Protective Effects of Sesamol against Liver Oxidative Stress and Inflammation in High-Fat Diet-Induced Hepatic Steatosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diet
2.2. Serum and Tissue Collection
2.3. Serum Parameter Analysis
2.4. Hepatic Parameters Analysis
2.5. Western Blotting Analysis
2.6. Quantitative Reverse-Transcription-Polymerase Chain Reaction (RT-PCR)
2.7. Statistical Analysis
3. Results
3.1. Body Weight and Energy Intake
3.2. Markers of Oxidative Stress in Serum
3.3. Effects of SEM on Hepatic MDA and SOD Production
3.4. Effects of SEM on Mediators Involved in Oxidative Stress Generation in Fatty Liver
3.5. Effects of SEM on Inflammatory Factors in Fatty Liver
3.6. Effects of SEM on Hepatic Regulators of Oxidative Stress and Inflammation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
References
- Friedman, S.L.; Neuschwander-Tetri, B.A.; Rinella, M.; Sanyal, A.J. Mechanisms of NAFLD development and therapeutic strategies. Nat. Med. 2018, 24, 908–922. [Google Scholar] [CrossRef] [PubMed]
- Stefan, N.; Häring, H.U.; Cusi, K. Non-alcoholic fatty liver disease: Causes, diagnosis, cardiometabolic consequences, and treatment strategies. Lancet Diabetes Endocrinol. 2019, 7, 313–324. [Google Scholar] [CrossRef]
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Polyzos, S.A.; Kountouras, J.; Mantzoros, C.S. Obesity and nonalcoholic fatty liver disease: From pathophysiology to therapeutics. Metabolism 2019, 92, 82–97. [Google Scholar] [CrossRef]
- Rani, V.; Deep, G.; Singh, R.K.; Palle, K.; Yadav, U.C. Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci. 2016, 148, 183–193. [Google Scholar] [CrossRef]
- Sies, H. Oxidative stress: A concept in redox biology and medicine. Redox Biol. 2015, 4, 180–183. [Google Scholar] [CrossRef] [Green Version]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The Role of Oxidative Stress and Antioxidants in Liver Diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative Stress: Harms and Benefits for Human Health. Oxid Med. Cell Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef]
- Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.; Rahu, N. Oxidative Stress and Inflammation: What Polyphenols Can Do for Us? Oxid Med. Cell Longev. 2016, 2016, 7432797. [Google Scholar] [CrossRef] [Green Version]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. CMLS 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [Green Version]
- Sreekumar, R.; Rosado, B.; Rasmussen, D.; Charlton, M. Hepatic gene expression in histologically progressive nonalcoholic steatohepatitis. Hepatology 2003, 38, 244–251. [Google Scholar] [CrossRef]
- Videla, L.A.; Rodrigo, R.; Orellana, M.; Fernandez, V.; Tapia, G.; Quiñones, L.; Varela, N.; Contreras, J.; Lazarte, R.; Csendes, A.; et al. Oxidative stress-related parameters in the liver of non-alcoholic fatty liver disease patients. Clin. Sci. 2004, 106, 261–268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferramosca, A.; Di Giacomo, M.; Zara, V. Antioxidant dietary approach in treatment of fatty liver: New insights and updates. World J. Gastroenterol. 2017, 23, 4146–4157. [Google Scholar] [CrossRef]
- Ren, B.; Yuan, T.; Diao, Z.; Zhang, C.; Liu, Z.; Liu, X. Protective effects of sesamol on systemic oxidative stress-induced cognitive impairments via regulation of Nrf2/Keap1 pathway. Food Funct. 2018, 9, 5912–5924. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.Y.; Yu, L.; Chen, J.H.; Yang, L.N.; Lin, C.; Shi, X.Q.; Qin, H. Sesamol Alleviates Obesity-Related Hepatic Steatosis via Activating Hepatic PKA Pathway. Nutrients 2020, 12, 329. [Google Scholar] [CrossRef] [Green Version]
- Gaggini, M.; Morelli, M.; Buzzigoli, E.; DeFronzo, R.A.; Bugianesi, E.; Gastaldelli, A. Non-alcoholic fatty liver disease (NAFLD) and its connection with insulin resistance, dyslipidemia, atherosclerosis and coronary heart disease. Nutrients 2013, 5, 1544–1560. [Google Scholar] [CrossRef]
- Kumar, N.; Mudgal, J.; Parihar, V.K.; Nayak, P.G.; Kutty, N.G.; Rao, C.M. Sesamol treatment reduces plasma cholesterol and triacylglycerol levels in mouse models of acute and chronic hyperlipidemia. Lipids 2013, 48, 633–638. [Google Scholar] [CrossRef]
- Khan, S.; Kumar, A.; Adhikari, J.S.; Rizvi, M.A.; Chaudhury, N.K. Protective effect of sesamol against ⁶⁰Co γ-ray-induced hematopoietic and gastrointestinal injury in C57BL/6 male mice. Free Radic. Res. 2015, 49, 1344–1361. [Google Scholar] [CrossRef]
- Vennila, L.; Pugalendi, K.V. Efficacy of sesamol on plasma and tissue lipids in isoproterenol-induced cardiotoxicity in Wistar rats. Arch. Pharmacal. Res. 2012, 35, 1465–1470. [Google Scholar] [CrossRef]
- Qin, H.; Xu, H.; Yu, L.; Yang, L.; Lin, C.; Chen, J. Sesamol intervention ameliorates obesity-associated metabolic disorders by regulating hepatic lipid metabolism in high-fat diet-induced obese mice. Food Nutr. Res. 2019, 63, 3637. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.Y.; Lee, T.H. Antioxidant enzymes as redox-based biomarkers: A brief review. BMB Rep. 2015, 48, 200–208. [Google Scholar] [CrossRef] [Green Version]
- Jian, T.; Ao, X.; Wu, Y.; Lv, H.; Ma, L.; Zhao, L.; Tong, B.; Ren, B.; Chen, J.; Li, W. Total sesquiterpene glycosides from Loquat (Eriobotrya japonica) leaf alleviate high-fat diet induced non-alcoholic fatty liver disease through cytochrome P450 2E1 inhibition. Biomed. Pharmacother. 2017, 91, 229–237. [Google Scholar] [CrossRef]
- Zhu, S.Y.; Jiang, N.; Yang, J.; Tu, J.; Zhou, Y.; Xiao, X.; Dong, Y. Silybum marianum oil attenuates hepatic steatosis and oxidative stress in high fat diet-fed mice. Biomed. Pharmacother. 2018, 100, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Ruankham, W.; Suwanjang, W.; Wongchitrat, P.; Prachayasittikul, V.; Prachayasittikul, S.; Phopin, K. Sesamin and sesamol attenuate H2O2-induced oxidative stress on human neuronal cells via the SIRT1-SIRT3-FOXO3a signaling pathway. Nutr. Neurosci. 2021, 24, 90–101. [Google Scholar] [CrossRef]
- Surapaneni, K.M.; Priya, V.V.; Mallika, J. Pioglitazone, quercetin and hydroxy citric acid effect on cytochrome P450 2E1 (CYP2E1) enzyme levels in experimentally induced non alcoholic steatohepatitis (NASH). Eur. Rev. Med. Pharmacol. Sci. 2014, 18, 2736–2741. [Google Scholar]
- Jian, T.; Wu, Y.; Ding, X.; Lv, H.; Ma, L.; Zuo, Y.; Ren, B.; Zhao, L.; Tong, B.; Chen, J.; et al. A novel sesquiterpene glycoside from Loquat leaf alleviates oleic acid-induced steatosis and oxidative stress in HepG2 cells. Biomed. Pharmacother. 2018, 97, 1125–1130. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.; Kumar, S.; Simon, S.D.; Singh, D.P.; Kumar, A. HIV gp120- and methamphetamine-mediated oxidative stress induces astrocyte apoptosis via cytochrome P450 2E1. Cell Death Dis. 2013, 4, e850. [Google Scholar] [CrossRef] [Green Version]
- Singel, K.L.; Segal, B.H. NOX2-dependent regulation of inflammation. Clin. Sci. 2016, 130, 479–490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serviddio, G.; Bellanti, F.; Tamborra, R.; Rollo, T.; Capitanio, N.; Romano, A.D.; Sastre, J.; Vendemiale, G.; Altomare, E. Uncoupling protein-2 (UCP2) induces mitochondrial proton leak and increases susceptibility of non-alcoholic steatohepatitis (NASH) liver to ischaemia-reperfusion injury. Gut 2008, 57, 957–965. [Google Scholar] [CrossRef]
- Zhang, S.; Feng, Z.; Gao, W.; Duan, Y.; Fan, G.; Geng, X.; Wu, B.; Li, K.; Liu, K.; Peng, C. Aucubin Attenuates Liver Ischemia-Reperfusion Injury by Inhibiting the HMGB1/TLR-4/NF-κB Signaling Pathway, Oxidative Stress, and Apoptosis. Front. Pharmacol. 2020, 11, 544124. [Google Scholar] [CrossRef]
- López, T., II; Domínguez-López, A.; Miliar-García, Á.; Escalona-Cardoso, G.N.; Real-Sandoval, S.A.; Gómez-Alcalá, A.; Jaramillo-Flores, M.E. Modulation of the mRNA of the Nlrp3 inflammasome by Morin and PUFAs in an obesity model induced by a high-fat diet. Food Res. Int. 2020, 137, 109706. [Google Scholar] [CrossRef]
- El-Derany, M.O.; El-Demerdash, E. Pyrvinium pamoate attenuates non-alcoholic steatohepatitis: Insight on hedgehog/Gli and Wnt/β-catenin signaling crosstalk. Biochem. Pharm. 2020, 177, 113942. [Google Scholar] [CrossRef]
- Zhang, D.D. Mechanistic studies of the Nrf2-Keap1 signaling pathway. Drug Metab. Rev. 2006, 38, 769–789. [Google Scholar] [CrossRef] [PubMed]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hou, Y.; Li, X.; Peng, S.; Yao, J.; Bai, F.; Fang, J. Lipoamide Ameliorates Oxidative Stress via Induction of Nrf2/ARE Signaling Pathway in PC12 Cells. J. Agric. Food Chem. 2019, 67, 8227–8234. [Google Scholar] [CrossRef]
- He, P.; Wu, Y.; Shun, J.; Liang, Y.; Cheng, M.; Wang, Y. Baicalin Ameliorates Liver Injury Induced by Chronic plus Binge Ethanol Feeding by Modulating Oxidative Stress and Inflammation via CYP2E1 and NRF2 in Mice. Oxid Med. Cell Longev. 2017, 2017, 4820414. [Google Scholar] [CrossRef]
- Li, W.; Ma, F.; Zhang, L.; Huang, Y.; Li, X.; Zhang, A.; Hou, C.; Zhu, Y.; Zhu, Y. S-Propargyl-cysteine Exerts a Novel Protective Effect on Methionine and Choline Deficient Diet-Induced Fatty Liver via Akt/Nrf2/HO-1 Pathway. Oxid Med. Cell Longev. 2016, 2016, 4690857. [Google Scholar] [CrossRef]
- Saha, S.; Buttari, B.; Panieri, E.; Profumo, E.; Saso, L. An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 2020, 25, 5474. [Google Scholar] [CrossRef]
- Lin, Q.; Kang, X.; Li, X.; Wang, T.; Liu, F.; Jia, J.; Jin, Z.; Xue, Y. NF-κB-mediated regulation of rat CYP2E1 by two independent signaling pathways. PLoS ONE 2019, 14, e0225531. [Google Scholar] [CrossRef] [PubMed]
Name | Primer Sequence (5′ to 3′) |
---|---|
cyp2e1 | Forward: GTGACTGGGGAATGGGGAAA |
Reserve: AGGTAGGGTCAAAAGGCTGG | |
nox2 | Forward: TGTGAGAGGTTGGTTCGG |
Reserve: CAGGAGCAGAGGTCAGTGTG | |
ucp2 | Forward: TTCTCCCAATGTTGCCCG |
Reserve: CCCGAAGGCAGAAGTGAAGT | |
nf-κb | Forward: GACCTGGTTTCGCTCTTG |
Reserve: TGCTGTATCCGGGTACTT | |
tnf-α | Forward: CACCACGCTCTTCTGTCTACTGAAC |
Reserve: AGATGATCTGAGTGTGAGGGTCTGG | |
Ho1 | Forward: ACCGCCTTCCTGCTCAACATTG |
Reserve: CTCTGACGAAGTGACGCCATCTG | |
Nqo1 | Forward: GCGAGAAGAGCCCTGATTGTACTG |
Reserve: AGCCTCTACAGCAGCCTCCTTC | |
β-actin | Forward: CGTGCGTGACATCAAAGA |
Reserve: AAGGAAGGCTGGAAAAGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, W.; Song, Z.; Li, S.; Hu, M.; Shaukat, H.; Qin, H. Protective Effects of Sesamol against Liver Oxidative Stress and Inflammation in High-Fat Diet-Induced Hepatic Steatosis. Nutrients 2021, 13, 4484. https://doi.org/10.3390/nu13124484
Zheng W, Song Z, Li S, Hu M, Shaukat H, Qin H. Protective Effects of Sesamol against Liver Oxidative Stress and Inflammation in High-Fat Diet-Induced Hepatic Steatosis. Nutrients. 2021; 13(12):4484. https://doi.org/10.3390/nu13124484
Chicago/Turabian StyleZheng, Wenya, Ziyu Song, Sha Li, Minmin Hu, Horia Shaukat, and Hong Qin. 2021. "Protective Effects of Sesamol against Liver Oxidative Stress and Inflammation in High-Fat Diet-Induced Hepatic Steatosis" Nutrients 13, no. 12: 4484. https://doi.org/10.3390/nu13124484