1. Introduction
In humans, skeletal muscle represents ~40% of the body mass. Due to its ability to generate strength, muscle is required for mobility, breathing, and posture. Skeletal muscle also plays a key role as a metabolism regulator through the use of a large quantity of glucose and lipids, particularly during exercise. Many pathological (e.g., myopathies, cancer, diabetes) and non-pathological (e.g., sedentary lifestyle, bed rest, immobilization, spaceflights) conditions lead to loss of muscle mass and consequently to reduction of the functional capacities and life expectancy [
1]. Skeletal muscle atrophy may also result in sarcopenia (i.e., the loss of muscle mass, size, strength and functionality because of aging). The importance of proper muscle function in human health is supported by data demonstrating that skeletal muscle strength is inversely associated with all-cause mortality in men [
2]. Therefore, reduction of muscle loss may contribute to improve the quality of life and to attenuate chronic diseases and mortality. Currently, exercise and nutritional approaches based on supplementation of essential amino acids or their metabolites (e.g., β-hydroxy-β- methyl butyrate, citrulline, ornithine, and vitamin D) seem the most effective preventive measures to limit the muscle mass loss associated with diseases and aging. However, compliance with exercise programs and their implementation are difficult. These are partly the consequence of patient pathologies (fatigue, pain) which limits their participation in long-term physical activity compared to people without chronic illness [
3,
4]. Pharmaceutical groups have recently taken an interest in the loss of muscle mass and have developed their drug candidates, such as anti-myostatin antibodies or myostatin inhibitors and a selective modulator of the androgen receptor. However, some studies already showed that these molecules have side effects and are not very effective in humans [
5,
6,
7].
Different signaling pathways control the balance between protein synthesis and degradation in skeletal muscle. Two main pathways coordinate the renewal of contractile proteins: the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin complex (PI3K/Akt/mTOR) pathway (the major signaling cascade of muscle hypertrophy), and the FOXO family pathway (transcription factors that control the expression of atrogenic and autophagy genes involved in proteasome-mediated degradation and autophagy, respectively). Activation of the PI3K/Akt pathway stimulates protein synthesis via its anabolic targets (mTOR, the protein S6 kinase 1 and the binding protein eIF4E) and blocks the FOXO proteolysis pathways mediated by E3 ubiquitin ligases of the muscle RING finger protein-1 (MuRF1, TRIM63) and muscle atrophy F-box (MAFbx) families, and consequently the proteasome activity [
1,
7,
8]. Recent studies have shown that natural molecules found in plants or fruits could be used for the treatment or prevention of skeletal muscle atrophy by stimulating protein synthesis and/or inhibiting protein degradation [
9,
10,
11,
12,
13,
14].
Plants represent an important source of bioactive molecules and are at the origin of two-thirds of the currently used drugs [
15]. Rosemary (
Salvia rosmarinus Schleid., synonym:
Rosmarinus officinalis L., Lamiaceae) stem and leaf extracts contain many different phenolic compounds, including flavonoids and phenolic diterpenes and triterpenes (Borras-Linares et al., 2014), with many major biological properties (antidiabetic, anti-inflammatory, antioxidant, and anticancer) [
16,
17,
18,
19,
20]. The antioxidant activities of rosemary leaf extracts are mainly attributed to the phenolic diterpenes carnosic acid (CA) and carnosol, the major oxidation product of CA [
21,
22]. Research on the identification of new compounds contained in rosemary extracts focuses on their potential antioxidant, anti-inflammatory or anti-cancer activities. However, many other unknown molecules may have hypertrophy-promoting activity in skeletal muscle.
Human myoblasts (i.e., skeletal muscle progenitor cells) can proliferate and at confluence, spontaneously fuse and differentiate, giving rise to myotubes (i.e., quiescent multinucleated cells that express muscle-specific structural proteins). These myotubes can respond to hypertrophic or atrophic stimuli by modulating cell fusion or the proteostasis dynamics, i.e., the balance between protein synthesis (hypertrophy) and protein degradation (atrophy), with or without modification of the fusion index (number of myotube nuclei relative to the total number of nuclei) [
9,
10,
13,
23,
24]. This cell model is therefore useful for selecting natural molecules with hypertrophic activity on the basis of their efficiency and their toxicity. Here, we found that rosemary leaf extracts induce myotube hypertrophy in human primary skeletal muscle cells. By using a bioassay-guided fractionation approach and human skeletal muscle cells, we identified carnosol as a molecule with myotrophic activity. We then evaluated, by Western blotting, carnosol effects on signaling pathways involved in the control of skeletal muscle hypertrophy and atrophy, and found that carnosol inhibits MuRF1 expression and proteasome activity, independently of its activity on the NRF2/antioxidant pathway.
2. Materials and Methods
2.1. General Experimental Procedure
Flash column chromatography was performed using a Spot Liquid Chromatography Flash Instrument (Armen Instrument, Saint-Avé, France) equipped with a quaternary pump, an UV/visible spectrophotometer and a fraction collector. The 1H-NMR, 13C-NMR, COSY, HSQC, and HMBC spectra were recorded on a BRUKER Avance III-600 MHz NMR spectrometer. The coupling constants (J) were estimated in Hertz.
2.2. Reagent and Standards
Cyclohexane (99.8%), dichloromethane (99.9%), chloroform (99.9%), 1-butanol (99.7%) (HPLC grade), deuterated chloroform (99.8%) and DMSO (99.9%) were purchased from Sigma-Aldrich (Steinheim, Germany). Acetonitrile (99.9%) was purchased from Chromasolv (Seelze, Germany). Formic acid (98%), ethyl acetate (99%) and acetone (99.5%) were from Panreac (Barcelona, Spain). Ethanol (99.9%) was purchased from VWR BDH Prolabo (Monroeville, PA, USA). Carnosol (98%) was purchased from Extrasynthese (Genay, France), and CA (99.5%) from PhytoLab GmbH & Co. KG (Vestenbergsgreuth, Germany).
2.3. Plant Material
Wild Rosmarinus officinalis plants were collected in the North of Montpellier (France) in February 2015. Dry leaves were ground and directly extracted. Voucher specimens were deposited as no RL05515O.
2.4. Extraction
A total of 150 g of ground rosemary leaves were macerated in the dark at room temperature with 900 g of absolute ethanol and 450 g of distilled water, with manual agitation every 24 h. After 7 days, the leaves extract was filtered. Evaporation under reduced pressure to dryness yielded 69 g of hydroethanolic extract, named RLE. The raw dry extract was kept at −20 °C until analysis and purification.
2.5. Bioassay-Guided Isolation of Carnosol from the Rosemary Leaf Extract
At each purification step, fractions were tested using the assay described below (part 2.9). The RLE (69 g) was solubilized in water (400 mL), then partitioned into cyclohexane (C6H12), dichloromethane (CH2Cl2), ethyl acetate (EtOAc), and butanol (BuOH) (2 × 200 mL for each solvent). Among the five fractions, only RLE-1 (soluble in C6H12, 2.27 g) could induce myotube hypertrophy and was then fractionated by normal-phase flash column chromatography (Merck Chimie SVF D26-SI60, 15–40 μm-30 g, flow rate 10 mL/min, 10 mL/fraction). Elution was completed with mixtures of C6H12/EtOAc (100:0 to 0:100), and then CH2Cl2/methanol (100:0 to 70:30 in 1% then 5% stepwise). After thin-layer chromatography analysis, the fractions eluted with cyclohexane/EtOAc 60:40 to 0:100 (fractions 252–459) were combined and concentrated under reduced pressure, yielding fraction RLE-1-4 (780 mg). RLE-1-4 was purified on LH-20 Sephadex gel (2.4 × 38 cm, 40 g LH-20, elution: 100% CH2Cl2 to 100% methanol, then 100% acetone, 5 mL/fraction). Fractions 116–141, eluted with CH2Cl2/MeOH 95:5 to 50:50, were combined and concentrated under reduced pressure, yielding fraction RLE-1-4-5 (225 mg). RLE-1-4-5 was fractionated on normal-phase flash column chromatography (Merck Chimie SVF D26-SI60, 15–40 μm-30 g, flow rate 5 mL/min, 5 mL/fraction) eluted with a mixture of C6H12/EtOAc (100:0 to 0:100) and then CHCl3/methanol (100:0 to 70:30) to obtain 166 fractions. Fractions 29 to 54, eluted with 100% C6H12, were combined (RLE-1-4-5-2; 90 mg), and deposited again on normal-phase flash column chromatography (Interchim PuriFlash SIHP 15 µm 25 g, flow rate 10 mL/min, 10 mL/fraction, elution C6H12/EtOAc 100:0 to 0:100). Fractions 38–52 (50 mg) were combined and purified on Sephadex LH-20 gel (1.2 × 24 cm, 20 g, elution CH2Cl2/methanol 100:0 to 0:100) to obtain 50 fractions. Fractions 17–33 (RLE-1-4-5-2-4-3, 28 mg) were combined and evaporated to dryness. Fraction RLE-1-4-5-2-4-3 was purified by precipitation of impurities with methanol. The soluble fraction in CH2Cl2 (14 mg) was then analyzed by NMR spectroscopy and identified as pure carnosol: 1H NMR (CDCl3, 600 MHz), δH 0.86 (3H, s, 19-CH3); 0.91 (3H, s, 18-CH3); 1.23 (3H, d, J = 2.3 Hz, 17-CH3); 1.24 (3H, d, J = 2.3 Hz, 16-CH3); 1.29 (1H, td, J = 3.2–13.5 Hz, 3-CH); 1.68 (1H, m, 3-CH); 1.72 (1H, d, J = 5.6, 5-CH), 1.74 (1H, d, J = 5.6, 2-CH), 1.88 (1H, t, J = 12.9 Hz, 2-CH); 2.02 (1H, dd, J = 3.2–13.8 Hz, 6-CH); 2.21 (1H, dt, J = 5.0–13.8 Hz, 6-CH); 2.39 (1H, td, J = 4.1–13.2 Hz, 1-CH); 2.92 (1H, d, J = 13.2 Hz, 1-CH); 3.08 (1H, sept, J = 6.7 Hz, 15-CH); 5.37 (1H, d, J = 4.1 Hz, 7-CH); 6.64 (1H, s, 14-CH) 13C NMR (CDCl3, 150 MHz) δC 19.0 (C2); 19.9 (C19); 22.6 (C16); 22.6 (C17); 27.5 (C15); 29.4 (C1); 29.9 (C6); 31.8 (C18); 34.7 (C4); 41.2 (C3); 45.6 (C6); 48.5 (C10); 78.0 (C7); 112.5 (C14); 121.8 (C9); 132.3 (C13); 132.9 (C8); 141.2 (C11); 141.9 (C12); 175.9 (C20).
2.6. High-Performance Liquid Chromatography (HPLC) Analysis
Chromatographic separation and detection for quantitative analysis were performed on an Ultimate 3000 apparatus that included a quaternary pump, a degasser, an automatic sampler, and a DAD detector (Thermo Fisher Scientific Inc., San Jose, CA, USA). The system was operated using the Chromeleon software, version 2.0. Chromatographic separation was achieved on an ODS Hypersyl C18 column (250 mm × 4.6 mm, 5 μm, Thermo Fisher Scientific Inc., San Jose, USA), with a column temperature maintained at 35 °C. Samples (5 mg/mL in methanol) were eluted at a flow rate of 1 mL/min, using solvent A (water/formic acid 99.9:0.1 v/v) and solvent B (acetonitrile), with a previously described gradient (Morel Saint 2019).
2.7. Primary Muscle Cell Cultures
Quadriceps muscle biopsies were obtained from three healthy adults, one 19-year-old male (M19), one 30-year-old male (M30), and one 70-year-old female (F70) at the Centre Hospitalier Universitaire Lapeyronie (Montpellier, France). Donors signed an informed written consent after the description of the protocol (Authorization N° DC-2008-594). Myoblasts (muscle progenitor cells) were purified from the muscle biopsies, and were cultured on collagen-coated dishes in DMEM/F12 medium with 10% fetal bovine serum (FBS), 0.1% Ultroser G and 1 ng/mL of human basic fibroblast growth factor (proliferation medium), as previously described [
23]. Myoblasts can differentiate by fusing into long multinucleated myotubes that express specific skeletal muscle proteins. For cell differentiation, confluent cells were cultured in DMEM/F12 medium with 5% FBS (differentiation medium) for 5 days.
2.8. Immunofluorescence Staining
Human myotubes were fixed in 2% paraformaldehyde (Electron Microscopy Sciences, Ayguesvives, France) in PBS and permeabilized with PBS/0.25% Triton X-100. Cells were then incubated with a mouse monoclonal anti-troponin T antibody (1/200; Sigma-Aldrich), followed by the Alexa 555-conjugated anti-mouse antibody (1/1000; Thermo Fisher Scientific). Nuclei were revealed by DAPI staining. Images (seven fields for each condition) were taken with a Zeiss epifluorescence microscope, with 5× plan air objective and analyzed with the Image J software.
Myotube area and fusion index analyses:
DAPI-positive cells were analyzed using the Fiji software to obtain the number of nuclei per image, normalized to the total image area to compare all conditions. For this automatic counting, a manual threshold was set to differentiate nuclei from the background, and the number of nuclei was provided by the “Analyze > Analyze particles” command. Troponin-T-positive cells were analyzed using the Fiji software to obtain the total myotube area per image, by setting a threshold to discriminate troponin-T-positive cells from the background and to quantify them with the “Analyze > Measure” command (normalized to the total image area). The fusion index was calculated as the ratio of the number of nuclei in troponin-T positive cells with ≥3 nuclei versus the total number of nuclei. This ratio was calculated by setting a threshold selection, inverting the selection, and pasting it on the DAPI images to highlight only the nuclei of myotubes that were then counted with the same technique used to determine the total number of nuclei.
2.9. Western Blotting
Protein extracts (10 or 20 μg/well) were separated by SDS-PAGE gel electrophoresis (25 mA for 1 h) using 12% and 4–15% Mini-PROTEAN Precast Gels, and then transferred (1.3 A, 25 V for 5 min) using the Trans-Blot Turbo Transfer System to nitrocellulose membranes (Trans-Blot Turbo 0.2 μm Nitrocellulose Transfer Pack) (Bio-Rad, Schiltigheim, France). Membranes were blocked at room temperature with Odyssey blocking buffer (EurobioScientific, Les Ulis, France) and probed with the rabbit polyclonal anti-HO-1 (1/2000; ref: 43966S), rabbit monoclonal anti-phosphorylated AKT (serine 473) (1/5000; ref: 4060), rabbit polyclonal anti-AKT (1/5000; ref: 9272), rabbit polyclonal anti-mTOR (1/1000; ref: 2972), rabbit polyclonal anti-phosphorylated mTOR (serine 2448)(1/1000; ref: 2971) (from Cell Signaling, Danvers, MA, USA); mouse monoclonal anti-myosin (skeletal slow) (1/5000; ref: M8421), mouse monoclonal anti-myosin (skeletal fast) (1/5000; ref: M4276), mouse monoclonal anti-troponin T (1/5000; ref: T6277); mouse monoclonal anti-actin (α-sarcomeric) (1/2000; ref: A2172) (from Sigma Aldrich Saint-Louis, MO, USA); mouse monoclonal anti-MAFbx (1/500; ref: SC-166806), mouse monoclonal anti-MuRF1 (1/2000; ref: SC-398608), mouse monoclonal anti-MuRF2 (1/4000; ref: SC-517149) (from Santa Cruz Biotechnology, Dallas, TX 75220, USA); and mouse monoclonal anti-myosin light chain 3 (F310, 1/300; ref: F310-S) antibody from Developmental Studies Hybridoma Bank (Iowa City, IA, USA). Primary antibodies were followed by incubation with IRDye®680RD and IRDye®800RD secondary antibodies (Eurobio Scientific, Les Ulis, France). Fluorescence was quantified with the Odyssey software. Data were normalized to the Revert bands (Revert Total Protein Stain Kit, LI-COR USA).
2.10. RT-qPCR
Total RNA was isolated from cultured human muscle cells using the NucleoSpin RNA II Kit (Macherey–Nagel, Hoerdt, France). The RNA concentration of each sample was measured with an Eppendorf BioPhotometer. cDNA was prepared using the VersocDNA Synthesis Kit (Thermo Scientific, Ilkirch, France). The expression of various genes was then analyzed as previously described [
25] by quantitative polymerase chain reaction (qPCR) with a LightCycler apparatus (Roche Diagnostics, Meylan, France), using the following primer sets:
RPPO human for | TCATCCAGCAGGTGTTCG |
RPPO human rev | AGCAAGTGGGAAGGTGTAA |
TRIM63 human for | AGGGACAAAAGACTGAACTGAATA |
TRIM63 human rev | TCCAGGATGGCATACAACG |
2.11. Transient siRNA Transfections
MURF1 (siMurf1) and negative control (siCTRL) Silencer Select pre-designed siRNAs were purchased from Fisher Scientific (France). Human myoblasts at confluence were transfected with Lipofectamine RNAiMax according to the manufacturer’s recommendations (Fisher scientific, France), induced to differentiate, and analyzed 72–96 h after transfection.
2.12. Proteasome Activity
Myotubes were collected in PBS by centrifugation after scraping from culture dishes. Cell pellets were lysed in 0.5 mL lysis buffer (50 mM TRIS (pH 8), 0.5 mM EDTA, 5 mM MgCl2, 0.5% NP40, 2 mM ATP, 1 mM DTT and 10% glycerol) for 30 min, on ice, by vortexing every 10 min. Then, lysates were centrifuged at 15,000 rpm at 4 °C for 15 min. Measurement of proteasome activity: 10 μg of myotube extracts/well for each condition were deposited in 96-well plates and incubated with proteasome substrate alone (Suc-LLVY-AMC- Bachem AG ref-I-1395.0025) or proteasome substrate and the 20S proteasome inhibitor bortezomib (MedChemExp ref: HY-10227/CS-1039) at 20 μM final. The fluorescence was read using a 380/460 nm filter set with the TECAN infinite 200Pro plate reader after 15, 30 and 60 min of incubation. The mean fluorescence for each extract and each condition was calculated, as well as the residual fluorescence (fluorescence of the substrate—(fluorescence of the substrate + the inhibitor)).
2.13. Statistical Analysis
Statistical analyses were done with the GraphPad Prism 6.0 software (GraphPad Software Inc., San Diego, CA, USA). Error bars represent the standard deviation (SD) of the mean. Statistical significance was determined using one-way ANOVA; * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 were considered significant.
4. Discussion
Here, we found that RLE was sufficient to induce hypertrophy of human muscle cells and that carnosol, a phenolic diterpene, was the active component mediating this effect in young and aged skeletal muscle cells. Recently, it has been reported that carnosol has anti-cachectic effects mainly by decreasing muscle and adipose tissue loss, in vitro in C2C12 mouse myoblasts incubated with conditioned medium from C26 colon carcinoma cells or with pro-inflammatory cytokines, and in vivo in C26 tumor cell-bearing mice [
29]. Moreover, carnosol can regulate glucose homeostasis in skeletal muscle via AMPK-dependent GLUT4 glucose transporter translocation [
30], and could be potentially used against insulin resistance and type 2 diabetes mellitus. All these findings indicate that carnosol is a promising molecule for the treatment of skeletal muscle disorders such as aging and cachexia.
Carnosol has various therapeutic effects (anti-cancer, anti-inflammatory and antioxidant activities) [
31]. Some of carnosol antioxidant effects are mediated through activation of the NRF2 signaling pathway [
32]. NRF2 is a transcription factor that mediates the intracellular antioxidant response by binding to the antioxidant response element in the promoter of its target genes, thus inducing the expression of a set of antioxidant enzymes, called ‘phase 2 enzymes,’ including HO-1 [
33]. Regulation of NRF2 signaling preserves the redox homeostasis and protects the skeletal muscle structure and function, thus making of NRF2 an interesting potential target of carnosol effects in muscle cells [
34]. We found here that carnosol activates the NRF2 signaling pathway in human primary muscle cells, but that this is not required for its hypertrophic effect. This suggests that carnosol exhibits distinct antioxidant and hypertrophic activities.
To elucidate how carnosol induces hypertrophy in human primary muscle cells, we first looked at the PI3K/Akt/mTOR cascade that represents the major pathway of muscle hypertrophy. Our data clearly indicated that carnosol did not affect Akt or mTOR phosphorylation/activation levels, in agreement with the study by Vlavcheski et al. showing that in L6 rat skeletal muscle cells, carnosol regulates glucose homeostasis, but does not affect the PI3K-Akt pathway [
30]. Conversely, in C2C12 myoblasts incubated with conditioned medium from C26 colon carcinoma cells or pro-inflammatory cytokines, and in C26 tumor cell-bearing mice, carnosol activates the Akt signaling pathway and ameliorates cachexia-induced muscle atrophy [
29]. These data suggest that carnosol activates the Akt signaling cascade in cells exposed to pro-inflammatory factors, such as in cachexia, but not in normal muscle cells.
Our data suggest that the hypertrophic effect of carnosol in human muscle cells is mediated through inhibition of the E3 ubiquitin ligase MuRF1 and of the proteasome. In muscles, proteins can be degraded through at least four pathways: lysosomes, calcium-activated proteases, ATP-dependent, and ATP-independent proteolytic pathways. The ATP-dependent pathways include the UPS, the most important proteolytic pathway to mediate muscle atrophy [
35]. Ubiquitination, which is required for protein targeting to the 26S proteasome complex, involves the coordinated action of the E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin ligases. In muscles, the two E3 ubiquitin ligases MAFbx and MuRF1 are considered the main markers of muscle atrophy. MuRF1 belongs to a small family with three members in mammals (MuRF1/TRIM63, MuRF2/TRIM55, and MuRF3/TRIM54). MuRF1 is expressed at low levels in adult muscles in normal conditions, and is upregulated by catabolic stimuli. Studies in knock-out (KO) mice revealed that MuRF1 and MAFbx are excellent markers of muscle atrophy, but only MuRF1 is important to preserve muscle mass in pathological contexts [
36]. However, MuRF1 does not seem to be required for the basal skeletal muscle metabolism. Like MuRF1-KO mice, MuRF2-KO mice do not have an obvious phenotype in standard conditions. However, most MuRF1/MuRF2 double KO mice die prematurely, and the survivors develop cardiac and skeletal muscle hypertrophy [
37].
Several interacting partners have been identified for MuRF-1, mainly myofibrillar/Contractile proteins such as myosin heavy chain (MHC), titin, myosin binding prot-C (MyBP-C), the light chain of myosin (MLC), alpha-actin (a-actin) and telethonin [
36,
38]. We found that carnosol increased the level of slow myosin heavy chain, but not of fast myosin heavy chain, troponin T, sarcomeric actin, myosin light chain F3 (in this manuscript) and telethonin (data not shown). This indicated that carnosol stimulates muscle hypertrophy by targeting the expression of specific proteins, especially MHCs, a identified interacting partner of MuRF1. Characterisation of myosin heavy chain (MHC) type is a useful method to classify fiber types based on the relationship between MHC type and fiber function. In humans, type I, or slow-twitch, fibers possess slower twitch speeds and are relatively fatigue resistant. Type II, or high-twitch, fibers, present higher twitch speeds than type I fibers but are less fatigue resistant [
39]. Thus, carnosol by promoting type I muscle fibers, should make the skeletal muscle fatigue resistant and more enduring. This hypothesis is currently being evaluated on animal models fed with a diet enriched with carnosol.
Here,
MuRF1 silencing in human muscle cells led to an increase of the myotube size. This phenotype was due to
MuRF1 silencing because the siRNA did not affect MuRF2 expression. Therefore, it appears that in a cell system that mimics muscle regeneration in vitro, MuRF1 can control the myotube size. It has been hypothesized that MuRF1 upregulation leads to muscle atrophy by increasing the proteasome activity and protein degradation. As carnosol represses both MuRF1 mRNA and protein expression and induces myotube hypertrophy, we examined the relationship between MuRF1 expression and proteasome activity in human muscle cells. We found that carnosol or MuRF1 silencing by siRNA reduced proteasome activity by 20%. However, modulation of MuRF1 expression does not always coincide with variation in proteasome activity. In several models of atrophy (denervation, hindlimb suspension, functional overload by synergist ablation surgery), there is a disconnection between MuRF1 expression and proteasome activity [
1]. We found that in human muscle cells, inhibition of the proteasome by bortezomib (5 nM) is sufficient to induce muscle hypertrophy. This suggests a simple relationship between UPS activity and myotube size during in vitro muscle regeneration. However, many questions remain concerning the relationship between the UPS and muscle differentiation. Proteasome dysfunction impairs satellite cell ability to proliferate, survive, and differentiate, resulting in defective muscle regeneration [
40]. Moreover, proteasome component inhibition or knockdown can block myoblast fusion and consequently muscle differentiation [
41,
42]. Therefore, proteasome activity is not always associated with muscle cell atrophy or hypertrophy, but could be required also for remodeling and growth, depending on the skeletal muscle differentiation stage [
35].
How carnosol controls MuRF1 expression remains an open question. Several transcription factors are involved in MuRF1 expression regulation by directly binding to specific sequences in its promoter. FOXO1,3,4 are transcription factors that bind to and induce
MuRF1 promoter activity in several catabolic situations. FOXO factors are downstream of the IGF1/insulin/Akt pathway. In anabolic conditions, Akt phosphorylates and inhibits FOXO proteins, thus repressing MuRF1 expression. However, as we demonstrated that carnosol does not activate Akt, FOXO involvement in MuRF1 repression by carnosol is unlikely. The NF-kB signaling pathway mediates the effects of inflammatory cytokines on muscle wasting. In response to inflammatory cytokines, the IκB kinase complex (IKK) phosphorylates IκB, resulting in its ubiquitination and proteasomal degradation, and then to the nuclear translocation of NF-κB. MuRF1 promoter has NF-κB binding sites [
38]. Carnosol inhibits the NF-κB signaling pathway in vitro in C2C12 mouse muscle cells incubated with conditioned medium from C26 tumor cells or pro-inflammatory cytokines. However, this inhibition was significant only at very high concentrations of carnosol (25 μM), whereas in our study 3 μM of carnosol were sufficient to observe an effect on MuRF1 expression [
29]. In addition, without incubation with pro-inflammatory cytokine, the activity of NF-κB is very low. Therefore, it seems unlikely that carnosol inhibits MuRF1 by repressing NF-κB in normal muscle cells. Besides FOXO and NF-κB, several transcription factors activate MuRF1: glucocorticoid receptor, p53 protein family, TFEB, myogenin, ZEB1 [
1,
38]. More work is needed to test whether one of these proteins could be a carnosol target.
Several strategies have been developed to identify natural molecules that could be used for the treatment or prevention of skeletal muscle atrophy by stimulating protein synthesis and/or inhibiting protein degradation. Here, we used a bioassay-guided fractionation approach to identify carnosol as anabolic compound in an RLE. Another strategy targeting molecules that inhibit the gene signatures induced by muscle atrophy allowed the identification of three natural compounds: ursolic acid (a ubiquitous triterpenoid in the plant kingdom, medicinal herbs, also enriched in the skin of apples), tomatidine (a steroidal alkaloid extracted from tomatoes), and apigenin (a trihydroxyflavone abundant in various edible plants including parsley, celery, chamomile, oranges, and grapefruits) [
9,
10,
11]. Many dietary supplements containing ecdysteroids are marketed as “natural anabolic agents”. Extracts of some plants (e.g.,
Spinacia oleracea, Rhaponticum carthamoides) and their active ingredient ecdysterone (20-hydroxyecdysone, 20HE) can significantly increase muscle mass and decrease body fat [
12]. Finally, researchers have identified natural molecules that can stimulate mitochondrial and muscle function/mass, such as urolithin A (including ellagitannins precursors isolated from pomegranate) [
14] and urolithin B [
13], respectively. Our study adds a new plant extract (RLE) and a molecule (carnosol) to this list of natural compounds that may be used for the treatment or prevention of skeletal muscle atrophy through their inhibition of the E3 ubiquitin ligase MuRF1 (and proteasome activity) and protein degradation.