. Foods 2020, 74, 104161. [Google Scholar] [CrossRef]
- Liu, H.; Wang, J.; Liu, M.; Zhao, H.; Yaqoob, S.; Zheng, M.; Cai, D.; Liu, J. Antiobesity effects of ginsenoside Rg1 on 3T3-L1 preadipocytes and high fat diet-induced obese mice mediated by AMPK. Nutrients 2018, 10, 830. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.W.; Choe, S.S.; Jang, H.; Kim, J.; Jeong, H.W.; Jo, H.; Jeong, K.H.; Tadi, S.; Park, M.G.; Kwak, T.H.; et al. AMPK activation with glabridin ameliorates adiposity and lipid dysregulation in obesity. J. Lipid Res. 2012, 53, 1277–1286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.H.; Kim, O.K.; Yoon, H.G.; Park, J.; You, Y.; Kim, K.; Lee, Y.H.; Choi, K.C.; Lee, J.; Jun, W. Anti-obesity effect of extract from fermented Curcuma longa L. through regulation of adipogenesis and lipolysis pathway in high-fat diet-induced obese rats. Food. Nutr. Res. 2016, 60, 30428. [Google Scholar] [CrossRef] [Green Version]
- Li, H.M.; Kim, J.K.; Jang, J.M.; Cui, C.B.; Lim, S.S. Analysis of the inhibitory activity of Abeliophyllum distichum leaf constituents against aldose reductase by using high-speed counter current chromatography. Arch. Pharm. Res. 2013, 36, 1104–1112. [Google Scholar] [CrossRef] [PubMed]
- Jang, T.W.; Park, J.H. Antioxidant activity and inhibitory effects on oxidative DNA damage of callus from Abeliophyllum distichum Nakai. Korean J. Plant Res. 2018, 31, 228–236. [Google Scholar]
- Park, G.H.; Park, J.H.; Eo, H.J.; Song, H.M.; Woo, S.H.; Kim, M.K.; Lee, J.W.; Lee, M.H.; Lee, J.R.; Koo, J.S.; et al. The induction of activating transcription factor 3 (ATF3) contributes to anti-cancer activity of Abeliophyllum distichum Nakai in human colorectal cancer cells. BMC Complement. Altern. Med. 2014, 14, 487. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primers | Sequence (5′–3′) |
---|---|---|
PPARγ | Forward | GCCCACCAACTTCGGAATC |
Reverse | TGCGAGTGGTCTTCCATCAC | |
C/EBPα | Forward | GAGCTGAGTGAGGCTCTCATTCT |
Reverse | TGGGAGGCAGACGAAAAAAC | |
SREBP1c | Forward | CCAGAGGGTGAGCCTGACAA |
Reverse | AGCCTCTGCAATTTCCAGATCT | |
FAS | Forward | GAAGTGTCTGGACTGTGTCATTTTTAC |
Reverse | TTAATTGTGGGATCAGGAGAGCAT | |
ACC | Forward | GCCTCTTCCTGACAAACGAG |
Reverse | TAAGGACTGTGCCTGGAACC | |
GAPDH | Forward | FCATGGCCTTCCGTGTTCCTA |
Reverse | GCGGCACGRCAGATCCA |
Serum Biomarkers | ND | HD | GE300 | AE100 | AE300 |
---|---|---|---|---|---|
ALT (U/L) | 44.9 ± 5.9 b | 196.8 ± 108.5 a | 74.9 ± 22.3 b | 55.2 ± 20.7 b | 41.4 ± 9.3 b |
AST (U/L) | 56.9 ± 6.5 b | 114.4 ± 61.3 a | 86.3 ± 18.9 b | 71.6 ± 12.1 b | 69.6 ± 6.8 b |
TC (mg/dL) | 127.0 ± 9.0 c | 220.0 ± 21.0 a | 168.0 ± 22.0 b | 176.0 ± 9.0 b | 162.0 ± 14.0 b |
TG (mg/dL) | 126.0 ± 13.0 b | 247.0 ± 60.0 a | 118.0 ± 17.0 b | 123.0 ± 20.0 b | 124.0 ± 9.0 b |
GLU (mg/dL) | 256.0 ± 39.1 c | 460.3 ± 69.6 a | 316.1 ± 38.1 bc | 320.0 ± 20.4 b | 303.5 ± 38.1 bc |
HDL-C (mg/dL) | 98.8 ± 6.8 c | 159.8 ± 12.0 a | 138.1 ± 15.4 b | 140.9 ± 19.6 b | 142.6 ± 8.3 ab |
LDL-C (mg/dL) | 14.5 ± 1.9 b | 35.2 ± 8.2 a | 17.3 ± 3.5 b | 20.2 ± 3.4 b | 18.1 ± 1.8 b |
Leptin (pg/mL) | 225.2 ± 20.9 c | 484.6 ± 60.4 a | 421.3 ± 101.2 a | 433.5 ± 76.9 a | 318.6 ± 14.1 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Eom, J.; Thomas, S.S.; Sung, N.-Y.; Kim, D.-S.; Cha, Y.-S.; Kim, K.-A. Abeliophyllum distichum Ameliorates High-Fat Diet-Induced Obesity in C57BL/6J Mice by Upregulating the AMPK Pathway. Nutrients 2020, 12, 3320. https://doi.org/10.3390/nu12113320
Eom J, Thomas SS, Sung N-Y, Kim D-S, Cha Y-S, Kim K-A. Abeliophyllum distichum Ameliorates High-Fat Diet-Induced Obesity in C57BL/6J Mice by Upregulating the AMPK Pathway. Nutrients. 2020; 12(11):3320. https://doi.org/10.3390/nu12113320
Chicago/Turabian StyleEom, Ji, Shalom Sara Thomas, Nak-Yun Sung, Dong-Sub Kim, Youn-Soo Cha, and Kyung-Ah Kim. 2020. "Abeliophyllum distichum Ameliorates High-Fat Diet-Induced Obesity in C57BL/6J Mice by Upregulating the AMPK Pathway" Nutrients 12, no. 11: 3320. https://doi.org/10.3390/nu12113320