Effects of 1,25-Dihydroxyvitamin D3 on the Inflammatory Responses of Stromal Vascular Cells and Adipocytes from Lean and Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diets
2.2. Determination of Serum and Adipose Tissue 25(OH)D Levels
2.3. Adipocyte and Stromal Vascular Cell(SVC) Isolation
2.4. Flow Cytometric Analysis
2.5. In Vitro 1,25(OH)2D3 Treatment
2.6. Determination of Pro-Inflammatory Cytokines Production
2.7. RNA Extraction from SVCs and Real-Time PCR
2.8. Statistical Analysis
3. Results
3.1. Body Weight, Weight Change, WAT Weight, and Food Intake
3.2. Serum and Epididymal Adipose Tissue 25(OH)D Levels
3.3. 1-Hydroxylase and Vdr Expression in Epididymal Adipose Tissue
3.4. Expression of Pro-Inflammatory Chemokines and Cytokines Expression in Epididymal Adipose Tissue
3.5. Subpopulation and the Number of Immune cells of SVCs in Visceral Adipose Tissue
3.6. Production of Pro-Inflammatory Cytokines by SVCs
3.7. Production of Pro-Inflammatory Cytokines by Adipocytes
3.8. Expression of Genes Involved in Inflammatory Responses in SVCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fantuzzi, G. Adipose tissue, adipokines, and inflammation. J. Allergy Clin. Immunol. 2005, 115, 911–919. [Google Scholar] [CrossRef] [PubMed]
- Weisberg, S.P.; McCann, D.; Desai, M.; Rosenbaum, M.; Leibel, R.L.; Ferrante, A.W., Jr. Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Investig. 2003, 112, 1796–1808. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Bengmark, S.; Qu, S. The role of hepatic fat accumulation in pathogenesis of non-alcoholic fatty liver disease (NAFLD). Lipids Health Dis. 2010, 9, 42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stojsavljević, S.; Gomerčić Palčić, M.; Virović Jukić, L.; Smirčić Duvnjak, L.; Duvnjak, M. Adipokines and proinflammatory cytokines, the key mediators in the pathogenesis of nonalcoholic fatty liver disease. J. Gastroenterol. 2014, 20, 18070–18091. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pereira-Santos, M.; Costa, P.R.; Assis, A.M.; Santos, C.A.; Santos, D.B. Obesity and vitamin D deficiency: A systematic review and meta-analysis. Obesity reviews: An official journal of the International. Pediatr. Obes. 2015, 16, 341–349. [Google Scholar] [CrossRef]
- Mezza, T.; Muscogiuri, G.; Sorice, G.P.; Prioletta, A.; Salomone, E.; Pontecorvi, A.; Giaccari, A. Vitamin D deficiency: A new risk factor for type 2 diabetes? Ann. Nutr. Metab. 2012, 61, 337–348. [Google Scholar] [CrossRef]
- Cheng, S.; Massaro, J.M.; Fox, C.S.; Larson, M.G.; Keyes, M.J.; McCabe, E.L.; Robins, S.J.; O’Donnell, C.J.; Hoffmann, U.; Jacques, P.F.; et al. Adiposity, cardiometabolic risk, and vitamin D status: The Framingham Heart Study. Diabetes 2010, 59, 242–248. [Google Scholar] [CrossRef] [Green Version]
- Roth, C.L.; Elfers, C.T.; Figlewicz, D.P.; Melhorn, S.J.; Morton, G.J.; Hoofnagle, A.; Yeh, M.M.; Nelson, J.E.; Kowdley, K.V. Vitamin D deficiency in obese rats exacerbates nonalcoholic fatty liver disease and increases hepatic resistin and Toll-like receptor activation. Hepatol. (Baltimore, Md.) 2012, 55, 1103–1111. [Google Scholar] [CrossRef]
- Ding, C.; Wilding, J.P.; Bing, C. 1,25-dihydroxyvitamin D3 protects against macrophage-induced activation of NFkappaB and MAPK signalling and chemokine release in human adipocytes. PLoS ONE 2013, 8, e61707. [Google Scholar] [CrossRef] [Green Version]
- Marcotorchino, J.; Gouranton, E.; Romier, B.; Tourniaire, F.; Astier, J.; Malezet, C.; Amiot, M.J.; Landrier, J.F. Vitamin D reduces the inflammatory response and restores glucose uptake in adipocytes. Mol. Nutr. Food Res. 2012, 56, 1771–1782. [Google Scholar] [CrossRef]
- Tilg, H.; Moschen, A.R. Adipocytokines: Mediators linking adipose tissue, inflammation and immunity. Nat. Rev. Immunol. 2006, 6, 772–783. [Google Scholar] [CrossRef] [PubMed]
- Lehr, S.; Hartwig, S.; Lamers, D.; Famulla, S.; Muller, S.; Hanisch, F.G.; Cuvelier, C.; Ruige, J.; Eckardt, K.; Ouwens, D.M.; et al. Identification and validation of novel adipokines released from primary human adipocytes. Mol. Cell. Proteom. MCP 2012, 11, M111010504. [Google Scholar] [CrossRef] [Green Version]
- Choe, S.S.; Huh, J.Y.; Hwang, I.J.; Kim, J.I.; Kim, J.B. Adipose Tissue Remodeling: Its Role in Energy Metabolism and Metabolic Disorders. Front. Endocrinol. 2016, 7, 30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Watanabe, Y.; Nagai, Y.; Takatsu, K. Activation and regulation of the pattern recognition receptors in obesity-induced adipose tissue inflammation and insulin resistance. Nutrients 2013, 5, 3757–3778. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nishimura, S.; Manabe, I.; Nagasaki, M.; Eto, K.; Yamashita, H.; Ohsugi, M.; Otsu, M.; Hara, K.; Ueki, K.; Sugiura, S.; et al. CD8+ effector T cells contribute to macrophage recruitment and adipose tissue inflammation in obesity. Nat. Med. 2009, 15, 914–920. [Google Scholar] [CrossRef]
- Feuerer, M.; Herrero, L.; Cipolletta, D.; Naaz, A.; Wong, J.; Nayer, A.; Lee, J.; Goldfine, A.B.; Benoist, C.; Shoelson, S.; et al. Lean, but not obese, fat is enriched for a unique population of regulatory T cells that affect metabolic parameters. Nat. Med. 2009, 15, 930–939. [Google Scholar] [CrossRef]
- Fabbrini, E.; Cella, M.; McCartney, S.A.; Fuchs, A.; Abumrad, N.A.; Pietka, T.A.; Chen, Z.; Finck, B.N.; Han, D.H.; Magkos, F.; et al. Association between specific adipose tissue CD4+ T-cell populations and insulin resistance in obese individuals. Gastroenterology 2013, 145, 366–374. [Google Scholar] [CrossRef] [Green Version]
- Jagannathan-Bogdan, M.; McDonnell, M.E.; Shin, H.; Rehman, Q.; Hasturk, H.; Apovian, C.M.; Nikolajczyk, B.S. Elevated proinflammatory cytokine production by a skewed T cell compartment requires monocytes and promotes inflammation in type 2 diabetes. J. Immunol. (Baltimore, Md.: 1950) 2011, 186, 1162–1172. [Google Scholar] [CrossRef] [Green Version]
- Del Valle, H.B.; Yaktine, A.L.; Taylor, C.L.; Ross, A.C. Dietary Reference Intakes for Calcium and Vitamin D; National Academies Press: Washington, DC, USA, 2011. [Google Scholar]
- Uematsu, S.; Akira, S. Toll-like receptors and innate immunity. J. Mol. Med. (Berlin, Germany) 2006, 84, 712–725. [Google Scholar] [CrossRef]
- Lee, J.Y.; Sohn, K.H.; Rhee, S.H.; Hwang, D. Saturated fatty acids, but not unsaturated fatty acids, induce the expression of cyclooxygenase-2 mediated through Toll-like receptor 4. J. Biol. Chem. 2001, 276, 16683–16689. [Google Scholar] [CrossRef] [Green Version]
- Wong, S.W.; Kwon, M.J.; Choi, A.M.; Kim, H.P.; Nakahira, K.; Hwang, D.H. Fatty acids modulate Toll-like receptor 4 activation through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J. Biol. Chem. 2009, 284, 27384–27392. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Creely, S.J.; McTernan, P.G.; Kusminski, C.M.; Fisher f, M.; Da Silva, N.F.; Khanolkar, M.; Evans, M.; Harte, A.L.; Kumar, S. Lipopolysaccharide activates an innate immune system response in human adipose tissue in obesity and type 2 diabetes. Am. J. Physiol. Endocrinol. Metab. 2007, 292, E740–E747. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Kokoeva, M.V.; Inouye, K.; Tzameli, I.; Yin, H.; Flier, J.S. TLR4 links innate immunity and fatty acid-induced insulin resistance. J. Clin. Investig. 2006, 116, 3015–3025. [Google Scholar] [CrossRef] [PubMed]
- Mutt, S.J.; Hypponen, E.; Saarnio, J.; Jarvelin, M.R.; Herzig, K.H. Vitamin D and adipose tissue-more than storage. Front. Physiol. 2014, 5, 228. [Google Scholar] [CrossRef] [Green Version]
- Lira, F.S.; Rosa, J.C.; Cunha, C.A.; Ribeiro, E.B.; do Nascimento, C.O.; Oyama, L.M.; Mota, J.F. Supplementing alpha-tocopherol (vitamin E) and vitamin D3 in high fat diet decrease IL-6 production in murine epididymal adipose tissue and 3T3-L1 adipocytes following LPS stimulation. Lipids Health Dis. 2011, 10, 37. [Google Scholar] [CrossRef] [Green Version]
- Gao, D.; Trayhurn, P.; Bing, C. 1,25-Dihydroxyvitamin D3 inhibits the cytokine-induced secretion of MCP-1 and reduces monocyte recruitment by human preadipocytes. Int. J. Obes. (2005) 2013, 37, 357–365. [Google Scholar] [CrossRef] [Green Version]
- Karkeni, E.; Marcotorchino, J.; Tourniaire, F.; Astier, J.; Peiretti, F.; Darmon, P.; Landrier, J.F. Vitamin D limits chemokine expression in adipocytes and macrophage migration in vitro and in male mice. Endocrinology 2015, 156, 1782–1793. [Google Scholar] [CrossRef]
- Lorente-Cebrian, S.; Eriksson, A.; Dunlop, T.; Mejhert, N.; Dahlman, I.; Astrom, G.; Sjolin, E.; Wahlen, K.; Carlberg, C.; Laurencikiene, J.; et al. Differential effects of 1alpha,25-dihydroxycholecalciferol on MCP-1 and adiponectin production in human white adipocytes. Eur. J. Nutr. 2012, 51, 335–342. [Google Scholar] [CrossRef]
- Zhang, Y.; Leung, D.Y.; Richers, B.N.; Liu, Y.; Remigio, L.K.; Riches, D.W.; Goleva, E. Vitamin D inhibits monocyte/macrophage proinflammatory cytokine production by targeting MAPK phosphatase-1. J. Immunol. (Baltimore, Md.: 1950) 2012, 188, 2127–2135. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Zemel, M.B. Calcitriol and calcium regulate cytokine production and adipocyte-macrophage cross-talk. J. Nutr. Biochem. 2008, 19, 392–399. [Google Scholar] [CrossRef]
- Lipkie, T.E.; Janasch, A.; Cooper, B.R.; Hohman, E.E.; Weaver, C.M.; Ferruzzi, M.G. Quantification of vitamin D and 25-hydroxyvitamin D in soft tissues by liquid chromatography-tandem mass spectrometry. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2013, 932, 6–11. [Google Scholar] [CrossRef] [Green Version]
- Jung, Y.S.; Wu, D.; Smith, D.; Meydani, S.N.; Han, S.N. Dysregulated 1,25-dihydroxyvitamin D levels in high-fat diet-induced obesity can be restored by changing to a lower-fat diet in mice. Nutr. Res. 2018, 53, 51–60. [Google Scholar] [CrossRef]
- Park, C.Y.; Park, S.; Kim, M.S.; Kim, H.K.; Han, S.N. Effects of mild calorie restriction on lipid metabolism and inflammation in liver and adipose tissue. Biochem. Biophys. Res. Commun. 2017, 490, 636–642. [Google Scholar] [CrossRef]
- Lee, G.Y.; Park, C.Y.; Cha, K.S.; Lee, S.E.; Pae, M.; Han, S.N. Differential effect of dietary vitamin D supplementation on natural killer cell activity in lean and obese mice. J. Nutr. Biochem. 2018, 55, 178–184. [Google Scholar] [CrossRef]
- Li, M.; Song, L.; Gao, X.; Chang, W.; Qin, X. Toll-like receptor 4 on islet beta cells senses expression changes in high-mobility group box 1 and contributes to the initiation of type 1 diabetes. Exp. Mol. Med. 2012, 44, 260–267. [Google Scholar] [CrossRef]
- Dias, J.D.; Rito, T.; Torlai Triglia, E.; Kukalev, A.; Ferrai, C.; Chotalia, M.; Brookes, E.; Kimura, H.; Pombo, A. Methylation of RNA polymerase II non-consensus Lysine residues marks early transcription in mammalian cells. eLife 2015, 4. [Google Scholar] [CrossRef] [PubMed]
- Castoldi, A.; Naffah de Souza, C.; Câmara, N.O.; Moraes-Vieira, P.M. The Macrophage Switch in Obesity Development. Front. Immunol. 2015, 6, 637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, B.C.; Kim, M.S.; Pae, M.; Yamamoto, Y.; Eberle, D.; Shimada, T.; Kamei, N.; Park, H.S.; Sasorith, S.; Woo, J.R.; et al. Adipose Natural Killer Cells Regulate Adipose Tissue Macrophages to Promote Insulin Resistance in Obesity. Cell Metab. 2016, 23, 685–698. [Google Scholar] [CrossRef]
- Makki, K.; Froguel, P.; Wolowczuk, I. Adipose tissue in obesity-related inflammation and insulin resistance: Cells, cytokines, and chemokines. ISRN Inflamm. 2013, 2013, 139239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trayhurn, P.; Wood, I.S. Adipokines: Inflammation and the pleiotropic role of white adipose tissue. Br. J. Nutr. 2004, 92, 347–355. [Google Scholar] [CrossRef] [Green Version]
- Gao, D.; Madi, M.; Ding, C.; Fok, M.; Steele, T.; Ford, C.; Hunter, L.; Bing, C. Interleukin-1β mediates macrophage-induced impairment of insulin signaling in human primary adipocytes. Am. J. Physiol. Endocrinol. Metab. 2014, 307, E289–E304. [Google Scholar] [CrossRef]
- Febbraio, M.A. Role of interleukins in obesity: Implications for metabolic disease. Trends Endocrinol. Metab. TEM 2014, 25, 312–319. [Google Scholar] [CrossRef] [PubMed]
- Satoh, T.; Otsuka, A.; Contassot, E.; French, L.E. The inflammasome and IL-1beta: Implications for the treatment of inflammatory diseases. Immunotherapy 2015, 7, 243–254. [Google Scholar] [CrossRef] [PubMed]
- Fain, J.N. Release of inflammatory mediators by human adipose tissue is enhanced in obesity and primarily by the nonfat cells: A review. Mediat. Inflamm. 2010, 2010, 513948. [Google Scholar] [CrossRef] [Green Version]
- Marcotorchino, J.; Tourniaire, F.; Astier, J.; Karkeni, E.; Canault, M.; Amiot, M.J.; Bendahan, D.; Bernard, M.; Martin, J.C.; Giannesini, B.; et al. Vitamin D protects against diet-induced obesity by enhancing fatty acid oxidation. J. Nutr. Biochem. 2014, 25, 1077–1083. [Google Scholar] [CrossRef]
- Zhang, X.L.; Guo, Y.F.; Song, Z.X.; Zhou, M. Vitamin D prevents podocyte injury via regulation of macrophage M1/M2 phenotype in diabetic nephropathy rats. Endocrinology 2014, 155, 4939–4950. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Morris, K.L.; Zemel, M.B. Role of calcitriol and cortisol on human adipocyte proliferation and oxidative and inflammatory stress: A microarray study. J. Nutr. 2008, 1, 30–48. [Google Scholar] [CrossRef]
- Caer, C.; Rouault, C.; Le Roy, T.; Poitou, C.; Aron-Wisnewsky, J.; Torcivia, A.; Bichet, J.C.; Clement, K.; Guerre-Millo, M.; Andre, S. Immune cell-derived cytokines contribute to obesity-related inflammation, fibrogenesis and metabolic deregulation in human adipose tissue. Sci. Rep. 2017, 7, 3000. [Google Scholar] [CrossRef]
- Sorisky, A.; Molgat, A.S.; Gagnon, A. Macrophage-induced adipose tissue dysfunction and the preadipocyte: Should I stay (and differentiate) or should I go? Adv. Nutr. (Bethesda, Md.) 2013, 4, 67–75. [Google Scholar] [CrossRef] [Green Version]
- Caricilli, A.M.; Nascimento, P.H.; Pauli, J.R.; Tsukumo, D.M.; Velloso, L.A.; Carvalheira, J.B.; Saad, M.J. Inhibition of toll-like receptor 2 expression improves insulin sensitivity and signaling in muscle and white adipose tissue of mice fed a high-fat diet. J. Endocrinol. 2008, 199, 399–406. [Google Scholar] [CrossRef] [Green Version]
- Gupta, S.C.; Sundaram, C.; Reuter, S.; Aggarwal, B.B. Inhibiting NF-κB activation by small molecules as a therapeutic strategy. Biochim. Biophys. 2010, 1799, 775–787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Owens, D.M.; Keyse, S.M. Differential regulation of MAP kinase signalling by dual-specificity protein phosphatases. Oncogene 2007, 26, 3203–3213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cohen-Lahav, M.; Shany, S.; Tobvin, D.; Chaimovitz, C.; Douvdevani, A. Vitamin D decreases NFkappaB activity by increasing IkappaBalpha levels. Nephrology, dialysis, transplantation: Official publication of the European Dialysis and Transplant Association. Eur. Ren. Assoc. 2006, 21, 889–897. [Google Scholar] [CrossRef] [Green Version]
CON (10% kcal fat) | HFD (45% kcal fat) | |||
---|---|---|---|---|
DC (1000 IU/kg of diet) | 25DS (25,000 IU/kg of diet) | DC (1000 IU/kg of diet) | 25DS (25,000 IU/kg of diet) | |
Casein (g) | 200 | 200 | 200 | 200 |
L-Cystine (g) | 3 | 3 | 3 | 3 |
Sucrose (g) | 350 | 350 | 172.8 | 172.8 |
Cornstarch (g) | 315 | 315 | 72.8 | 72.8 |
Dyetrose (g) | 35 | 35 | 100 | 100 |
Soybean Oil (g) | 45 | 45 | 45 | 45 |
t-BHQ (g) | 0.009 | 0.009 | 0.009 | 0.009 |
Lard (g) | - | - | 157.5 | 157.5 |
Cellulose (g) | 50 | 50 | 50 | 50 |
Mineral Mix (g) 2 | 35 | 35 | 35 | 35 |
Vitamin Mix (g) (No vit D) | - | 10 | - | 10 |
Vitamin Mix (g) 3 | 10 | - | 10 | - |
Vitamin D3 (400,000 IU/g) | - | 0.0625 | - | 0.0625 |
Choline Bitartrate (g) | 2 | 2 | 2 | 2 |
Total (g) | 1045 | 1045 | 848.1 | 848.2 |
kcal/g diet | 3.69 | 3.69 | 4.64 | 4.64 |
Cell | Antibodies | Company, Cat# | Clone |
---|---|---|---|
Macrophage | Percp-CD45 | BD bioscience, 557235 | 30-F11 |
FITC-CD11c | BD bioscience, 557400 | HL3 | |
PE-F4/80 | BD bioscience, 565410 | T45–2342 | |
APC-CD11b | BD bioscience, 553312 | M1/70 | |
CD4 + _T cell | Percp-CD45 | BD bioscience, 557235 | 30-F11 |
APC-CD4 | BD bioscience, 561091 | RM4–5 | |
CD8 + _T cell | Percp-CD45 | BD bioscience, 557235 | 30-F11 |
PE-CD8a | BD bioscience, 553033 | 53–6.7 | |
B cell | Percp-CD45 | BD bioscience, 557235 | 30-F11 |
FITC-CD3 | BD bioscience, 561798 | 17A2 | |
PE-CD19 | BD bioscience, 553786 | 1D3 | |
NK cell | Percp-CD45 | BD bioscience, 557235 | 30-F11 |
FITC-CD3 | BD bioscience, 561798 | 17A2 | |
PE-NK1.1 | BD bioscience, 553165 | PK136 | |
APC-CD11b | BD bioscience, 553312 | M1/70 |
Gene 1 | Forward Primer | Reverse Primer | Ref.2 |
---|---|---|---|
Cyp27b1 | GACGATGTTGGCTGTCTTCC | ATCTCTTCCCTTCGGCTTTG | [33] |
Vdr | ATGTCCAGTGAGGGGGTGTA- | TGTCTGAGGAGCAACAGCAC | [33] |
Mcp1(Ccl2) | AGGCATCACAGTCCGAGTCAC | CCTTTTCCACAACCACCTCAAG | [34] |
Rantes(Ccl5) | CTTGAACCCACTTCTTCTCTGG | TGCTGCTTTGCCTACCTCTC | [35] |
Mip-1γ(Ccl9) | TGGGTGTTATGTAGTCAAAGGAG | GAGGAAGGAGAGGGCAGTATG | - |
Il-6 | CATTTCCACGATTTCCCAGAGA | TCCATCCAGTTGCCTTCTTGGG | [34] |
Il-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT | [34] |
Tnf-α | CTGGAAAGGTCTGAAGGTAGGAAGG | AACACAAGATGCTGGGACAGTGA | [34] |
Ifn- γ | TGGACCTGTGGGTTGTTGAC | GAACTGGCAAAAGGATGGTG | [35] |
Tlr2 | CTTCATCTACGGGCAGTGGT | TTTGCTGGGCTGACTTCTCT | - |
Tlr4 | TTTCACCTCTGCCTTCACTACA | GGGACTTCTCAACCTTCTCAA | [36] |
Dusp1 | CGGTGAAGCCAGATTAGGAG | AGCGAAGAAGGAGCGACAA | [37] |
Dusp10 | AGGAAAGAAGAGCGACAAGC | TCAAAGGCAAACGACCAAT | - |
Iκbα | CAGCATCTCCACTCCGTCCT | ACATCAGCCCCACATTTCA | - |
Gapdh | GGAGAAACCTGCCAAGTA | AAGAGTGGGAGTTGCTGTTG | [33] |
CON | HFD | p-Value | |||||
---|---|---|---|---|---|---|---|
DC (n = 8) | 25DS (n = 7) | DC (n = 7) | 25DS (n = 7) | Fat Amount | Vitamin D Content | Interaction | |
Body weight at 0 week (g) | 22.8 ± 0.4 | 23.2 ± 0.3 | 22.6 ± 0.3 | 22.8 ± 0.3 | 0.32 | 0.38 | 0.65 |
Body weight at 13 week (g) | 34.9 ± 0.5 a | 34.5 ± 1.2 a | 49.3 ± 1.3 c | 46.4 ± 0.9 b | <0.001 | 0.12 | 0.22 |
Weight gain (g) | 12.1 ± 0.8 a | 11.3 ± 1.3 a | 26.6 ± 1.3 c | 23.6 ± 1.0 b | <0.001 | 0.11 | 0.33 |
WAT weight 3 (g) | 2.70 ±0.27 a | 2.62 ±0.33 a | 5.92 ± 0.17 b | 5.68 ± 0.24 b | <0.001 | 0.55 | 0.76 |
Average food intake (g/day) | 2.90 ± 0.07 | 3.00 ± 0.05 | 3.17 ± 0.17 | 2.80 ± 0.05 | 0.73 | 0.17 | 0.02 |
CON | HFD | p-Value | |||||
---|---|---|---|---|---|---|---|
DC | 25DS | DC | 25DS | Fat Amount | Vitamin D Content | Interaction | |
Serum 25(OH)D levels (ng/mL) | 24.0 ± 2.5 a | 83.1 ± 1.6 c | 29.4 ± 1.7 a | 66.7 ± 3.7 b | 0.04 | <0.001 | <0.001 |
Adipose 25(OH)D levels (ng/g tissue) | 3.4 ± 0.4 a | 18.1 ± 2.2 b | 8.0 ± 1.5 a | 19.5 ± 2.1 b | 0.09 | <0.001 | 0.36 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, C.Y.; Kim, T.Y.; Yoo, J.S.; Seo, Y.; Pae, M.; Han, S.N. Effects of 1,25-Dihydroxyvitamin D3 on the Inflammatory Responses of Stromal Vascular Cells and Adipocytes from Lean and Obese Mice. Nutrients 2020, 12, 364. https://doi.org/10.3390/nu12020364
Park CY, Kim TY, Yoo JS, Seo Y, Pae M, Han SN. Effects of 1,25-Dihydroxyvitamin D3 on the Inflammatory Responses of Stromal Vascular Cells and Adipocytes from Lean and Obese Mice. Nutrients. 2020; 12(2):364. https://doi.org/10.3390/nu12020364
Chicago/Turabian StylePark, Chan Yoon, Tae Yeon Kim, Ji Su Yoo, Yeonkyung Seo, Munkyong Pae, and Sung Nim Han. 2020. "Effects of 1,25-Dihydroxyvitamin D3 on the Inflammatory Responses of Stromal Vascular Cells and Adipocytes from Lean and Obese Mice" Nutrients 12, no. 2: 364. https://doi.org/10.3390/nu12020364