Elevated Glucose and Insulin Levels Decrease DHA Transfer across Human Trophoblasts via SIRT1-Dependent Mechanism
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primary Human Trophoblast Culture
2.2. Transport of DHA across Trophoblasts
2.3. Quantification of Triglycerides
2.4. Quantitative Real-Time PCR (qRT-PCR)
2.5. Western Blotting
2.6. Data Analysis
3. Results
3.1. Effect of GDM Conditions on the Expression of IR-Related Genes in Trophoblasts
3.2. Effect of GDM Conditions on DHA Transport across Trophoblasts
3.3. Intracellular Triglyceride Levels
3.4. Expression of Fatty Acid Transport Genes in Trophoblasts
3.5. Effect of GDM Conditions on SIRT1 Expression
3.6. Effect of SIRT1 Expression on DHA Transport
3.7. Effect of SIRT1 on DHA Transport in GDM Conditions
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Summary of Revisions: Standards of Medical Care in Diabetes-2020. Diabetes Care 2020, 43, S4–S6. [CrossRef] [Green Version]
- Buchanan, T.A.; Xiang, A.; Kjos, S.L.; Watanabe, R. What is gestational diabetes? Diabetes Care 2007, 30 (Suppl. 2), S105–S111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herrera, E.; Ortega-Senovilla, H. Disturbances in lipid metabolism in diabetic pregnancy—Are these the cause of the problem? Best Pract. Res. Clin. Endocrinol. Metab. 2010, 24, 515–525. [Google Scholar] [CrossRef] [PubMed]
- Kawasaki, M.; Arata, N.; Ogawa, Y. Obesity and abnormal glucose tolerance in the offspring of mothers with diabetes. Curr. Opin. Obstet. Gynecol. 2018, 30, 361–368. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.; Newton, K.M.; Knopp, R.H. Gestational diabetes and the incidence of type 2 diabetes: A systematic review. Diabetes Care 2002, 25, 1862–1868. [Google Scholar] [CrossRef] [Green Version]
- Dabelea, D.; Hanson, R.L.; Lindsay, R.S.; Pettitt, D.J.; Imperatore, G.; Gabir, M.M.; Roumain, J.; Bennett, P.H.; Knowler, W.C. Intrauterine exposure to diabetes conveys risks for type 2 diabetes and obesity: A study of discordant sibships. Diabetes 2000, 49, 2208–2211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rizzo, T.; Metzger, B.E.; Burns, W.J.; Burns, K. Correlations between antepartum maternal metabolism and intelligence of offspring. N. Engl. J. Med. 1991, 325, 911–916. [Google Scholar] [CrossRef] [PubMed]
- Sousa, R.A.L.; Torres, Y.S.; Figueiredo, C.P.; Passos, G.F.; Clarke, J.R. Consequences of gestational diabetes to the brain and behavior of the offspring. An. Acad. Bras. Cienc. 2018, 90, 2279–2291. [Google Scholar] [CrossRef] [Green Version]
- Innis, S.M. Dietary (n-3) fatty acids and brain development. J. Nutr. 2007, 137, 855–859. [Google Scholar] [CrossRef] [Green Version]
- Kawakita, E.; Hashimoto, M.; Shido, O. Docosahexaenoic acid promotes neurogenesis in vitro and in vivo. Neuroscience 2006, 139, 991–997. [Google Scholar] [CrossRef]
- Devarshi, P.P.; Grant, R.W.; Ikonte, C.J.; Hazels Mitmesser, S. Maternal Omega-3 Nutrition, Placental Transfer and Fetal Brain Development in Gestational Diabetes and Preeclampsia. Nutrients 2019, 11, 1107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Judge, M.P.; Casavant, S.G.; Dias, J.A.; McGrath, J.M. Reduced DHA transfer in diabetic pregnancies: Mechanistic basis and long-term neurodevelopmental implications. Nutr. Rev. 2016, 74, 411–420. [Google Scholar] [CrossRef] [PubMed]
- Gil-Sanchez, A.; Demmelmair, H.; Parrilla, J.J.; Koletzko, B.; Larque, E. Mechanisms involved in the selective transfer of long chain polyunsaturated Fatty acids to the fetus. Front. Genet. 2011, 2, 57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berghaus, T.M.; Demmelmair, H.; Koletzko, B. Essential fatty acids and their long-chain polyunsaturated metabolites in maternal and cord plasma triglycerides during late gestation. Neonatology 2000, 77, 96–100. [Google Scholar] [CrossRef] [Green Version]
- Prieto-Sanchez, M.T.; Ruiz-Palacios, M.; Blanco-Carnero, J.E.; Pagan, A.; Hellmuth, C.; Uhl, O.; Peissner, W.; Ruiz-Alcaraz, A.J.; Parrilla, J.J.; Koletzko, B.; et al. Placental MFSD2a transporter is related to decreased DHA in cord blood of women with treated gestational diabetes. Clin. Nutr. 2017, 36, 513–521. [Google Scholar] [CrossRef] [PubMed]
- Zornoza-Moreno, M.; Fuentes-Hernandez, S.; Carrion, V.; Alcantara-Lopez, M.V.; Madrid, J.A.; Lopez-Soler, C.; Sanchez-Solis, M.; Larque, E. Is low docosahexaenoic acid associated with disturbed rhythms and neurodevelopment in offsprings of diabetic mothers? Eur. J. Clin. Nutr. 2014, 68, 931–937. [Google Scholar] [CrossRef]
- Yee, J.K.; Mao, C.S.; Ross, M.G.; Lee, W.N.; Desai, M.; Toda, A.; Kjos, S.L.; Hicks, R.A.; Patterson, M.E. High oleic/stearic fatty-acid desaturation index in cord plasma from infants of mothers with gestational diabetes. J. Perinatol. 2014, 34, 357–363. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.P.; Levy, E.; Fraser, W.D.; Julien, P.; Delvin, E.; Montoudis, A.; Spahis, S.; Garofalo, C.; Nuyt, A.M.; Luo, Z.C. Circulating docosahexaenoic acid levels are associated with fetal insulin sensitivity. PLoS ONE 2014, 9, e85054. [Google Scholar] [CrossRef] [Green Version]
- Ortega-Senovilla, H.; Schaefer-Graf, U.; Meitzner, K.; Abou-Dakn, M.; Graf, K.; Kintscher, U.; Herrera, E. Gestational diabetes mellitus causes changes in the concentrations of adipocyte fatty acid-binding protein and other adipocytokines in cord blood. Diabetes Care 2011, 34, 2061–2066. [Google Scholar] [CrossRef] [Green Version]
- Dijck-Brouwer, D.A.; Hadders-Algra, M.; Bouwstra, H.; Decsi, T.; Boehm, G.; Martini, I.A.; Rudy Boersma, E.; Muskiet, F.A. Impaired maternal glucose homeostasis during pregnancy is associated with low status of long-chain polyunsaturated fatty acids (LCP) and essential fatty acids (EFA) in the fetus. Prostaglandins Leukot. Essent. Fatty Acids 2005, 73, 85–87. [Google Scholar] [CrossRef]
- Min, Y.; Lowy, C.; Ghebremeskel, K.; Thomas, B.; Bitsanis, D.; Crawford, M.A. Fetal erythrocyte membrane lipids modification: Preliminary observation of an early sign of compromised insulin sensitivity in offspring of gestational diabetic women. Diabet. Med. 2005, 22, 914–920. [Google Scholar] [CrossRef]
- Thomas, B.A.; Ghebremeskel, K.; Lowy, C.; Offley-Shore, B.; Crawford, M.A. Plasma fatty acids of neonates born to mothers with and without gestational diabetes. Prostaglandins Leukot. Essent. Fatty Acids 2005, 72, 335–341. [Google Scholar] [CrossRef]
- Wijendran, V.; Bendel, R.B.; Couch, S.C.; Philipson, E.H.; Cheruku, S.; Lammi-Keefe, C.J. Fetal erythrocyte phospholipid polyunsaturated fatty acids are altered in pregnancy complicated with gestational diabetes mellitus. Lipids 2000, 35, 927–931. [Google Scholar] [CrossRef] [PubMed]
- Leveille, P.; Rouxel, C.; Plourde, M. Diabetic pregnancy, maternal and fetal docosahexaenoic acid: A review of existing evidence. J. Matern. Fetal Neonatal Med. 2018, 31, 1358–1363. [Google Scholar] [CrossRef] [PubMed]
- Zhou, S.J.; Yelland, L.; McPhee, A.J.; Quinlivan, J.; Gibson, R.A.; Makrides, M. Fish-oil supplementation in pregnancy does not reduce the risk of gestational diabetes or preeclampsia. Am. J. Clin. Nutr. 2012, 95, 1378–1384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gil-Sanchez, A.; Koletzko, B.; Larque, E. Current understanding of placental fatty acid transport. Curr. Opin. Clin. Nutr. Metab. Care 2012, 15, 265–272. [Google Scholar] [CrossRef] [PubMed]
- Segura, M.T.; Demmelmair, H.; Krauss-Etschmann, S.; Nathan, P.; Dehmel, S.; Padilla, M.C.; Rueda, R.; Koletzko, B.; Campoy, C. Maternal BMI and gestational diabetes alter placental lipid transporters and fatty acid composition. Placenta 2017, 57, 144–151. [Google Scholar] [CrossRef] [PubMed]
- Houtkooper, R.H.; Pirinen, E.; Auwerx, J. Sirtuins as regulators of metabolism and healthspan. Nat. Rev. Mol. Cell Biol. 2012, 13, 225–238. [Google Scholar] [CrossRef] [Green Version]
- Yang, T.; Fu, M.; Pestell, R.; Sauve, A.A. SIRT1 and endocrine signaling. Trends Endocrinol. Metab. 2006, 17, 186–191. [Google Scholar] [CrossRef]
- Balestrieri, M.L.; Servillo, L.; Esposito, A.; D’Onofrio, N.; Giovane, A.; Casale, R.; Barbieri, M.; Paolisso, P.; Rizzo, M.R.; Paolisso, G.; et al. Poor glycaemic control in type 2 diabetes patients reduces endothelial progenitor cell number by influencing SIRT1 signalling via platelet-activating factor receptor activation. Diabetologia 2013, 56, 162–172. [Google Scholar] [CrossRef] [Green Version]
- de Kreutzenberg, S.V.; Ceolotto, G.; Papparella, I.; Bortoluzzi, A.; Semplicini, A.; Dalla Man, C.; Cobelli, C.; Fadini, G.P.; Avogaro, A. Downregulation of the longevity-associated protein sirtuin 1 in insulin resistance and metabolic syndrome: Potential biochemical mechanisms. Diabetes 2010, 59, 1006–1015. [Google Scholar] [CrossRef] [Green Version]
- Tobita, T.; Guzman-Lepe, J.; Takeishi, K.; Nakao, T.; Wang, Y.; Meng, F.; Deng, C.X.; Collin de l’Hortet, A.; Soto-Gutierrez, A. SIRT1 Disruption in Human Fetal Hepatocytes Leads to Increased Accumulation of Glucose and Lipids. PLoS ONE 2016, 11, e0149344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, T.; Liu, Y.H.; Fu, Y.C.; Liu, X.M.; Zhou, X.H. Direct evidence of sirtuin downregulation in the liver of non-alcoholic fatty liver disease patients. Ann. Clin. Lab. Sci. 2014, 44, 410–418. [Google Scholar] [PubMed]
- Pfluger, P.T.; Herranz, D.; Velasco-Miguel, S.; Serrano, M.; Tschop, M.H. Sirt1 protects against high-fat diet-induced metabolic damage. Proc. Natl. Acad. Sci. USA 2008, 105, 9793–9798. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lappas, M.; Mitton, A.; Lim, R.; Barker, G.; Riley, C.; Permezel, M. SIRT1 is a novel regulator of key pathways of human labor. Biol. Reprod. 2011, 84, 167–178. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.H.; Sengupta, K.; Li, C.; Kim, H.S.; Cao, L.; Xiao, C.; Kim, S.; Xu, X.; Zheng, Y.; Chilton, B.; et al. Impaired DNA damage response, genome instability, and tumorigenesis in SIRT1 mutant mice. Cancer Cell 2008, 14, 312–323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, H.L.; Mostoslavsky, R.; Saito, S.; Manis, J.P.; Gu, Y.; Patel, P.; Bronson, R.; Appella, E.; Alt, F.W.; Chua, K.F. Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1)-deficient mice. Proc. Natl. Acad. Sci. USA 2003, 100, 10794–10799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McBurney, M.W.; Yang, X.; Jardine, K.; Hixon, M.; Boekelheide, K.; Webb, J.R.; Lansdorp, P.M.; Lemieux, M. The mammalian SIR2alpha protein has a role in embryogenesis and gametogenesis. Mol. Cell. Biol. 2003, 23, 38–54. [Google Scholar] [CrossRef] [Green Version]
- Kallol, S.; Huang, X.; Muller, S.; Ontsouka, C.E.; Albrecht, C. Novel Insights into Concepts and Directionality of Maternal(-)Fetal Cholesterol Transfer across the Human Placenta. Int. J. Mol. Sci. 2018, 19, 2334. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Luthi, M.; Ontsouka, E.C.; Kallol, S.; Baumann, M.U.; Surbek, D.V.; Albrecht, C. Establishment of a confluent monolayer model with human primary trophoblast cells: Novel insights into placental glucose transport. Mol. Hum. Reprod. 2016, 22, 442–456. [Google Scholar] [CrossRef] [Green Version]
- Li, G.; Lin, L.; Wang, Y.L.; Yang, H. 1,25(OH)2D3 Protects Trophoblasts Against Insulin Resistance and Inflammation Via Suppressing mTOR Signaling. Reprod. Sci. 2019, 26, 223–232. [Google Scholar] [CrossRef] [PubMed]
- Qiao, L.; Lee, B.; Kinney, B.; Yoo, H.S.; Shao, J. Energy intake and adiponectin gene expression. Am. J. Physiol. Endocrinol. Metab. 2011, 300, E809–E816. [Google Scholar] [CrossRef] [PubMed]
- Picard, F.; Kurtev, M.; Chung, N.; Topark-Ngarm, A.; Senawong, T.; De Oliveira, R.M.; Leid, M.; McBurney, M.W.; Guarente, L. Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-gamma. Nature 2004, 429, 771–776. [Google Scholar] [CrossRef] [PubMed]
- Catalano, P.M. Trying to understand gestational diabetes. Diabet. Med. 2014, 31, 273–281. [Google Scholar] [CrossRef]
- Powe, C.E. Early Pregnancy Biochemical Predictors of Gestational Diabetes Mellitus. Curr. Diabetes Rep. 2017, 17, 12. [Google Scholar] [CrossRef]
- Ruiz-Palacios, M.; Ruiz-Alcaraz, A.J.; Sanchez-Campillo, M.; Larque, E. Role of Insulin in Placental Transport of Nutrients in Gestational Diabetes Mellitus. Ann. Nutr. Metab. 2017, 70, 16–25. [Google Scholar] [CrossRef]
- Lassance, L.; Miedl, H.; Absenger, M.; Diaz-Perez, F.; Lang, U.; Desoye, G.; Hiden, U. Hyperinsulinemia stimulates angiogenesis of human fetoplacental endothelial cells: A possible role of insulin in placental hypervascularization in diabetes mellitus. J. Clin. Endocrinol. Metab. 2013, 98, E1438–E1447. [Google Scholar] [CrossRef] [Green Version]
- Hiden, U.; Maier, A.; Bilban, M.; Ghaffari-Tabrizi, N.; Wadsack, C.; Lang, I.; Dohr, G.; Desoye, G. Insulin control of placental gene expression shifts from mother to foetus over the course of pregnancy. Diabetologia 2006, 49, 123–131. [Google Scholar] [CrossRef] [Green Version]
- Xu, S.; Jay, A.; Brunaldi, K.; Huang, N.; Hamilton, J.A. CD36 enhances fatty acid uptake by increasing the rate of intracellular esterification but not transport across the plasma membrane. Biochemistry 2013, 52, 7254–7261. [Google Scholar] [CrossRef]
- Visiedo, F.; Bugatto, F.; Sanchez, V.; Cozar-Castellano, I.; Bartha, J.L.; Perdomo, G. High glucose levels reduce fatty acid oxidation and increase triglyceride accumulation in human placenta. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E205–E212. [Google Scholar] [CrossRef] [Green Version]
- Bitsanis, D.; Ghebremeskel, K.; Moodley, T.; Crawford, M.A.; Djahanbakhch, O. Gestational diabetes mellitus enhances arachidonic and docosahexaenoic acids in placental phospholipids. Lipids 2006, 41, 341–346. [Google Scholar] [CrossRef] [PubMed]
- Islam, A.; Kagawa, Y.; Sharifi, K.; Ebrahimi, M.; Miyazaki, H.; Yasumoto, Y.; Kawamura, S.; Yamamoto, Y.; Sakaguti, S.; Sawada, T.; et al. Fatty Acid Binding Protein 3 is Involved in n-3 and n-6 PUFA transport in mouse trophoblasts. J. Nutr. 2014, 144, 1509–1516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Makkar, A.; Mishima, T.; Chang, G.; Scifres, C.; Sadovsky, Y. Fatty acid binding protein-4 is expressed in the mouse placental labyrinth, yet is dispensable for placental triglyceride accumulation and fetal growth. Placenta 2014, 35, 802–807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haggarty, P. Placental regulation of fatty acid delivery and its effect on fetal growth—A review. Placenta 2002, 23 (Suppl. A), S28–S38. [Google Scholar] [CrossRef]
- Furuhashi, M.; Fuseya, T.; Murata, M.; Hoshina, K.; Ishimura, S.; Mita, T.; Watanabe, Y.; Omori, A.; Matsumoto, M.; Sugaya, T.; et al. Local Production of Fatty Acid-Binding Protein 4 in Epicardial/Perivascular Fat and Macrophages Is Linked to Coronary Atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2016, 36, 825–834. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Storch, J.; McDermott, L. Structural and functional analysis of fatty acid-binding proteins. J. Lipid Res. 2009, 50 (Suppl.), S126–S131. [Google Scholar] [CrossRef] [Green Version]
- Scifres, C.M.; Chen, B.; Nelson, D.M.; Sadovsky, Y. Fatty acid binding protein 4 regulates intracellular lipid accumulation in human trophoblasts. J. Clin. Endocrinol. Metab. 2011, 96, E1083–E1091. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.; Ma, S.; Zhang, H.; Yang, X.; Lu, G.J.; Zhang, H.; He, Y.; Kong, F.; Yang, A.; Xu, H.; et al. FABP4-mediated homocysteine-induced cholesterol accumulation in THP-1 monocyte-derived macrophages and the potential epigenetic mechanism. Mol. Med. Rep. 2016, 14, 969–976. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez-Calvo, R.; Girona, J.; Rodriguez, M.; Samino, S.; Barroso, E.; de Gonzalo-Calvo, D.; Guaita-Esteruelas, S.; Heras, M.; van der Meer, R.W.; Lamb, H.J.; et al. Fatty acid binding protein 4 (FABP4) as a potential biomarker reflecting myocardial lipid storage in type 2 diabetes. Metabolism 2019, 96, 12–21. [Google Scholar] [CrossRef]
- Furuhashi, M. Fatty Acid-Binding Protein 4 in Cardiovascular and Metabolic Diseases. J. Atheroscler. Thromb. 2019, 26, 216–232. [Google Scholar] [CrossRef] [Green Version]
- Jadoon, A.; Cunningham, P.; McDermott, L.C. Regulation of fatty acid binding proteins by hypoxia inducible factors 1alpha and 2alpha in the placenta: Relevance to pre-eclampsia. Prostaglandins Leukot. Essent. Fatty Acids 2015, 93, 25–29. [Google Scholar] [CrossRef] [PubMed]
- Li, H.P.; Chen, X.; Li, M.Q. Gestational diabetes induces chronic hypoxia stress and excessive inflammatory response in murine placenta. Int. J. Clin. Exp. Pathol. 2013, 6, 650–659. [Google Scholar] [PubMed]
- Meyer, B.; Calvert, D.; Moses, R. Free fatty acids and gestational diabetes mellitus. Aust. N. Z. J. Obstet. Gynaecol. 1996, 36, 255–257. [Google Scholar] [CrossRef] [PubMed]
- Ning, H.; Tao, H.; Weng, Z.; Zhao, X. Plasma fatty acid-binding protein 4 (FABP4) as a novel biomarker to predict gestational diabetes mellitus. Acta Diabetol. 2016, 53, 891–898. [Google Scholar] [CrossRef] [PubMed]
- Diaz, P.; Dimasuay, K.G.; Koele-Schmidt, L.; Jang, B.; Barbour, L.A.; Jansson, T.; Powell, T.L. Glyburide treatment in gestational diabetes is associated with increased placental glucose transporter 1 expression and higher birth weight. Placenta 2017, 57, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Jawerbaum, A.; Gonzalez, E. Diabetic pregnancies: The challenge of developing in a pro-inflammatory environment. Curr. Med. Chem. 2006, 13, 2127–2138. [Google Scholar] [CrossRef]
- Qiao, L.; Guo, Z.; Bosco, C.; Guidotti, S.; Wang, Y.; Wang, M.; Parast, M.; Schaack, J.; Hay, W.W., Jr.; Moore, T.R.; et al. Maternal High-Fat Feeding Increases Placental Lipoprotein Lipase Activity by Reducing SIRT1 Expression in Mice. Diabetes 2015, 64, 3111–3120. [Google Scholar] [CrossRef] [Green Version]
- Chen, D.; Bruno, J.; Easlon, E.; Lin, S.J.; Cheng, H.L.; Alt, F.W.; Guarente, L. Tissue-specific regulation of SIRT1 by calorie restriction. Genes Dev. 2008, 22, 1753–1757. [Google Scholar] [CrossRef] [Green Version]
- Jia, Y.; Zheng, Z.; Wang, Y.; Zhou, Q.; Cai, W.; Jia, W.; Yang, L.; Dong, M.; Zhu, X.; Su, L.; et al. SIRT1 is a regulator in high glucose-induced inflammatory response in RAW264.7 cells. PLoS ONE 2015, 10, e0120849. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
IRS-1 | TGGGGACTACAAGGTAGGGG | ATGCCACCTGGCTGAATGAA |
IGF-1 | AGAGCCTGCGCAATGGAATA | GAGATGCGAGGAGGACATGG |
IGF-2 | ACACCCTCCAGTTCGTCTGT | GGGGTATCTTGGGGAAGTTGT |
Leptin | GCTGGAGAAGCTCACCCAAT | CAAAGTGCAAGCAGGGTTCC |
FAT/CD36 | TTGGAGACCTGCTTATCCAGAAGACAATT | AAACTGTCTGTAAACTTCTGTGCCTGTTTTAAC |
FAT/P1 | TGTCTCATCTATGGGCTGACAGTCG | GTACTGAACCACCGTGCAGTTGTACT |
FAT/P2 | CGTCACTGTCATTCAGTATATCGGTGAAC | ATTTCCCAGTGCCAGTCTCACTTTATGA |
FAT/P4 | TCTTTGGCAGCGAAATGGCCTCAG | AGAGCAGAAGAGGCTGAGCGA |
FAT/P6 | TGGAGAACTTTGTCGCTACCTTTGCAAA | CACTCCGTATGCCATTTCCAATTGCC |
FABP3 | TGAGACAACAGCAGATGACAGGAAGG | ATCAATTAGCTCCCGCACAAGTGTG |
FABP4 | GGTACCTGGAAACTTGTCTCCAGTGA | TCACATCCCCATTCACACTGATGATCATG |
SIRT1 | TCTTCCCTCAAAGTAAGACCAGTAGCACTA | CTACATCAAAATGCAGATGAGGCAAAGGT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mishra, J.S.; Zhao, H.; Hattis, S.; Kumar, S. Elevated Glucose and Insulin Levels Decrease DHA Transfer across Human Trophoblasts via SIRT1-Dependent Mechanism. Nutrients 2020, 12, 1271. https://doi.org/10.3390/nu12051271
Mishra JS, Zhao H, Hattis S, Kumar S. Elevated Glucose and Insulin Levels Decrease DHA Transfer across Human Trophoblasts via SIRT1-Dependent Mechanism. Nutrients. 2020; 12(5):1271. https://doi.org/10.3390/nu12051271
Chicago/Turabian StyleMishra, Jay S., Hanjie Zhao, Sari Hattis, and Sathish Kumar. 2020. "Elevated Glucose and Insulin Levels Decrease DHA Transfer across Human Trophoblasts via SIRT1-Dependent Mechanism" Nutrients 12, no. 5: 1271. https://doi.org/10.3390/nu12051271