Multifaceted Protective Effects of Hesperidin by Aromatic Hydrocarbon Receptor in Endothelial Cell Injury Induced by Benzo[a]Pyrene
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Line and Cell Culture
2.2. FITC-LDL Uptake
2.3. Immunocytochemical/Immunofluorescence Imaging
2.4. Western Blot
2.5. Real-Time qPCR
2.6. ROS
2.7. MDA
2.8. Statistical Analysis
3. Results
3.1. Hsd Reduces BaP-Induced AHR Pathway and LDL Accumulation
3.2. Hsd Reduces BaP-Induced Oxidative Activity
3.3. Hsd Reduces BaP-Induced Inflammation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Steinberg, D. Atherogenesis in perspective: Hypercholesterolemia and inflammation as partners in crime. Nat. Med. 2002, 8, 1211–1217. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Sessa, W.C.; Fernández-Hernando, C. Endothelial Transcytosis of Lipoproteins in Atherosclerosis. Front. Cardiovasc. Med. 2018, 5, 130. [Google Scholar] [CrossRef] [PubMed]
- Iio, A.; Ohguchi, K.; Iinuma, M.; Nozawa, Y.; Ito, M. Hesperetin upregulates ABCA1 expression and promotes cholesterol efflux from THP-1 macrophages. J. Nat. Prod. 2012, 75, 563–566. [Google Scholar] [CrossRef]
- Glass, C.K.; Witztum, J.L. Atherosclerosis. The road ahead. Cell 2001, 104, 503–516. [Google Scholar] [CrossRef] [Green Version]
- Hoang, A.; Murphy, A.J.; Coughlan, M.T.; Thomas, M.C.; Forbes, J.M.; O’Brien, R.; Cooper, M.E.; Chin-Dusting, J.P.; Sviridov, D. Advanced glycation of apolipoprotein A-I impairs its anti-atherogenic properties. Diabetologia 2007, 50, 1770–1779. [Google Scholar] [CrossRef]
- Ohgami, N.; Nagai, R.; Miyazaki, A.; Ikemoto, M.; Arai, H.; Horiuchi, S.; Nakayama, H. Scavenger receptor class B type I-mediated reverse cholesterol transport is inhibited by advanced glycation end products. J. Biol. Chem. 2001, 276, 13348–13355. [Google Scholar] [CrossRef] [Green Version]
- Passarelli, M.; Tang, C.; McDonald, T.O.; O’Brien, K.D.; Gerrity, R.G.; Heinecke, J.W.; Oram, J.F. Advanced glycation end product precursors impair ABCA1-dependent cholesterol removal from cells. Diabetes 2005, 54, 2198–2205. [Google Scholar] [CrossRef] [Green Version]
- Iborra, R.T.; Machado-Lima, A.; Okuda, L.S.; Pinto, P.R.; Nakandakare, E.R.; Machado, U.F.; Correa-Giannella, M.L.; Pickford, R.; Woods, T.; Brimble, M.A.; et al. AGE-albumin enhances ABCA1 degradation by ubiquitin-proteasome and lysosomal pathways in macrophages. J. Diabetes Complicat. 2018, 32, 1–10. [Google Scholar] [CrossRef]
- Lioy, P.L.; Waldman, J.M.; Greenberg, A.; Harkov, R.; Pietarinen, C. The Total Human Environmental Exposure Study (THEES) to benzo(a)pyrene: Comparison of the inhalation and food pathways. Arch. Environ. Health 1988, 43, 304–312. [Google Scholar] [CrossRef]
- Tzeng, H.-P.; Lan, K.-C.; Yang, T.-H.; Chung, M.-N.; Liu, S.H. Benzo a pyrene activates interleukin-6 induction and suppresses nitric oxide-induced apoptosis in rat vascular smooth muscle cells. PLoS ONE 2017, 12, e0178063. [Google Scholar] [CrossRef] [Green Version]
- Shukla, H.; Chitrakar, R.; Bibi, H.A.; Gaje, G.; Koucheki, A.; Trush, M.A.; Zhu, H.; Li, Y.R.; Jia, Z. Reactive oxygen species production by BP-1,6-quinone and its effects on the endothelial dysfunction: Involvement of the mitochondria. Toxicol. Lett. 2020, 322, 120–130. [Google Scholar] [CrossRef] [PubMed]
- Miller, K.P.; Ramos, K.S. Impact of cellular metabolism on the biological effects of benzo[a]pyrene and related hydrocarbons. Drug Metab. Rev. 2001, 33, 1–35. [Google Scholar] [CrossRef]
- Linton, M.F.; Yancey, P.G.; Davies, S.S.; Jerome, W.G.; Linton, E.F.; Song, W.L.; Doran, A.C.; Vickers, K.C. The Role of Lipids and Lipoproteins in Atherosclerosis. In Endotext; Feingold, K.R., Anawalt, B., Boyce, A., Chrousos, G., de Herder, W.W., Dhatariya, K., Dungan, K., Grossman, A., Hershman, J.M., Hofland, J., et al., Eds.; MDText.com, Inc.: South Dartmouth, MA, USA, 2000. [Google Scholar]
- Ott, C.; Jacobs, K.; Haucke, E.; Navarrete Santos, A.; Grune, T.; Simm, A. Role of advanced glycation end products in cellular signaling. Redox Biol. 2014, 2, 411–429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, M.M.; Requena, J.R.; Crowley, J.R.; Thorpe, S.R.; Heinecke, J.W. The myeloperoxidase system of human phagocytes generates Nepsilon-(carboxymethyl)lysine on proteins: A mechanism for producing advanced glycation end products at sites of inflammation. J. Clin. Investig. 1999, 104, 103–113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de Souza Pinto, R.; Castilho, G.; Paim, B.A.; Machado-Lima, A.; Inada, N.M.; Nakandakare, E.R.; Vercesi, A.E.; Passarelli, M. Inhibition of macrophage oxidative stress prevents the reduction of ABCA-1 transporter induced by advanced glycated albumin. Lipids 2012, 47, 443–450. [Google Scholar] [CrossRef] [PubMed]
- N’Diaye, M.; Le Ferrec, E.; Lagadic-Gossmann, D.; Corre, S.; Gilot, D.; Lecureur, V.; Monteiro, P.; Rauch, C.; Galibert, M.D.; Fardel, O. Aryl hydrocarbon receptor- and calcium-dependent induction of the chemokine CCL1 by the environmental contaminant benzo[a]pyrene. J. Biol. Chem. 2006, 281, 19906–19915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, K.; Lv, Q.; Miao, Y.M.; Qiao, S.M.; Dai, Y.; Wei, Z.F. Cardamonin, a natural flavone, alleviates inflammatory bowel disease by the inhibition of NLRP3 inflammasome activation via an AhR/Nrf2/NQO1 pathway. Biochem. Pharmacol. 2018, 155, 494–509. [Google Scholar] [CrossRef]
- Moyer, B.J.; Rojas, I.Y.; Kerley-Hamilton, J.S.; Hazlett, H.F.; Nemani, K.V.; Trask, H.W.; West, R.J.; Lupien, L.E.; Collins, A.J.; Ringelberg, C.S.; et al. Inhibition of the aryl hydrocarbon receptor prevents Western diet-induced obesity. Model for AHR activation by kynurenine via oxidized-LDL, TLR2/4, TGFβ, and IDO1. Toxicol. Appl. Pharmacol. 2016, 300, 13–24. [Google Scholar] [CrossRef] [Green Version]
- Knaapen, A.M.; Curfs, D.M.; Pachen, D.M.; Gottschalk, R.W.; de Winther, M.P.; Daemen, M.J.; Van Schooten, F.J. The environmental carcinogen benzo[a]pyrene induces expression of monocyte-chemoattractant protein-1 in vascular tissue: A possible role in atherogenesis. Mutat Res 2007, 621, 31–41. [Google Scholar] [CrossRef]
- Li, C.; Schluesener, H. Health-promoting effects of the citrus flavanone hesperidin. Crit. Rev. Food Sci. Nutr. 2017, 57, 613–631. [Google Scholar] [CrossRef]
- Parhiz, H.; Roohbakhsh, A.; Soltani, F.; Rezaee, R.; Iranshahi, M. Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: An updated review of their molecular mechanisms and experimental models. Phytother. Res. 2015, 29, 323–331. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.Z.; Chen, J.F.; Shen, L.M.; Zhou, J.; Wang, C.F. Anti-atherosclerotic effect of hesperidin in LDLr−/− mice and its possible mechanism. Eur. J. Pharmacol. 2017, 815, 109–117. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, P.S.; Spolidorio, L.C.; Manthey, J.A.; Cesar, T.B. Citrus flavanones prevent systemic inflammation and ameliorate oxidative stress in C57BL/6J mice fed high-fat diet. Food Funct. 2016, 7, 2675–2681. [Google Scholar] [CrossRef] [PubMed]
- Arafa, H.M.M.; Aly, H.A.A.; Abd-Ellah, M.F.; El-Refaey, H.M. Hesperidin attenuates benzo alpha pyrene-induced testicular toxicity in rats via regulation of oxidant/antioxidant balance. Toxicol. Ind. Health 2009, 25, 417–427. [Google Scholar] [CrossRef] [PubMed]
- Tan, Y.Q.; Chiu-Leung, L.C.; Lin, S.M.; Leung, L.K. The citrus flavonone hesperetin attenuates the nuclear translocation of aryl hydrocarbon receptor. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2018, 210, 57–64. [Google Scholar] [CrossRef]
- Hennekens, C.H.; Gaziano, J.M. Antioxidants and heart disease: Epidemiology and clinical evidence. Clin. Cardiol. 1993, 16 (Suppl. 1), 10–15. [Google Scholar] [CrossRef]
- Bucala, R.; Mitchell, R.; Arnold, K.; Innerarity, T.; Vlassara, H.; Cerami, A. Identification of the major site of apolipoprotein B modification by advanced glycosylation end products blocking uptake by the low density lipoprotein receptor. J. Biol. Chem. 1995, 270, 10828–10832. [Google Scholar] [CrossRef] [Green Version]
- Mitra, S.; Deshmukh, A.; Sachdeva, R.; Lu, J.; Mehta, J.L. Oxidized low-density lipoprotein and atherosclerosis implications in antioxidant therapy. Am. J. Med. Sci. 2011, 342, 135–142. [Google Scholar] [CrossRef]
- Butler, J.P.; Post, G.B.; Lioy, P.J.; Waldman, J.M.; Greenberg, A. Assessment of carcinogenic risk from personal exposure to benzo(a)pyrene in the Total Human Environmental Exposure Study (THEES). Air Waste 1993, 43, 970–977. [Google Scholar] [CrossRef]
- Xing, Y.; Nukaya, M.; Satyshur, K.A.; Jiang, L.; Stanevich, V.; Korkmaz, E.N.; Burdette, L.; Kennedy, G.D.; Cui, Q.; Bradfield, C.A. Identification of the Ah-receptor structural determinants for ligand preferences. Toxicol. Sci. 2012, 129, 86–97. [Google Scholar] [CrossRef] [Green Version]
- Giannone, J.V.; Li, W.; Probst, M.; Okey, A.B. Prolonged depletion of AH receptor without alteration of receptor mRNA levels after treatment of cells in culture with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biochem. Pharmacol. 1998, 55, 489–497. [Google Scholar] [CrossRef]
- Mimura, J.; Fujii-Kuriyama, Y. Functional role of AhR in the expression of toxic effects by TCDD. Biochim. Biophys. Acta 2003, 1619, 263–268. [Google Scholar] [CrossRef]
- Anwar, S.; Khan, S.; Almatroudi, A.; Khan, A.A.; Alsahli, M.A.; Almatroodi, S.A.; Rahmani, A.H. A review on mechanism of inhibition of advanced glycation end products formation by plant derived polyphenolic compounds. Mol. Biol. Rep. 2021, 48, 787–805. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Ito, T.; Tsuji, G.; Furue, M. Baicalein Inhibits Benzo[a]pyrene-Induced Toxic Response by Downregulating Src Phosphorylation and by Upregulating NRF2-HMOX1 System. Antioxidants 2020, 9, 507. [Google Scholar] [CrossRef]
- Ahmadi, A.; Panahi, Y.; Johnston, T.P.; Sahebkar, A. Antidiabetic drugs and oxidized low-density lipoprotein: A review of anti-atherosclerotic mechanisms. Pharmacol. Res. 2021, 172, 105819. [Google Scholar] [CrossRef]
- Rhoads, J.P.; Major, A.S. How Oxidized Low-Density Lipoprotein Activates Inflammatory Responses. Crit. Rev. Immunol. 2018, 38, 333–342. [Google Scholar] [CrossRef]
- Mitra, S.; Goyal, T.; Mehta, J.L. Oxidized LDL, LOX-1 and atherosclerosis. Cardiovasc. Drugs Ther. 2011, 25, 419–429. [Google Scholar] [CrossRef]
- Kierdorf, K.; Fritz, G. RAGE regulation and signaling in inflammation and beyond. J. Leukoc. Biol. 2013, 94, 55–68. [Google Scholar] [CrossRef]
- Guazelli, C.F.S.; Fattori, V.; Ferraz, C.R.; Borghi, S.M.; Casagrande, R.; Baracat, M.M.; Verri, W.A., Jr. Antioxidant and anti-inflammatory effects of hesperidin methyl chalcone in experimental ulcerative colitis. Chem. Biol. Interact. 2021, 333, 109315. [Google Scholar] [CrossRef]
- Zhu, K.; Meng, Q.; Zhang, Z.; Yi, T.; He, Y.; Zheng, J.; Lei, W. Aryl hydrocarbon receptor pathway: Role, regulation and intervention in atherosclerosis therapy (Review). Mol. Med. Rep. 2019, 20, 4763–4773. [Google Scholar] [CrossRef] [Green Version]







| Name | Sequence (5′-3′) |
|---|---|
| β-actin-forward | ATCATGTTTGAGACCTTCAACA |
| β-actin-reverse | CATCTCTTGCTCGAAGTCCA |
| AHR-forward | CAAATCCTTCCAAGCGGCATA |
| AHR-reverse | CGCTGAGCCTAAGAACTGAAAG |
| CYP1A1-forward | TCGGCCACGGAGTTTCTTC |
| CYP1A1-reverse | GGTCAGCATGTGCCCAATCA |
| ABCA1-forward | TTCCCGCATTATCTGGAAAGC |
| ABCA1-reverse | CAAGGTCCATTTCTTGGCTGT |
| IL-1β-forward | AGCTACGAATCTCCGACCAC |
| IL-1β-reverse | CGTTATCCCATGTGTCGAAGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duan, J.; Chen, C.; Li, H.; Ju, G.; Gao, A.; Sun, Y.; Zhang, W. Multifaceted Protective Effects of Hesperidin by Aromatic Hydrocarbon Receptor in Endothelial Cell Injury Induced by Benzo[a]Pyrene. Nutrients 2022, 14, 574. https://doi.org/10.3390/nu14030574
Duan J, Chen C, Li H, Ju G, Gao A, Sun Y, Zhang W. Multifaceted Protective Effects of Hesperidin by Aromatic Hydrocarbon Receptor in Endothelial Cell Injury Induced by Benzo[a]Pyrene. Nutrients. 2022; 14(3):574. https://doi.org/10.3390/nu14030574
Chicago/Turabian StyleDuan, Juanjuan, Chao Chen, Hong Li, Gaoyan Ju, Ai Gao, Yinghao Sun, and Wensheng Zhang. 2022. "Multifaceted Protective Effects of Hesperidin by Aromatic Hydrocarbon Receptor in Endothelial Cell Injury Induced by Benzo[a]Pyrene" Nutrients 14, no. 3: 574. https://doi.org/10.3390/nu14030574
APA StyleDuan, J., Chen, C., Li, H., Ju, G., Gao, A., Sun, Y., & Zhang, W. (2022). Multifaceted Protective Effects of Hesperidin by Aromatic Hydrocarbon Receptor in Endothelial Cell Injury Induced by Benzo[a]Pyrene. Nutrients, 14(3), 574. https://doi.org/10.3390/nu14030574
