Association of Gut Microbiome and Vitamin D Deficiency in Knee Osteoarthritis Patients: A Pilot Study
Abstract
:1. Introduction
2. Material and Methods
2.1. Study Participants
2.2. Data/Specimen Collection
3. DNA Isolation, V3–V4 Region 16 s rRNA Sequencing and Library Preparation
4. Data Analysis
5. Results
6. Gut Microbiome Profile
7. Knee Osteoarthritis-Associated Dysbiosis
7.1. Knee Osteoarthritis-Associated Dysbiosis in Patients with Vitamin D Deficiency
7.2. Vitamin D Deficiency Impacts Knee Osteoarthritis-Associated Dysbiosis
7.3. Vitamin D Deficiency Affects the Gut Bacterial Communities
8. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Locantore, P.; Del Gatto, V.; Gelli, S.; Paragliola, R.M.; Pontecorvi, A. The interplay between immune system and microbiota in osteoporosis. Mediat. Inflamm. 2020, 2020. [Google Scholar] [CrossRef]
- Heidari, B.; Babaei, M. Therapeutic and preventive potential of vitamin D supplementation in knee osteoarthritis. ACR Open Rheumatol. 2019, 1, 318–326. [Google Scholar] [CrossRef]
- Iolascon, G.; Gimigliano, F.; Moretti, A.; de Sire, A.; Migliore, A.; Brandi, M.L.; Piscitelli, P. Early osteoarthritis: How to define, diagnose, and manage. A systematic review. Eur. Geriatr. Med. 2017, 8, 383–396. [Google Scholar] [CrossRef]
- Rabini, A.; De Sire, A.; Marzetti, E.; Gimigliano, R.; Ferriero, G.; Piazzini, D.B.; Iolascon, G.; Gimigliano, F. Effects of focal muscle vibration on physical functioning in patients with knee osteoarthritis: A randomized controlled trial. Eur. J. Phys. Rehabil. Med. 2015, 51, 513–520. [Google Scholar]
- De Sire, A.; Stagno, D.; Minetto, M.A.; Cisari, C.; Baricich, A.; Invernizzi, M. Long-term effects of intra-articular oxygen-ozone therapy versus hyaluronic acid in older people affected by knee osteoarthritis: A randomized, single-blind extension study. J. Back Musculoskelet. Rehabil. 2020, 33, 347–354. [Google Scholar] [CrossRef]
- Cooper, C.; Rannou, F.; Richette, P.; Bruyère, O.; Al-Daghri, N.; Altman, R.D.; Brandi, M.L.; Collaud Basset, S.; Herrero-Beaumont, G.; Migliore, A.; et al. Use of intraarticular hyaluronic acid in the management of knee osteoarthritis in clinical practice. Arthritis Care Res. 2017, 69, 1287–1296. [Google Scholar] [CrossRef]
- Li, H.-M.; Liu, Y.; Zhang, R.-J.; Ding, J.-Y.; Shen, C.-L. Vitamin D receptor gene polymorphisms and osteoarthritis: A meta-analysis. Rheumatology 2021, 60, 538–548. [Google Scholar] [CrossRef] [PubMed]
- Elik, H.; Doiu, B.; Yllmaz, F.; Begoilu, F.A.; Kuran, B. The efficiency of platelet-rich plasma treatment in patients with knee osteoarthritis. J. Back Musculoskelet. Rehabil. 2020, 33, 127–138. [Google Scholar] [CrossRef] [PubMed]
- Grübler, M.R.; Gängler, S.; Egli, A.; Bischoff-Ferrari, H.A. Effects of vitamin D3 on glucose metabolism in patients with severe osteoarthritis: A randomized double-blind trial comparing daily 2000 with 800 IU vitamin D3. Diabetes Obes. Metab. 2020. [Google Scholar] [CrossRef]
- Tripathy, S.K.; Gantaguru, A.; Nanda, S.N.; Velagada, S.; Srinivasan, A.; Mangaraj, M. Association of vitamin D and knee osteoarthritis in younger individuals. World J. Orthop. 2020, 11, 418–425. [Google Scholar] [CrossRef]
- Reyes, C.; Leyland, K.M.; Peat, G.; Cooper, C.; Arden, N.K.; Prieto-Alhambra, D. Association between overweight and obesity and risk of clinically diagnosed knee, hip, and hand osteoarthritis: A population-based cohort study. Arthritis Rheumatol. 2016, 68, 1869–1875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marshall, W.G.; Hazewinkel, H.A.W.; Mullen, D.; De Meyer, G.; Baert, K.; Carmichael, S. The effect of weight loss on lameness in obese dogs with osteoarthritis. Vet. Res. Commun. 2010, 34, 241–253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berenbaum, F.; Griffin, T.M.; Liu-Bryan, R. Review: Metabolic regulation of inflammation in osteoarthritis. Arthritis Rheumatol. 2017, 69, 9–21. [Google Scholar] [CrossRef] [PubMed]
- Winer, D.A.; Luck, H.; Tsai, S.; Winer, S. The intestinal immune system in obesity and insulin resistance. Cell Metab. 2016, 23, 413–426. [Google Scholar] [CrossRef] [Green Version]
- Cani, P.D.; Bibiloni, R.; Knauf, C.; Waget, A.; Neyrinck, A.M.; Delzenne, N.M.; Burcelin, R. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008, 57, 1470–1481. [Google Scholar] [CrossRef] [Green Version]
- Zhao, H.; Zhang, H.; Wu, H.; Li, H.; Liu, L.; Guo, J.; Li, C.; Shih, D.Q.; Zhang, X. Protective role of 1,25(OH)2vitamin D3 in the mucosal injury and epithelial barrier disruption in DSS-induced acute colitis in mice. BMC Gastroenterol. 2012, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Z.Y.; Stabler, T.; Pei, F.X.; Kraus, V.B. Both systemic and local lipopolysaccharide (LPS) burden are associated with knee OA severity and inflammation. Osteoarthr. Cartil. 2016, 24, 1769–1775. [Google Scholar] [CrossRef] [Green Version]
- Szychlinska, M.A.; Di Rosa, M.; Castorina, A.; Mobasheri, A.; Musumeci, G. A correlation between intestinal microbiota dysbiosis and osteoarthritis. Heliyon 2019, 5, e01134. [Google Scholar] [CrossRef] [Green Version]
- Hao, X.; Shang, X.; Liu, J.; Chi, R.; Zhang, J.; Xu, T. The gut microbiota in osteoarthritis: Where do we stand and what can we do? Arthritis Res. Ther. 2021, 23, 42. [Google Scholar] [CrossRef]
- De Sire, A.; de Sire, R.; Petito, V.; Masi, L.; Cisari, C.; Gasbarrini, A.; Scaldaferri, F.; Invernizzi, M. Gut–joint axis: The role of physical exercise on gut microbiota modulation in older people with osteoarthritis. Nutrients 2020, 12, 574. [Google Scholar] [CrossRef] [Green Version]
- Favazzo, L.J.; Hendesi, H.; Villani, D.A.; Soniwala, S.; Dar, Q.A.; Schott, E.M.; Gill, S.R.; Zuscik, M.J. The gut microbiome-joint connection: Implications in osteoarthritis. Curr. Opin. Rheumatol. 2020, 32, 92–101. [Google Scholar] [CrossRef] [PubMed]
- McAlindon, T.E.; Felson, D.T.; Zhang, Y.; Hannan, M.T.; Aliabadi, P.; Weissman, B.; Rush, D.; Wilson, P.W.F.; Jacques, P. Relation of dietary intake and serum levels of vitamin d to progression of osteoarthritis of the knee among participants in the Framingham Study. Ann. Intern. Med. 1996, 125, 353–359. [Google Scholar] [CrossRef] [PubMed]
- Ding, C.; Cicuttini, F.; Parameswaran, V.; Burgess, J.; Quinn, S.; Jones, G. Serum levels of vitamin D, sunlight exposure, and knee cartilage loss in older adults: The Tasmanian older adult cohort study. Arthritis Rheum. 2009, 60, 1381–1389. [Google Scholar] [CrossRef]
- Goula, T.; Kouskoukis, A.; Drosos, G.; Tselepis, A.S.; Ververidis, A.; Valkanis, C.; Zisimopoulos, A.; Kazakos, K. Vitamin D status in patients with knee or hip osteoarthritis in a Mediterranean country. J. Orthop. Traumatol. 2015, 16, 35–39. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.F.; Driban, J.B.; Lo, G.H.; Price, L.L.; Booth, S.; Eaton, C.B.; Lu, B.; Nevitt, M.; Jackson, B.; Garganta, C.; et al. Vitamin D deficiency is associated with progression of knee osteoarthritis. J. Nutr. 2014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McAlindon, T.; LaValley, M.; Schneider, E.; Nuite, M.; Lee, J.Y.; Price, L.L.; Lo, G.; Dawson-Hughes, B. Effect of vitamin D supplementation on progression of knee pain and cartilage volume loss in patients with symptomatic osteoarthritis: A randomized controlled trial. JAMA J. Am. Med. Assoc. 2013, 309, 155–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holick, M.F. High prevalence of vitamin D inadequacy and implications for health. Mayo Clin. Proc. 2006, 81, 353–373. [Google Scholar] [CrossRef] [Green Version]
- Tabatabaeizadeh, S.A.; Fazeli, M.; Meshkat, Z.; Khodashenas, E.; Esmaeili, H.; Mazloum, S.; Ferns, G.A.; Abdizadeh, M.F.; Ghayour-Mobarhan, M. The effects of high doses of vitamin D on the composition of the gut microbiome of adolescent girls. Clin. Nutr. ESPEN 2020, 35, 103–108. [Google Scholar] [CrossRef]
- Guo, C.; Sinnott, B.; Niu, B.; Lowry, M.B.; Fantacone, M.L.; Gombart, A.F. Synergistic induction of human cathelicidin antimicrobial peptide gene expression by vitamin D and stilbenoids. Mol. Nutr. Food Res. 2014, 58, 528–536. [Google Scholar] [CrossRef] [Green Version]
- National Institute of Nutrition, IDietary Guidelines for Indians. Available online: http://ninindia.org/DietaryGuidelinesforNINwebsite.pdf (accessed on 8 June 2016).
- Roos, E.M.; Toksvig-Larsen, S. Knee injury and Osteoarthritis Outcome Score (KOOS)—Validation and comparison to the WOMAC in total knee replacement. Health Qual. Life Outcomes 2003. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Liu, D.; Liu, F.; Wu, J.; Zou, J.; Xiao, X.; Zhao, F.; Zhu, B. HTQC: A fast quality control toolkit for Illumina sequencing data. BMC Bioinform. 2013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Segata, N.; Abubucker, S.; Goll, J.; Schubert, A.M.; Izard, J.; Cantarel, B.L.; Huttenhower, C. Microbial community function and biomarker discovery in the human microbiome. Genome Biol. 2011, 12, 1–25. [Google Scholar] [CrossRef]
- Boer, C.G.; Radjabzadeh, D.; Medina-Gomez, C.; Garmaeva, S.; Schiphof, D.; Arp, P.; Koet, T.; Kurilshikov, A.; Fu, J.; Ikram, M.A.; et al. Intestinal microbiome composition and its relation to joint pain and inflammation. Nat. Commun. 2019, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
V3-4F | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNACTCCTACGGGAGGCAGCAG |
V3-4R | CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGACTACHVGGGTWTCTAAT |
Characteristics | KOA_VDD (n = 7) | KOA (n = 4) | VDD (n = 7) | Normal (NVD) (n = 6) |
---|---|---|---|---|
Age (Years ± SD) | 52 ± 7.2 | 50 ± 9.70 | 44 ± 8.1 | 37.7 ± 12.7 |
Gender (Male/Female) | 1/6 | 1/3 | 7/0 | 7/0 |
Clinical Presentation | ||||
Painful Knee | ++ | ++ | NA | NA |
WOMAC Score (Score ± SD) | 57.6 ± 7.2 | 54.3 ± 10.7 | 90 ± 2.2 | 93 ± 0.4 |
Kellgren-Lawrence grade (Grade ± SD) | 2.3 ± 0.9 | 3.5 ± 0.6 | NA | NA |
Demography | ||||
Vitamin D ng/mL (Levels ± SD) | 21.2 ± 3.5 | 35.8 ± 4.2 | 19.1 ± 4.3 | 42 ± 9.8 |
Hemoglobin g/dL (levels ± SD) | 12.8 ± 1.7 | 12.7 ± 1.9 | 13.1 ± 2.1 | 13.1 ± 1.8 |
BMI | 28.2 ± 2.7 | 27.5 ± 2.8 | 28.9 ± 2.6 | 22.9 ± 2.6 |
Physical activity | Mild | Mild to | Moderate | Active |
Socio-economic score (Score ± SD) | 13.7± 4.7 | 12± 2.4 | 20± 5.2 | 14.1± 2.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ramasamy, B.; Magne, F.; Tripathy, S.K.; Venugopal, G.; Mukherjee, D.; Balamurugan, R. Association of Gut Microbiome and Vitamin D Deficiency in Knee Osteoarthritis Patients: A Pilot Study. Nutrients 2021, 13, 1272. https://doi.org/10.3390/nu13041272
Ramasamy B, Magne F, Tripathy SK, Venugopal G, Mukherjee D, Balamurugan R. Association of Gut Microbiome and Vitamin D Deficiency in Knee Osteoarthritis Patients: A Pilot Study. Nutrients. 2021; 13(4):1272. https://doi.org/10.3390/nu13041272
Chicago/Turabian StyleRamasamy, Boopalan, Fabien Magne, Sujit Kumar Tripathy, Giriprasad Venugopal, Diptasree Mukherjee, and Ramadass Balamurugan. 2021. "Association of Gut Microbiome and Vitamin D Deficiency in Knee Osteoarthritis Patients: A Pilot Study" Nutrients 13, no. 4: 1272. https://doi.org/10.3390/nu13041272