Blueberry Counteracts BV-2 Microglia Morphological and Functional Switch after LPS Challenge
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Chemicals
2.2. Preparation of Blueberry Extract and LC-HR-MSn Analysis
2.3. Cell Culture and Treatment
2.4. Cell Viability Assays
2.5. Immunofluorescence Microscopy
2.6. Migration Assays
2.7. Pull Down Assay for Activated Rho GTPases
2.8. Real-Time Quantitative PRC Analysis
2.9. Statistical Analysis
3. Results
3.1. Major Compounds of BB Extract
3.2. Influence of BB Extract on BV-2 Cell Viability
3.3. BB Extract and Cell Morphology Changes
3.4. Effect of BB Extract on Cellular Migration
3.5. BB Extract Modulated Rho GTPases Activity
3.6. BB Extract Influenced Microglia M1/M2 Polarization Markers
3.7. BB Extract Prevented Pro-Inflammatory Cytokines Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Vauzour, D.; Rodriguez-Mateos, A.; Corona, G.; Oruna-Concha, M.J.; Spencer, J.P. Polyphenols and human health: Prevention of disease and mechanisms of action. Nutrients 2010, 2, 1106–1131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva, S.; Costa, E.M.; Veiga, M.; Morais, R.M.; Calhau, C.; Pintado, M. Health promoting properties of blueberries: A review. Crit. Rev. Food Sci. Nutr. 2020, 60, 181–200. [Google Scholar] [CrossRef] [PubMed]
- Figueira, I.; Menezes, R.; Macedo, D.; Costa, I.; Dos Santos, C.N. Polyphenols beyond barriers: A glimpse into the brain. Curr. Neuropharmacol. 2017, 15, 562–594. [Google Scholar] [CrossRef] [Green Version]
- Del Rio, D.; Rodriguez-Mateos, A.; Spencer, J.P.; Tognolini, M.; Borges, G.; Crozier, A. Dietary (poly)phenolics in human health: Structures, bioavailability, and evidence of protective effects against chronic diseases. Antioxid. Redox Signal. 2013, 18, 1818–1892. [Google Scholar] [CrossRef] [Green Version]
- Miller, K.; Feucht, W.; Schmid, M. Bioactive compounds of strawberry and blueberry and their potential health effects based on human intervention studies: A brief overview. Nutrients 2019, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Papandreou, M.A.; Tsachaki, M.; Efthimiopoulos, S.; Klimis-Zacas, D.; Margarity, M.; Lamari, F.N. Cell-line specific protection by berry polyphenols against hydrogen peroxide challenge and lack of effect on metabolism of amyloid precursor protein. Phytother. Res. 2012, 26, 956–963. [Google Scholar] [CrossRef]
- Routray, W.; Orsat, V. Blueberries and their anthocyanins: Factors affecting biosynthesis and properties. Compr. Rev. Food Sci. Food Saf. 2011, 10, 303–320. [Google Scholar] [CrossRef]
- Nair, A.R.; Masson, G.S.; Ebenezer, P.J.; Del Piero, F.; Francis, J. Role of TLR4 in lipopolysaccharide-induced acute kidney injury: Protection by blueberry. Free Radic. Biol. Med. 2014, 71, 16–25. [Google Scholar] [CrossRef]
- Kelly, E.; Vyas, P.; Weber, J.T. Biochemical properties and neuroprotective effects of compounds in various species of berries. Molecules 2017, 23. [Google Scholar] [CrossRef] [Green Version]
- Zafra-Stone, S.; Yasmin, T.; Bagchi, M.; Chatterjee, A.; Vinson, J.A.; Bagchi, D. Berry anthocyanins as novel antioxidants in human health and disease prevention. Mol. Nutr. Food Res. 2007, 51, 675–683. [Google Scholar] [CrossRef]
- Giacalone, M.; Di Sacco, F.; Traupe, I.; Topini, R.; Forfori, F.; Giunta, F. Antioxidant and neuroprotective properties of blueberry polyphenols: A critical review. Nutr. Neurosci. 2011, 14, 119–125. [Google Scholar] [CrossRef]
- Manganaris, G.A.; Goulas, V.; Vicente, A.R.; Terry, L.A. Berry antioxidants: Small fruits providing large benefits. J. Sci. Food Agric. 2014, 94, 825–833. [Google Scholar] [CrossRef] [Green Version]
- Smith, M.A.L.; Marley, K.A.; Seigler, D.; Singletary, K.W.; Meline, B. Bioactive properties of wild blueberry fruits. J. Food Sci. 2008, 65, 352–356. [Google Scholar] [CrossRef]
- Wu, X.; Beecher, G.R.; Holden, J.M.; Haytowitz, D.B.; Gebhardt, S.E.; Prior, R.L. Lipophilic and hydrophilic antioxidant capacities of common foods in the United States. J. Agric. Food Chem. 2004, 52, 4026–4037. [Google Scholar] [CrossRef] [PubMed]
- Kahkonen, M.P.; Heinonen, M. Antioxidant activity of anthocyanins and their aglycons. J. Agric. Food Chem. 2003, 51, 628–633. [Google Scholar] [CrossRef] [PubMed]
- Satué-Gracia, M.T.; Heinonen, M.; Franke, E.N. Anthocyanins as antioxidants on human low-density lipoprotein and lecithin−liposome systems. J. Agric. Food Chem. 1997, 45, 3362–3367. [Google Scholar] [CrossRef]
- Wang, H.; Cao, G.; Prior, R. Oxygen radical absorbing capacity of anthocyanins. J. Agric. Food Chem. 1997, 45, 304–309. [Google Scholar] [CrossRef]
- Huang, W.; Zhu, Y.; Li, C.; Sui, Z.; Min, W. Effect of blueberry anthocyanins malvidin and glycosides on the antioxidant properties in endothelial cells. Oxid. Med. Cell Longev. 2016, 2016, 1591803. [Google Scholar] [CrossRef] [Green Version]
- Lau, F.C.; Bielinski, D.F.; Joseph, J.A. Inhibitory effects of blueberry extract on the production of inflammatory mediators in lipopolysaccharide-activated BV2 microglia. J. Neurosci. Res. 2007, 85, 1010–1017. [Google Scholar] [CrossRef]
- Carey, A.N.; Fisher, D.R.; Rimando, A.M.; Gomes, S.M.; Bielinski, D.F.; Shukitt-Hale, B. Stilbenes and anthocyanins reduce stress signaling in BV-2 mouse microglia. J. Agric. Food Chem. 2013, 61, 5979–5986. [Google Scholar] [CrossRef]
- Shi, D.; Xu, M.; Ren, M.; Pan, E.; Luo, C.; Zhang, W.; Tang, Q. Immunomodulatory effect of flavonoids of blueberry (Vaccinium corymbosum L.) leaves via the NF-kappaB signal pathway in LPS-stimulated RAW 264.7 cells. J. Immunol. Res. 2017, 2017, 5476903. [Google Scholar] [CrossRef] [Green Version]
- Wu, T.; Gao, Y.; Guo, X.; Zhang, M.; Gong, L. Blackberry and blueberry anthocyanin supplementation counteract high-fat-diet-induced obesity by alleviating oxidative stress and inflammation and accelerating energy expenditure. Oxid. Med. Cell Longev. 2018, 2018, 4051232. [Google Scholar] [CrossRef] [PubMed]
- Carey, A.N.; Gildawie, K.R.; Rovnak, A.; Thangthaeng, N.; Fisher, D.R.; Shukitt-Hale, B. Blueberry supplementation attenuates microglia activation and increases neuroplasticity in mice consuming a high-fat diet. Nutr. Neurosci. 2019, 22, 253–263. [Google Scholar] [CrossRef] [PubMed]
- Xie, C.; Kang, J.; Ferguson, M.E.; Nagarajan, S.; Badger, T.M.; Wu, X. Blueberries reduce pro-inflammatory cytokine TNF-alpha and IL-6 production in mouse macrophages by inhibiting NF-kappaB activation and the MAPK pathway. Mol. Nutr. Food Res. 2011, 55, 1587–1591. [Google Scholar] [CrossRef] [PubMed]
- Rutledge, G.A.; Fisher, D.R.; Miller, M.G.; Kelly, M.E.; Bielinski, D.F.; Shukitt-Hale, B. The effects of blueberry and strawberry serum metabolites on age-related oxidative and inflammatory signaling in vitro. Food Funct. 2019, 10, 7707–7713. [Google Scholar] [CrossRef]
- Figueira, M.E.; Oliveira, M.; Direito, R.; Rocha, J.; Alves, P.; Serra, A.T.; Duarte, C.; Bronze, R.; Fernandes, A.; Brites, D.; et al. Protective effects of a blueberry extract in acute inflammation and collagen-induced arthritis in the rat. Biomed. Pharmacother. 2016, 83, 1191–1202. [Google Scholar] [CrossRef]
- Bensalem, J.; Dudonne, S.; Etchamendy, N.; Pellay, H.; Amadieu, C.; Gaudout, D.; Dubreuil, S.; Paradis, M.E.; Pomerleau, S.; Capuron, L.; et al. Polyphenols from grape and blueberry improve episodic memory in healthy elderly with lower level of memory performance: A bicentric double-blind, randomized, placebo-controlled clinical study. J. Gerontol. A Biol. Sci. Med. Sci. 2019, 74, 996–1007. [Google Scholar] [CrossRef] [PubMed]
- McNamara, R.K.; Kalt, W.; Shidler, M.D.; McDonald, J.; Summer, S.S.; Stein, A.L.; Stover, A.N.; Krikorian, R. Cognitive response to fish oil, blueberry, and combined supplementation in older adults with subjective cognitive impairment. Neurobiol. Aging 2018, 64, 147–156. [Google Scholar] [CrossRef]
- Sobolev, A.P.; Ciampa, A.; Ingallina, C.; Mannina, L.; Capitani, D.; Ernesti, I.; Maggi, E.; Businaro, R.; Del Ben, M.; Engel, P.; et al. Blueberry-based meals for obese patients with metabolic syndrome: A multidisciplinary metabolomic pilot study. Metabolites 2019, 9. [Google Scholar] [CrossRef] [Green Version]
- Nair, A.R.; Mariappan, N.; Stull, A.J.; Francis, J. Blueberry supplementation attenuates oxidative stress within monocytes and modulates immune cell levels in adults with metabolic syndrome: A randomized, double-blind, placebo-controlled trial. Food Funct. 2017, 8, 4118–4128. [Google Scholar] [CrossRef] [PubMed]
- Su, X.; Zhang, J.; Wang, H.; Xu, J.; He, J.; Liu, L.; Zhang, T.; Chen, R.; Kang, J. Phenolic acid profiling, antioxidant, and anti-inflammatory activities, and miRNA regulation in the polyphenols of 16 blueberry samples from China. Molecules 2017, 22. [Google Scholar] [CrossRef] [PubMed]
- Grace, M.H.; Xiong, J.; Esposito, D.; Ehlenfeldt, M.; Lila, M.A. Simultaneous LC-MS quantification of anthocyanins and non-anthocyanin phenolics from blueberries with widely divergent profiles and biological activities. Food Chem. 2019, 277, 336–346. [Google Scholar] [CrossRef] [PubMed]
- Ruifeng, G.; Yunhe, F.; Zhengkai, W.; Ershun, Z.; Yimeng, L.; Minjun, Y.; Xiaojing, S.; Zhengtao, Y.; Naisheng, Z. Chlorogenic acid attenuates lipopolysaccharide-induced mice mastitis by suppressing TLR4-mediated NF-kappaB signaling pathway. Eur. J. Pharmacol. 2014, 729, 54–58. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.; Thakali, K.M.; Jensen, G.S.; Wu, X. Phenolic acids of the two major blueberry species in the US Market and their antioxidant and anti-inflammatory activities. Plant. Foods Hum. Nutr. 2015, 70, 56–62. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, A.; Biswas, S.K.; Galdiero, M.R.; Sica, A.; Locati, M. Macrophage plasticity and polarization in tissue repair and remodelling. J. Pathol. 2013, 229, 176–185. [Google Scholar] [CrossRef]
- Mecha, M.; Carrillo-Salinas, F.J.; Feliu, A.; Mestre, L.; Guaza, C. Microglia activation states and cannabinoid system: Therapeutic implications. Pharmacol. Ther. 2016, 166, 40–55. [Google Scholar] [CrossRef]
- Block, M.L.; Hong, J.S. Chronic microglial activation and progressive dopaminergic neurotoxicity. Biochem. Soc. Trans. 2007, 35, 1127–1132. [Google Scholar]
- Davalos, D.; Grutzendler, J.; Yang, G.; Kim, J.V.; Zuo, Y.; Jung, S.; Littman, D.R.; Dustin, M.L.; Gan, W.B. ATP mediates rapid microglial response to local brain injury in vivo. Nat. Neurosci. 2005, 8, 752–758. [Google Scholar] [CrossRef]
- Sieger, D.; Moritz, C.; Ziegenhals, T.; Prykhozhij, S.; Peri, F. Long-range Ca2+ waves transmit brain-damage signals to microglia. Dev. Cell 2012, 22, 1138–1148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lively, S.; Schlichter, L.C. The microglial activation state regulates migration and roles of matrix-dissolving enzymes for invasion. J. Neuroinflam. 2013, 10, 75. [Google Scholar] [CrossRef] [Green Version]
- Orihuela, R.; McPherson, C.A.; Harry, G.J. Microglial M1/M2 polarization and metabolic states. Br. J. Pharmacol. 2016, 173, 649–665. [Google Scholar] [CrossRef] [PubMed]
- Martinez, F.O.; Gordon, S. The M1 and M2 paradigm of macrophage activation: Time for reassessment. F1000Prime Rep. 2014, 6, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kabba, J.A.; Xu, Y.; Christian, H.; Ruan, W.; Chenai, K.; Xiang, Y.; Zhang, L.; Saavedra, J.M.; Pang, T. Microglia: Housekeeper of the central nervous system. Cell Mol. Neurobiol. 2018, 38, 53–71. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Clifford, M.N. Chlorogenic acids and other cinnamates-Nature, occurrence and dietary burden. J. Sci. Food Agric. 1999, 80, 1033–1043. [Google Scholar] [CrossRef]
- Sondheimer, E. On the distribution of caffeic acid and the chlorogenic acid isomers in plants. Arch. Biochem. Biophys. 1958, 74, 131–138. [Google Scholar] [CrossRef]
- Brito, A.; Ramirez, J.E.; Areche, C.; Sepulveda, B.; Simirgiotis, M.J. HPLC-UV-MS profiles of phenolic compounds and antioxidant activity of fruits from three citrus species consumed in Northern Chile. Molecules 2014, 19, 17400–17421. [Google Scholar] [CrossRef]
- Clifford, M.N.; Johnston, K.L.; Knight, S.; Kuhnert, N. Hierarchical scheme for LC-MSn identification of chlorogenic acids. J. Agric. Food Chem. 2003, 51, 2900–2911. [Google Scholar] [CrossRef]
- Simirgiotis, M.J.; Benites, J.; Areche, C.; Sepulveda, B. Antioxidant capacities and analysis of phenolic compounds in three endemic Nolana species by HPLC-PDA-ESI-MS. Molecules 2015, 20, 11490–11507. [Google Scholar] [CrossRef] [Green Version]
- Willems, J.L.; Khamis, M.M.; Mohammed Saeid, W.; Purves, R.W.; Katselis, G.; Low, N.H.; El-Aneed, A. Analysis of a series of chlorogenic acid isomers using differential ion mobility and tandem mass spectrometry. Anal. Chim. Acta 2016, 933, 164–174. [Google Scholar] [CrossRef]
- Ncube, E.N.; Mhlongo, M.I.; Piater, L.A.; Steenkamp, P.A.; Dubery, I.A.; Madala, N.E. Analyses of chlorogenic acids and related cinnamic acid derivatives from Nicotiana tabacum tissues with the aid of UPLC-QTOF-MS/MS based on the in-source collision-induced dissociation method. Chem. Cent. J. 2014, 8, 66. [Google Scholar] [CrossRef] [Green Version]
- Jaiswal, R.; Kuhnert, N. How to identify and discriminate between the methyl quinates of chlorogenic acids by liquid chromatography-tandem mass spectrometry. J. Mass Spectrom. 2011, 46, 269–281. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Yu, Q.; Cheng, H.; Ge, Y.; Liu, H.; Ye, X.; Chen, Y. Metabolomic approach for the authentication of berry fruit juice by liquid chromatography quadrupole time-of-flight mass spectrometry coupled to chemometrics. J. Agric. Food Chem. 2018, 66, 8199–8208. [Google Scholar] [CrossRef] [PubMed]
- Duan, L.; Chen, B.Y.; Sun, X.L.; Luo, Z.J.; Rao, Z.R.; Wang, J.J.; Chen, L.W. LPS-induced proNGF synthesis and release in the N9 and BV2 microglial cells: A new pathway underling microglial toxicity in neuroinflammation. PLoS ONE 2013, 8, e73768. [Google Scholar] [CrossRef] [PubMed]
- Aldskogius, H. Regulation of microglia-Potential new drug targets in the CNS. Expert Opin. Ther. Targets 2001, 5, 655–668. [Google Scholar] [CrossRef]
- Ma, L.; Sun, Z.; Zeng, Y.; Luo, M.; Yang, J. Molecular mechanism and health role of functional ingredients in blueberry for chronic disease in human beings. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef] [Green Version]
- Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-Ghazani, F.; et al. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed. Pharmacother. 2018, 97, 67–74. [Google Scholar] [CrossRef]
- Miyamae, Y.; Kurisu, M.; Han, J.; Isoda, H.; Shigemori, H. Structure-activity relationship of caffeoylquinic acids on the accelerating activity on ATP production. Chem. Pharm. Bull. (Tokyo) 2011, 59, 502–507. [Google Scholar] [CrossRef] [Green Version]
- Miyamae, Y.; Kurisu, M.; Murakami, K.; Han, J.; Isoda, H.; Irie, K.; Shigemori, H. Protective effects of caffeoylquinic acids on the aggregation and neurotoxicity of the 42-residue amyloid beta-protein. Bioorg. Med. Chem. 2012, 20, 5844–5849. [Google Scholar] [CrossRef] [PubMed]
- Mazewski, C.; Kim, M.S.; Gonzalez de Mejia, E. Anthocyanins, delphinidin-3-O-glucoside and cyanidin-3-O-glucoside, inhibit immune checkpoints in human colorectal cancer cells in vitro and in silico. Sci. Rep. 2019, 9, 11560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graeber, M.B. Changing face of microglia. Science 2010, 330, 783–788. [Google Scholar] [CrossRef] [PubMed]
- Cui, S.; Wu, Q.; Wang, J.; Li, M.; Qian, J.; Li, S. Quercetin inhibits LPS-induced macrophage migration by suppressing the iNOS/FAK/paxillin pathway and modulating the cytoskeleton. Cell Adh. Migr. 2019, 13, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yorgun, M.A.; Rashid, K.; Aslanidis, A.; Bresgen, C.; Dannhausen, K.; Langmann, T. Crocin, a plant-derived carotenoid, modulates microglial reactivity. Biochem. Biophys. Rep. 2017, 12, 245–250. [Google Scholar] [CrossRef] [PubMed]
- Azios, N.G.; Dharmawardhane, S.F. Resveratrol and estradiol exert disparate effects on cell migration, cell surface actin structures, and focal adhesion assembly in MDA-MB-231 human breast cancer cells. Neoplasia 2005, 7, 128–140. [Google Scholar] [CrossRef] [Green Version]
- Scheiblich, H.; Roloff, F.; Singh, V.; Stangel, M.; Stern, M.; Bicker, G. Nitric oxide/cyclic GMP signaling regulates motility of a microglial cell line and primary microglia in vitro. Brain Res. 2014, 1564, 9–21. [Google Scholar] [CrossRef]
- Kolsch, V.; Charest, P.G.; Firtel, R.A. The regulation of cell motility and chemotaxis by phospholipid signaling. J. Cell Sci. 2008, 121, 551–559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cain, R.J.; Ridley, A.J. Phosphoinositide 3-kinases in cell migration. Biol. Cell 2009, 101, 13–29. [Google Scholar] [CrossRef]
- Guilluy, C.; Garcia-Mata, R.; Burridge, K. Rho protein crosstalk: Another social network? Trends Cell Biol. 2011, 21, 718–726. [Google Scholar] [CrossRef] [Green Version]
- Lawson, C.D.; Ridley, A.J. Rho GTPase signaling complexes in cell migration and invasion. J. Cell Biol. 2018, 217, 447–457. [Google Scholar] [CrossRef]
- De Piano, M.; Manuelli, V.; Zadra, G.; Otte, J.; Edqvist, P.D.; Ponten, F.; Nowinski, S.; Niaouris, A.; Grigoriadis, A.; Loda, M.; et al. Lipogenic signalling modulates prostate cancer cell adhesion and migration via modification of Rho GTPases. Oncogene 2020. [Google Scholar] [CrossRef] [Green Version]
- Stankiewicz, T.R.; Linseman, D.A. Rho family GTPases: Key players in neuronal development, neuronal survival, and neurodegeneration. Front. Cell Neurosci. 2014, 8, 314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ridley, A.J.; Hall, A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 1992, 70, 389–399. [Google Scholar] [CrossRef]
- Nobes, C.D.; Hall, A. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 1995, 81, 53–62. [Google Scholar] [CrossRef] [Green Version]
- Welch, H.C.; Coadwell, W.J.; Stephens, L.R.; Hawkins, P.T. Phosphoinositide 3-kinase-dependent activation of Rac. FEBS Lett. 2003, 546, 93–97. [Google Scholar] [CrossRef] [Green Version]
- Amano, M.; Nakayama, M.; Kaibuchi, K. Rho-kinase/ROCK: A key regulator of the cytoskeleton and cell polarity. Cytoskeleton (Hoboken) 2010, 67, 545–554. [Google Scholar] [CrossRef] [Green Version]
- Giri, S.; Rattan, R.; Singh, A.K.; Singh, I. The 15-deoxy-delta12,14-prostaglandin J2 inhibits the inflammatory response in primary rat astrocytes via down-regulating multiple steps in phosphatidylinositol 3-kinase-Akt-NF-kappaB-p300 pathway independent of peroxisome proliferator-activated receptor gamma. J. Immunol. 2004, 173, 5196–5208. [Google Scholar]
- Guha, M.; Mackman, N. LPS induction of gene expression in human monocytes. Cell Signal. 2001, 13, 85–94. [Google Scholar] [CrossRef]
- Ojaniemi, M.; Glumoff, V.; Harju, K.; Liljeroos, M.; Vuori, K.; Hallman, M. Phosphatidylinositol 3-kinase is involved in Toll-like receptor 4-mediated cytokine expression in mouse macrophages. Eur. J. Immunol. 2003, 33, 597–605. [Google Scholar] [CrossRef]
- Adams, L.S.; Phung, S.; Yee, N.; Seeram, N.P.; Li, L.; Chen, S. Blueberry phytochemicals inhibit growth and metastatic potential of MDA-MB-231 breast cancer cells through modulation of the phosphatidylinositol 3-kinase pathway. Cancer Res. 2010, 70, 3594–3605. [Google Scholar] [CrossRef] [Green Version]
- Bronte, V.; Zanovello, P. Regulation of immune responses by L-arginine metabolism. Nat. Rev. Immunol. 2005, 5, 641–654. [Google Scholar] [CrossRef]
- Rath, M.; Muller, I.; Kropf, P.; Closs, E.I.; Munder, M. Metabolism via arginase or nitric oxide synthase: Two competing arginine pathways in macrophages. Front. Immunol. 2014, 5, 532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sica, A.; Mantovani, A. Macrophage plasticity and polarization: In vivo veritas. J. Clin. Investig. 2012, 122, 787–795. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Smith, W.; Hao, D.; He, B.; Kong, L. M1 and M2 macrophage polarization and potentially therapeutic naturally occurring compounds. Int. Immunopharmacol. 2019, 70, 459–466. [Google Scholar] [CrossRef] [PubMed]
- Hirata, N.; Yanagawa, Y.; Ebihara, T.; Seya, T.; Uematsu, S.; Akira, S.; Hayashi, F.; Iwabuchi, K.; Onoe, K. Selective synergy in anti-inflammatory cytokine production upon cooperated signaling via TLR4 and TLR2 in murine conventional dendritic cells. Mol. Immunol. 2008, 45, 2734–2742. [Google Scholar] [CrossRef]
- Tao, M.Q.; Ji, C.L.; Wu, Y.J.; Dong, J.Y.; Li, Y.; Olatunji, O.J.; Zuo, J. 1,7-Dihydroxy-3,4-dimethoxyxanthone inhibits lipopolysaccharide-induced inflammation in RAW264.7 macrophages by suppressing TLR4/NF-kappaB signaling cascades. Inflammation 2020. [Google Scholar] [CrossRef]
- Figueira, I.; Garcia, G.; Pimpao, R.C.; Terrasso, A.P.; Costa, I.; Almeida, A.F.; Tavares, L.; Pais, T.F.; Pinto, P.; Ventura, M.R.; et al. Polyphenols journey through blood-brain barrier towards neuronal protection. Sci. Rep. 2017, 7, 11456. [Google Scholar] [CrossRef]
GENE | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
mIL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
mTNF-α | CTGAACTTCGGGGTGATCGG | GGCTTGTCACTCGAATTTTGAGA |
mIL-6 | CGGAGAGGAGACTTCACAGAGGA | TTTCCACGATTTCCCAGAGAACA |
mACT-β | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Caris, M.G.; Grieco, M.; Maggi, E.; Francioso, A.; Armeli, F.; Mosca, L.; Pinto, A.; D’Erme, M.; Mancini, P.; Businaro, R. Blueberry Counteracts BV-2 Microglia Morphological and Functional Switch after LPS Challenge. Nutrients 2020, 12, 1830. https://doi.org/10.3390/nu12061830
De Caris MG, Grieco M, Maggi E, Francioso A, Armeli F, Mosca L, Pinto A, D’Erme M, Mancini P, Businaro R. Blueberry Counteracts BV-2 Microglia Morphological and Functional Switch after LPS Challenge. Nutrients. 2020; 12(6):1830. https://doi.org/10.3390/nu12061830
Chicago/Turabian StyleDe Caris, Maria Giovanna, Maddalena Grieco, Elisa Maggi, Antonio Francioso, Federica Armeli, Luciana Mosca, Alessandro Pinto, Maria D’Erme, Patrizia Mancini, and Rita Businaro. 2020. "Blueberry Counteracts BV-2 Microglia Morphological and Functional Switch after LPS Challenge" Nutrients 12, no. 6: 1830. https://doi.org/10.3390/nu12061830