Clostridium tyrobutyricum Protects against LPS-Induced Colonic Inflammation via IL-22 Signaling in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice and Bacteria
2.2. RT–qPCR
2.3. Immunohistochemistry
2.4. Colonic Lamina Propria Cell Isolation
2.5. Flow Cytometry
2.6. Statistical Analysis
3. Results
3.1. Ct Attenuated Colonic Inflammation in Mice
3.2. Effects of Ct on Immune Cells in Mice
3.2.1. Effects of Ct on Macrophages, Mast Cells, and DCs in Mice
3.2.2. Effects of Ct on T Cells and Its Cell Subsets in Mice
3.2.3. Effects of Ct on ILC3s in Mice
3.3. Ct Protected against Colonic Inflammation and Barrier Dysfunction via IL-22
3.4. Effects of Ct on Immune Cells in Mice Knocking down IL-22
3.4.1. Effects of Ct on Macrophages, Mast Cells, and DCs in Mice Knocking down IL-22
3.4.2. Effects of Ct on T Cells, Tregs, and Th17 Cells in Mice Knocking down IL-22
3.4.3. Effects of Ct on Th1 and Th2 Cells in Mice Knocking down IL-22
3.4.4. Effects of Ct on ILCs in Mice Knocking down IL-22
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kaplan, G.G. The global burden of IBD: From 2015 to 2025. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 720–727. [Google Scholar] [CrossRef] [PubMed]
- Lloyd-Price, J.; Arze, C.; Ananthakrishnan, A.N.; Schirmer, M.; Avila-Pacheco, J.; Poon, T.W.; Andrews, E.; Ajami, N.J.; Bonham, K.S.; Brislawn, C.J.; et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 2019, 569, 655–662. [Google Scholar] [CrossRef] [PubMed]
- Albenberg, L.G.; Wu, G.D. Diet and the intestinal microbiome: Associations, functions, and implications for health and disease. Gastroenterology 2014, 146, 1564–1572. [Google Scholar] [CrossRef] [Green Version]
- Ananthakrishnan, A.N. Environmental risk factors for inflammatory bowel diseases: A review. Dig. Dis. Sci. 2015, 60, 290–298. [Google Scholar] [CrossRef] [PubMed]
- Hollister, E.B.; Gao, C.; Versalovic, J. Compositional and functional features of the gastrointestinal microbiome and their effects on human health. Gastroenterology 2014, 146, 1449–1458. [Google Scholar] [CrossRef] [Green Version]
- Clemente, J.C.; Manasson, J.; Scher, J.U. The role of the gut microbiome in systemic inflammatory disease. BMJ 2018, 360, j5145. [Google Scholar] [CrossRef]
- Xavier, R.J.; Podolsky, D.K. Unravelling the pathogenesis of inflammatory bowel disease. Nature 2007, 448, 427–434. [Google Scholar] [CrossRef]
- Shabgah, A.G.; Navashenaq, J.G.; Shabgah, O.G.; Mohammadi, H.; Sahebkar, A. Interleukin-22 in human inflammatory diseases and viral infections. Autoimmun. Rev. 2017, 16, 1209–1218. [Google Scholar] [CrossRef]
- Ouyang, W.; Rutz, S.; Crellin, N.K.; Valdez, P.A.; Hymowitz, S.G. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu. Rev. Immunol. 2011, 29, 71–109. [Google Scholar] [CrossRef]
- Dudakov, J.A.; Hanash, A.M.; van den Brink, M.R. Interleukin-22: Immunobiology and pathology. Annu. Rev. Immunol. 2015, 33, 747–785. [Google Scholar] [CrossRef] [Green Version]
- Guyonnet, D.; Schlumberger, A.; Mhamdi, L.; Jakob, S.; Chassany, O. Fermented milk containing Bifidobacterium lactis DN-173 010 improves gastrointestinal well-being and digestive symptoms in women reporting minor digestive symptoms: A randomised, double-blind, parallel, controlled study. Br. J. Nutr. 2009, 102, 1654–1662. [Google Scholar] [CrossRef]
- Fukushima, Y.; Kawata, Y.; Hara, H.; Terada, A.; Mitsuoka, T. Effect of a probiotic formula on intestinal immunoglobulin A production in healthy children. Int. J. Food Microbiol. 1998, 42, 39–44. [Google Scholar] [CrossRef]
- Panigrahi, P.; Parida, S.; Nanda, N.C.; Satpathy, R.; Pradhan, L.; Chandel, D.S.; Baccaglini, L.; Mohapatra, A.; Mohapatra, S.S.; Misra, P.R.; et al. A randomized synbiotic trial to prevent sepsis among infants in rural India. Nature 2017, 548, 407–412. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Buys, N.J. Glucose- and glycaemic factor-lowering effects of probiotics on diabetes: A meta-analysis of randomised placebo-controlled trials. Br. J. Nutr. 2016, 115, 1167–1177. [Google Scholar] [CrossRef]
- Suez, J.; Zmora, N.; Segal, E.; Elinav, E. The pros, cons, and many unknowns of probiotics. Nat. Med. 2019, 25, 716–729. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Cheng, C.; Bao, T.; Liu, L.; Wang, B.; Tao, W.; Pei, X.; Yang, S.T.; Wang, M. Production of butyric acid from acid hydrolysate of corn husk in fermentation by Clostridium tyrobutyricum: Kinetics and process economic analysis. Biotechnol. Biofuels 2018, 11, 164. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Liu, L.; Tao, W.; Pei, X.; Wang, G.; Wang, M. Clostridium Tyrobutyricum Protect Intestinal Barrier Function from LPS-Induced Apoptosis via P38/JNK Signaling Pathway in IPEC-J2 Cells. Cell Physiol. Biochem. 2018, 46, 1779–1792. [Google Scholar] [CrossRef]
- Scott, C.L.; Bain, C.C.; Mowat, A.M. Isolation and Identification of Intestinal Myeloid Cells. Methods Mol. Biol. 2017, 1559, 223–239. [Google Scholar] [CrossRef]
- Zmora, N.; Zilberman-Schapira, G.; Suez, J.; Mor, U.; Dori-Bachash, M.; Bashiardes, S.; Kotler, E.; Zur, M.; Regev-Lehavi, D.; Brik, R.B.; et al. Personalized Gut Mucosal Colonization Resistance to Empiric Probiotics Is Associated with Unique Host and Microbiome Features. Cell 2018, 174, 1388–1405.e21. [Google Scholar] [CrossRef] [Green Version]
- Suez, J.; Zmora, N.; Zilberman-Schapira, G.; Mor, U.; Dori-Bachash, M.; Bashiardes, S.; Zur, M.; Regev-Lehavi, D.; Ben-Zeev Brik, R.; Federici, S.; et al. Post-Antibiotic Gut Mucosal Microbiome Reconstitution Is Impaired by Probiotics and Improved by Autologous FMT. Cell 2018, 174, 1406–1423.e16. [Google Scholar] [CrossRef] [Green Version]
- Liu, T.; Zhu, L.; Zhu, Z.; Jiang, L. Genome Sequence Analysis of Clostridium tyrobutyricum, a Promising Microbial Host for Human Health and Industrial Applications. Curr. Microbiol. 2020, 77, 3685–3694. [Google Scholar] [CrossRef] [PubMed]
- Cornick, S.; Tawiah, A.; Chadee, K. Roles and regulation of the mucus barrier in the gut. Tissue Barriers 2015, 3, e982426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Etienne-Mesmin, L.; Chassaing, B.; Desvaux, M.; De Paepe, K.; Gresse, R.; Sauvaitre, T.; Forano, E.; de Wiele, T.V.; Schuller, S.; Juge, N.; et al. Experimental models to study intestinal microbes-mucus interactions in health and disease. FEMS Microbiol. Rev. 2019, 43, 457–489. [Google Scholar] [CrossRef] [Green Version]
- Hansson, G.C. Mucus and mucins in diseases of the intestinal and respiratory tracts. J. Intern Med. 2019, 285, 479–490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paone, P.; Cani, P.D. Mucus barrier, mucins and gut microbiota: The expected slimy partners? Gut 2020, 69, 2232–2243. [Google Scholar] [CrossRef]
- Xie, M.H.; Aggarwal, S.; Ho, W.H.; Foster, J.; Zhang, Z.; Stinson, J.; Wood, W.I.; Goddard, A.D.; Gurney, A.L. Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J. Biol. Chem. 2000, 275, 31335–31339. [Google Scholar] [CrossRef] [Green Version]
- Dumoutier, L.; Roost, E.V.; Ameye, G.; Michaux, L.; Renauld, J.-C. IL-TIF/IL-22: Genomic organization and mapping of the human and mouse genes. Genes Immun. 2000, 1, 488–494. [Google Scholar] [CrossRef] [Green Version]
- Kamanaka, M.; Huber, S.; Zenewicz, L.A.; Gagliani, N.; Rathinam, C.; O’Connor, W., Jr.; Wan, Y.Y.; Nakae, S.; Iwakura, Y.; Hao, L.; et al. Memory/effector (CD45RB(lo)) CD4 T cells are controlled directly by IL-10 and cause IL-22-dependent intestinal pathology. J. Exp. Med. 2011, 208, 1027–1040. [Google Scholar] [CrossRef]
- Brand, S.; Beigel, F.; Olszak, T.; Zitzmann, K.; Eichhorst, S.T.; Otte, J.M.; Diepolder, H.; Marquardt, A.; Jagla, W.; Popp, A.; et al. IL-22 is increased in active Crohn’s disease and promotes proinflammatory gene expression and intestinal epithelial cell migration. Am. J. Physiol. Gastrointest Liver Physiol. 2006, 290, G827–G838. [Google Scholar] [CrossRef] [Green Version]
- Wolk, K.; Witte, E.; Hoffmann, U.; Doecke, W.D.; Endesfelder, S.; Asadullah, K.; Sterry, W.; Volk, H.D.; Wittig, B.M.; Sabat, R. IL-22 induces lipopolysaccharide-binding protein in hepatocytes: A potential systemic role of IL-22 in Crohn’s disease. J. Immunol. 2007, 178, 5973–5981. [Google Scholar] [CrossRef]
- Mortha, A.; Chudnovskiy, A.; Hashimoto, D.; Bogunovic, M.; Spencer, S.P.; Belkaid, Y.; Merad, M. Microbiota-dependent crosstalk between macrophages and ILC3 promotes intestinal homeostasis. Science 2014, 343, 1249288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perez, L.G.; Kempski, J.; McGee, H.M.; Pelzcar, P.; Agalioti, T.; Giannou, A.; Konczalla, L.; Brockmann, L.; Wahib, R.; Xu, H.; et al. TGF-beta signaling in Th17 cells promotes IL-22 production and colitis-associated colon cancer. Nat. Commun. 2020, 11, 2608. [Google Scholar] [CrossRef]
- Wolk, K.; Witte, E.; Wallace, E.; Docke, W.D.; Kunz, S.; Asadullah, K.; Volk, H.D.; Sterry, W.; Sabat, R. IL-22 regulates the expression of genes responsible for antimicrobial defense, cellular differentiation, and mobility in keratinocytes: A potential role in psoriasis. Eur. J. Immunol. 2006, 36, 1309–1323. [Google Scholar] [CrossRef] [PubMed]
- Liang, S.C.; Tan, X.Y.; Luxenberg, D.P.; Karim, R.; Dunussi-Joannopoulos, K.; Collins, M.; Fouser, L.A. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J. Exp. Med. 2006, 203, 2271–2279. [Google Scholar] [CrossRef]
- Honda, K.; Littman, D.R. The microbiome in infectious disease and inflammation. Annu. Rev. Immunol. 2012, 30, 759–795. [Google Scholar] [CrossRef] [Green Version]
- Zigmond, E.; Jung, S. Intestinal macrophages: Well educated exceptions from the rule. Trends Immunol. 2013, 34, 162–168. [Google Scholar] [CrossRef]
- Steinbach, E.C.; Plevy, S.E. The role of macrophages and dendritic cells in the initiation of inflammation in IBD. Inflamm. Bowel Dis. 2014, 20, 166–175. [Google Scholar] [CrossRef] [Green Version]
- Mantovani, A.; Bonecchi, R.; Locati, M. Tuning inflammation and immunity by chemokine sequestration: Decoys and more. Nat. Rev. Immunol. 2006, 6, 907–918. [Google Scholar] [CrossRef]
- Na, Y.R.; Stakenborg, M.; Seok, S.H.; Matteoli, G. Macrophages in intestinal inflammation and resolution: A potential therapeutic target in IBD. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 531–543. [Google Scholar] [CrossRef]
- Rescigno, M.; Di Sabatino, A. Dendritic cells in intestinal homeostasis and disease. J. Clin. Investig. 2009, 119, 2441–2450. [Google Scholar] [CrossRef] [Green Version]
- Frick, J.S.; Grunebach, F.; Autenrieth, I.B. Immunomodulation by semi-mature dendritic cells: A novel role of Toll-like receptors and interleukin-6. Int. J. Med. Microbiol. 2010, 300, 19–24. [Google Scholar] [CrossRef] [PubMed]
- Rijnierse, A.; Nijkamp, F.P.; Kraneveld, A.D. Mast cells and nerves tickle in the tummy: Implications for inflammatory bowel disease and irritable bowel syndrome. Pharmacol. Ther. 2007, 116, 207–235. [Google Scholar] [CrossRef] [PubMed]
- Lyons, D.O.; Pullen, N.A. Beyond IgE: Alternative Mast Cell Activation Across Different Disease States. Int. J. Mol. Sci. 2020, 21, 1498. [Google Scholar] [CrossRef] [Green Version]
- Wechsler, J.B.; Szabo, A.; Hsu, C.L.; Krier-Burris, R.A.; Schroeder, H.A.; Wang, M.Y.; Carter, R.G.; Velez, T.E.; Aguiniga, L.M.; Brown, J.B.; et al. Histamine drives severity of innate inflammation via histamine 4 receptor in murine experimental colitis. Mucosal. Immunol. 2018, 11, 861–870. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Atarashi, K.; Tanoue, T.; Shima, T.; Imaoka, A.; Kuwahara, T.; Momose, Y.; Cheng, G.; Yamasaki, S.; Saito, T.; Ohba, Y.; et al. Induction of Colonic Regulatory T Cells by Indigenous Clostridium Species. Science 2011, 331, 337–341. [Google Scholar] [CrossRef] [Green Version]
- Atarashi, K.; Tanoue, T.; Oshima, K.; Suda, W.; Nagano, Y.; Nishikawa, H.; Fukuda, S.; Saito, T.; Narushima, S.; Hase, K.; et al. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature 2013, 500, 232–236. [Google Scholar] [CrossRef] [PubMed]
- Furusawa, Y.; Obata, Y.; Fukuda, S.; Endo, T.A.; Nakato, G.; Takahashi, D.; Nakanishi, Y.; Uetake, C.; Kato, K.; Kato, T.; et al. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature 2013, 504, 446–450. [Google Scholar] [CrossRef]
- Hayashi, A.; Sato, T.; Kamada, N.; Mikami, Y.; Matsuoka, K.; Hisamatsu, T.; Hibi, T.; Roers, A.; Yagita, H.; Ohteki, T.; et al. A single strain of Clostridium butyricum induces intestinal IL-10-producing macrophages to suppress acute experimental colitis in mice. Cell Host Microbe. 2013, 13, 711–722. [Google Scholar] [CrossRef] [Green Version]
- Kashiwagi, I.; Morita, R.; Schichita, T.; Komai, K.; Saeki, K.; Matsumoto, M.; Takeda, K.; Nomura, M.; Hayashi, A.; Kanai, T.; et al. Smad2 and Smad3 Inversely Regulate TGF-beta Autoinduction in Clostridium butyricum-Activated Dendritic Cells. Immunity 2015, 43, 65–79. [Google Scholar] [CrossRef] [Green Version]
- Zelante, T.; Iannitti, R.G.; Cunha, C.; De Luca, A.; Giovannini, G.; Pieraccini, G.; Zecchi, R.; D’Angelo, C.; Massi-Benedetti, C.; Fallarino, F.; et al. Tryptophan catabolites from microbiota engage aryl hydrocarbon receptor and balance mucosal reactivity via interleukin-22. Immunity 2013, 39, 372–385. [Google Scholar] [CrossRef] [Green Version]
- Yang, W.; Yu, T.; Huang, X.; Bilotta, A.J.; Xu, L.; Lu, Y.; Sun, J.; Pan, F.; Zhou, J.; Zhang, W.; et al. Intestinal microbiota-derived short-chain fatty acids regulation of immune cell IL-22 production and gut immunity. Nat. Commun. 2020, 11, 4457. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | AAGAAGGTGGTGAAGCAGGCATC | CGGCATCGAAGGTGGAAGAGTG |
IL-6 | ACTTCCATCCAGTTGCCTTCTTGG | TTAAGCCTCCGACTTGTGAAGTGG |
IL-1β | TCGCAGCAGCACATCAACAAGAG | TGCTCATGTCCTCATCCTGGAAGG |
IL-22 | TCCAACTTCCAGCAGCCATACATC | GCACTGATCCTTAGCACTGACTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, Z.; Liu, L.; Jin, Y.; Pei, X.; Sun, W.; Wang, M. Clostridium tyrobutyricum Protects against LPS-Induced Colonic Inflammation via IL-22 Signaling in Mice. Nutrients 2021, 13, 215. https://doi.org/10.3390/nu13010215
Xiao Z, Liu L, Jin Y, Pei X, Sun W, Wang M. Clostridium tyrobutyricum Protects against LPS-Induced Colonic Inflammation via IL-22 Signaling in Mice. Nutrients. 2021; 13(1):215. https://doi.org/10.3390/nu13010215
Chicago/Turabian StyleXiao, Zhiping, Lujie Liu, Yuyue Jin, Xun Pei, Wanjing Sun, and Minqi Wang. 2021. "Clostridium tyrobutyricum Protects against LPS-Induced Colonic Inflammation via IL-22 Signaling in Mice" Nutrients 13, no. 1: 215. https://doi.org/10.3390/nu13010215