Targeted High-Resolution Taxonomic Identification of Bifidobacterium longum subsp. infantis Using Human Milk Oligosaccharide Metabolizing Genes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Genomes
2.2. Calculation of ANI Values
2.3. Genomic Analysis of HMO-Metabolizing Clusters
2.4. Subjects and Samples
2.5. Sample Processing and Sequencing
2.6. Identification of B. infantis in Metagenomic Samples by the Presence of HMO-Metabolizing Clusters
2.7. Primer Design and Testing
2.8. Development of PCR Conditions
2.9. Confirmation of HMO-Metabolizing Genes in the Metagenomes by PCR
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
HMO | Human Milk Oligossacharide |
References
- Lebreton, F.; Manson, A.L.; Saavedra, J.T.; Straub, T.J.; Earl, A.M.; Gilmore, M.S. Tracing the enterococci from paleozoic origins to the hospital. Cell 2017, 169, 849–861.e13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frese, S.A.; Hutton, A.A.; Contreras, L.N.; Shaw, C.A.; Palumbo, M.C.; Casaburi, G.; Xu, G.; Davis, J.C.; Lebrilla, C.B.; Henrick, B.M.; et al. Persistence of supplemented Bifidobacterium longum subsp. infantis EVC001 in breastfed infants. mSphere 2017, 2, e00501-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Le Doare, K.; Holder, B.; Bassett, A.; Pannaraj, P.S. Mother’s milk: A purposeful contribution to the development of the infant microbiota and immunity. Front. Immunol. 2018, 9, 361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Milani, C.; Lugli, G.A.; Duranti, S.; Turroni, F.; Bottacini, F.; Mangifesta, M.; Sanchez, B.; Viappiani, A.; Mancabelli, L.; Taminiau, B.; et al. Genomic encyclopedia of type strains of the genus Bifidobacterium. Appl. Environ. Microbiol. 2014, 80, 6290–6302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Milani, C.; Turroni, F.; Duranti, S.; Lugli, G.A.; Mancabelli, L.; Ferrario, C.; van Sinderen, D.; Ventura, M. Genomics of the genus Bifidobacterium reveals species-specific adaptation to the glycan-rich gut environment. Appl. Environ. Microbiol. 2016, 82, 980–991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, Z.; Zhang, W.; Guo, C.; Yang, X.; Liu, W.; Wu, Y.; Song, Y.; Kwok, L.Y.; Cui, Y.; Menghe, B.; et al. Comparative genomic analysis of 45 type strains of the genus Bifidobacterium: A snapshot of its genetic diversity and evolution. PLoS ONE 2015, 10, e0117912. [Google Scholar] [CrossRef] [Green Version]
- Garrido, D.; Kim, J.H.; German, J.B.; Raybould, H.E.; Mills, D.A. Oligosaccharide binding proteins from Bifidobacterium longum subsp. infantis reveal a preference for host glycans. PLoS ONE 2011, 6, e17315. [Google Scholar] [CrossRef] [Green Version]
- LoCascio, R.G.; Desai, P.; Sela, D.A.; Weimer, B.; Mills, D.A. Broad conservation of milk utilization genes in Bifidobacterium longum subsp. infantis as revealed by comparative genomic hybridization. Appl. Environ. Microbiol. 2010, 76, 7373–7381. [Google Scholar] [CrossRef] [Green Version]
- Sela, D.A.; Chapman, J.; Adeuya, A.; Kim, J.H.; Chen, F.; Whitehead, T.R.; Lapidus, A.; Rokhsar, D.S.; Lebrilla, C.B.; German, J.B.; et al. The genome sequence of Bifidobacterium longum subsp. infantis reveals adaptations for milk utilization within the infant microbiome. Proc. Natl. Acad. Sci. USA 2008, 105, 18964–18969. [Google Scholar] [CrossRef] [Green Version]
- Satokari, R.M.; Vaughan, E.E.; Favier, C.F.; Doré, J.; Edwards, C.; Vos, W.M.d. Diversity of Bifidobacterium and Lactobacillus spp. in breast-fed and formula-fed infants as assessed by 16S rDNA sequence differences. Microb. Ecol. Health Dis. 2002, 14, 97–105. [Google Scholar] [CrossRef]
- Bonjoch, X.; Balleste, E.; Blanch, A.R. Multiplex PCR with 16S rRNA gene-targeted primers of Bifidobacterium spp. to identify sources of fecal pollution. Appl. Environ. Microbiol. 2004, 70, 6. [Google Scholar] [CrossRef] [Green Version]
- Matsuki, T.; Watanabe, K.; Fujimoto, J.; Kado, Y.; Takada, T.; Matsumoto, K.; Tanaka, R. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal Bifidobacteria. Appl. Environ. Microbiol. 2004, 70, 167–173. [Google Scholar] [CrossRef] [Green Version]
- Johnson, J.S.; Spakowicz, D.J.; Hong, B.Y.; Petersen, L.M.; Demkowicz, P.; Chen, L.; Leopold, S.R.; Hanson, B.M.; Agresta, H.O.; Gerstein, M.; et al. Evaluation of 16S rRNA gene sequencing for species and strain-level microbiome analysis. Nat. Commun. 2019, 10, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Truong, D.T.; Franzosa, E.A.; Tickle, T.L.; Scholz, M.; Weingart, G.; Pasolli, E.; Tett, A.; Huttenhower, C.; Segata, N. MetaPhlAn2 for enhanced metagenomic taxonomic profiling. Nat. Methods 2015, 12, 902–903. [Google Scholar] [CrossRef]
- Wood, D.E.; Lu, J.; Langmead, B. Improved metagenomic analysis with Kraken 2. Genome Biol. 2019, 20, 257. [Google Scholar] [CrossRef] [Green Version]
- Marcobal, A.; Barboza, M.; Froehlich, J.W.; Block, D.E.; German, J.B.; Lebrilla, C.B.; Mills, D.A. Consumption of human milk oligosaccharides by gut-related microbes. J. Agric. Food Chem. 2010, 58, 5334–5340. [Google Scholar] [CrossRef] [Green Version]
- Marcobal, A.; Barboza, M.; Sonnenburg, E.; Pudlo, N.; Martens, E.; Desai, P.; Lebrilla, C.; Weimer, B.; Mills, D.; German, J.B.; et al. Bacteroides in the infant gut consume milk oligosaccharides via mucus-utilization pathways. Cell Host Microbe 2011, 10, 507–514. [Google Scholar] [CrossRef] [Green Version]
- Ruiz-Moyano, S.; Totten, S.M.; Garrido, D.A.; Smilowitz, J.T.; German, J.B.; Lebrilla, C.B.; Mills, D.A. Variation in consumption of human milk oligosaccharides by infant gut-associated strains of Bifidobacterium breve. Appl. Environ. Microbiol. 2013, 79, 6040–6049. [Google Scholar] [CrossRef] [Green Version]
- Yu, Z.T.; Chen, C.; Newburg, D.S. Utilization of major fucosylated and sialylated human milk oligosaccharides by isolated human gut microbes. Glycobiology 2013, 23, 1281–1292. [Google Scholar] [CrossRef] [Green Version]
- Garrido, D.; Ruiz-Moyano, S.; Lemay, D.G.; Sela, D.A.; German, J.B.; Mills, D.A. Comparative transcriptomics reveals key differences in the response to milk oligosaccharides of infant gut-associated bifidobacteria. Sci. Rep. 2015, 5, 13517. [Google Scholar] [CrossRef]
- Thongaram, T.; Hoeflinger, J.L.; Chow, J.; Miller, M.J. Human milk oligosaccharide consumption by probiotic and human-associated bifidobacteria and lactobacilli. J. Dairy Sci. 2017, 100, 7825–7833. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Konstantinidis, K.T.; Tiedje, J.M. Genomic insights that advance the species definition for prokaryotes. Proc. Natl. Acad. Sci. USA 2005, 102, 2567–2572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pritchard, L.; Glover, R.H.; Humphris, S.; Elphinstone, J.G.; Toth, I.K. Genomics and taxonomy in diagnostics for food security: Soft-rotting enterobacterial plant pathogens. Anal. Methods 2016, 8, 12–24. [Google Scholar] [CrossRef]
- Kurtz, S.; Phillippy, A.; Delcher, A.L.; Smoot, M.; Shumway, M.; Antonescu, C.; Salzberg, S.L. Versatile and open software for comparing large genomes. Genome Biol. 2004, 5, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Stecher, G.; Tamura, K.; Kumar, S. Molecular evolutionary genetics analysis (MEGA) for macOS. Mol. Biol. Evol. 2020, 37, 1237–1239. [Google Scholar] [CrossRef]
- Kryazhimskiy, S.; Plotkin, J.B. The population genetics of dN/dS. PLoS Genet. 2008, 4, e1000304. [Google Scholar] [CrossRef] [Green Version]
- McIver, L.J.; Abu-Ali, G.; Franzosa, E.A.; Schwager, R.; Morgan, X.C.; Waldron, L.; Segata, N.; Huttenhower, C. bioBakery: A meta’omic analysis environment. Bioinformatics 2018, 34, 1235–1237. [Google Scholar] [CrossRef] [Green Version]
- Langmead, B.; Wilks, C.; Antonescu, V.; Charles, R. Scaling read aligners to hundreds of threads on general-purpose processors. Bioinformatics 2019, 35, 421–432. [Google Scholar] [CrossRef] [Green Version]
- Tannock, G.W.; Lawley, B.; Munro, K.; Gowri Pathmanathan, S.; Zhou, S.J.; Makrides, M.; Gibson, R.A.; Sullivan, T.; Prosser, C.G.; Lowry, D.; et al. Comparison of the Compositions of the stool microbiotas of infants fed goat milk formula, cow milk-based formula, or breast milk. Appl. Environ. Microbiol. 2013, 79, 3040–3048. [Google Scholar] [CrossRef] [Green Version]
- Lawley, B.; Munro, K.; Hughes, A.; Hodgkinson, A.J.; Prosser, C.G.; Lowry, D.; Zhou, S.J.; Makrides, M.; Gibson, R.A.; Lay, C.; et al. Differentiation of Bifidobacterium longum subspecies longum and infantis by quantitative PCR using functional gene targets. PeerJ 2017, 5, e3375. [Google Scholar] [CrossRef] [Green Version]
- Hong, W.S.; Chen, M.J. Rapid identification of Bifidobacteria in dairy products by gene-targeted species-specific PCR technique and DGGE. Asian-Australas. J. Anim. Sci. 2007, 20, 1887–1894. [Google Scholar] [CrossRef]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1996, 173, 697–703. [Google Scholar] [CrossRef] [Green Version]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Green Version]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef] [Green Version]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
- Jain, C.; Rodriguez, R.L.M.; Phillippy, A.M.; Konstantinidis, K.T.; Aluru, S. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat. Commun. 2018, 9, 5114. [Google Scholar] [CrossRef] [Green Version]
- Zhu, A.; Sunagawa, S.; Mende, D.R.; Bork, P. Inter-individual differences in the gene content of human gut bacterial species. Genome Biol. 2015, 16, 82. [Google Scholar] [CrossRef] [Green Version]
- Bonham, K.S.; Bruchhage, M.M.K.; Rowland, S.; Volpe, A.R.; Dyer, K.; Consortium, R.; D’Sa, V.; Huttenhower, C.; Deoni, S.C.L.; Klepac-Ceraj, V. Gut microbes and their genes are associated with brain development and cognitive function in healthy children. bioRxiv 2020. [Google Scholar] [CrossRef]
- Kunz, C. Historical aspects of human milk oligosaccharides. Adv. Nutr. 2012, 3, 430S–439S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yatsunenko, T.; Rey, F.E.; Manary, M.J.; Trehan, I.; Dominguez-Bello, M.G.; Contreras, M.; Magris, M.; Hidalgo, G.; Baldassano, R.N.; Anokhin, A.P.; et al. Human gut microbiome viewed across age and geography. Nature 2012, 486, 222–227. [Google Scholar] [CrossRef] [PubMed]
- Bäckhed, F.; Roswall, J.; Peng, Y.; Feng, Q.; Jia, H.; Kovatcheva-Datchary, P.; Li, Y.; Xia, Y.; Xie, H.; Zhong, H.; et al. Dynamics and stabilization of the human gut microbiome during the first year of life. Cell Host Microbe 2015, 17, 690–703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davis, J.C.C.; Lewis, Z.T.; Krishnan, S.; Bernstein, R.M.; Moore, S.E.; Prentice, A.M.; Mills, D.A.; Lebrilla, C.B.; Zivkovic, A.M. Growth and morbidity of Gambian infants are influenced by maternal milk oligosaccharides and infant gut microbiota. Sci. Rep. 2017, 7, 40466. [Google Scholar] [CrossRef]
- Vatanen, T.; Plichta, D.R.; Somani, J.; Münch, P.C.; Arthur, T.D.; Hall, A.B.; Rudolf, S.; Oakeley, E.J.; Ke, X.; Young, R.A.; et al. Genomic variation and strain-specific functional adaptation in the human gut microbiome during early life. Nat. Microbiol. 2019, 4, 470–479. [Google Scholar] [CrossRef] [Green Version]
- Casaburi, G.; Duar, R.M.; Brown, H.; Mitchell, R.D.; Kazi, S.; Chew, S.; Cagney, O.; Flannery, R.L.; Sylvester, K.G.; Frese, S.A.; et al. Metagenomic insights of the infant microbiome community structure and function across multiple sites in the United States. Sci. Rep. 2021, 11, 1472. [Google Scholar] [CrossRef]
- Fu, L.; Song, J.; Wang, C.; Fu, S.; Wang, Y. Bifidobacterium infantis potentially alleviates shrimp tropomyosin-induced allergy by tolerogenic dendritic cell-dependent induction of regulatory T cells and alterations in gut microbiota. Front. Immunol. 2017, 8, 1536. [Google Scholar] [CrossRef]
- Wang, W.; Luo, X.; Zhang, Q.; He, X.; Zhang, Z.; Wang, X. Bifidobacterium infantis relieves allergic asthma in mice by regulating Th1/Th2. Med. Sci. Monit. 2020, 26, e920583. [Google Scholar] [CrossRef]
- Navarro-Tapia, E.; Sebastiani, G.; Sailer, S.; Toledano, L.A.; Serra-Delgado, M.; García-Algar, Ó.; Andreu-Fernández, V. Probiotic supplementation during the perinatal and infant period: Effects on gut dysbiosis and disease. Nutrients 2020, 12, 2243. [Google Scholar] [CrossRef]
- Cerdó, T.; Ruíz, A.; Suárez, A.; Campoy, C. Probiotic, Prebiotic, and Brain Development. Nutrients 2017, 9, 1247. [Google Scholar] [CrossRef] [Green Version]
- Smillie, C.S.; Smith, M.B.; Friedman, J.; Cordero, O.X.; David, L.A.; Alm, E.J. Ecology drives a global network of gene exchange connecting the human microbiome. Nature 2011, 480, 241–244. [Google Scholar] [CrossRef]
- Brito, I.L.; Yilmaz, S.; Huang, K.; Xu, L.; Jupiter, S.D.; Jenkins, A.P.; Naisilisili, W.; Tamminen, M.; Smillie, C.S.; Wortman, J.R.; et al. Mobile genes in the human microbiome are structured from global to individual scales. Nature 2016, 535, 435–439. [Google Scholar] [CrossRef]
Gene | Target Organism | Name | Sequence (5’-3’) | Annealing Temp (C) | % Coverage 1 | References | Length (bp) 2 |
---|---|---|---|---|---|---|---|
exo--sialidase (Blon_2348) | B. longum infantis | Sia-266F | GACGAGGAGGAATACAGCAG | 58 | 100 | This study | 410 |
Sia-676R | CACGAACAGCGAATCATGGATT | ||||||
glycoside-hydrolase (Blon_2355) | B. longum infantis | GH-750F | GCGCCATCCTGGTGATGTTATT | 59 | 100 | This study | 498 |
GH-1248R | CTACGTGATCTGGGAGAGTTTC | ||||||
haloacid dehalogenase domain protein hydrolase (Blon_2356) | B. longum infantis | HH-60F | CCACAATGTCATCGACCATCTG | 59 | 83 | This study | 474 |
HH-534R | CCGAAGTATTCGGATGCCTATG | ||||||
glycoside hydrolase (Blon_2358) | B. longum infantis | GH-492F | CGATGATGTGCTGGATTCGTTC | 58 | 74 | This study | 510 |
GH-1002R | CTCGACCATTCCAAGATGCTCA | ||||||
Sialidase | B. longum infantis | Inf 2348-F | ATACAGCAGAACCTTGGCCT | 60 | 50 | [32] | 280 |
Inf 2348-R | GCGATCACATGGACGAGAAC | ||||||
Major Facilitator Superfamily | B. longum infantis | Blon0915-F | CGTATTGGCTTTGTACGCATTT | 50 | 71 | [2] | 118 |
Blon0915-R | ATCGTGCCGGTGAGATTTAC | ||||||
16S rRNA | B. longum infantis, B. longum longum, B. indicum | Binf-F | CCATCTCTGGGATCGTCGG | 57 | [31] | 562 | |
Binf-R | TATCGGGGAGCAAGCGTGA | ||||||
16S rRNA | B. infantis | HCBin-F | AGGATACGTTCGGCGTC | 60 | [33] | 377 | |
HCBin-R | CGCAAGATTCCTCTAGCA | ||||||
16S rRNA | Bifidobacterium | g-Bif-F | CTCCTGGAAACGGGTGG | 55 | [31] | 550 | |
g-Bif-R | GGTGTTCTTCCCGATATCTACA | ||||||
16S rRNA | All bacteria | Uni-27F | AGAGTTTGATCCTGGCTCAG | 55 | [34] | ≈ 1400 | |
Uni-1492R | RGYTACCTTGTTACGACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tso, L.; Bonham, K.S.; Fishbein, A.; Rowland, S.; Klepac-Ceraj, V. Targeted High-Resolution Taxonomic Identification of Bifidobacterium longum subsp. infantis Using Human Milk Oligosaccharide Metabolizing Genes. Nutrients 2021, 13, 2833. https://doi.org/10.3390/nu13082833
Tso L, Bonham KS, Fishbein A, Rowland S, Klepac-Ceraj V. Targeted High-Resolution Taxonomic Identification of Bifidobacterium longum subsp. infantis Using Human Milk Oligosaccharide Metabolizing Genes. Nutrients. 2021; 13(8):2833. https://doi.org/10.3390/nu13082833
Chicago/Turabian StyleTso, Lauren, Kevin S. Bonham, Alyssa Fishbein, Sophie Rowland, and Vanja Klepac-Ceraj. 2021. "Targeted High-Resolution Taxonomic Identification of Bifidobacterium longum subsp. infantis Using Human Milk Oligosaccharide Metabolizing Genes" Nutrients 13, no. 8: 2833. https://doi.org/10.3390/nu13082833
APA StyleTso, L., Bonham, K. S., Fishbein, A., Rowland, S., & Klepac-Ceraj, V. (2021). Targeted High-Resolution Taxonomic Identification of Bifidobacterium longum subsp. infantis Using Human Milk Oligosaccharide Metabolizing Genes. Nutrients, 13(8), 2833. https://doi.org/10.3390/nu13082833