Synergistic Effects of Heat-Treated Green Tea Extract and Enzymatically-Modified Isoquercitrin in Preventing Obesity
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animals
2.3. Cell Culture
2.4. Body Composition Analysis and Micro-Computer Tomography (Micro-CT)
2.5. Histology and Immunofluorescence Staining (Immunohistochemistry)
2.6. Glucose Tolerance Test and Indirect Calorimetry Analysis
2.7. Pancreatic Lipase Activity Assay and Fecal Lipid Extraction
2.8. Enzyme-Linked Immunosorbent Assay (ELISA)
2.9. Quantitative Real-Time PCR (qRT-PCR)
2.10. Western Blot Analysis
2.11. Statistics
3. Results
3.1. HTGT and EMIQ Synergistically Prevented High-Fat Diet-Induced Obesity in Mice
3.2. HTGT and EMIQ Synergistically Reduced Overall and Abdominal Adiposity
3.3. HTGT and EMIQ Synergistically Improved Glucose Tolerance and Energy Expenditure and Inhibits Pancreatic Lipase Activity
3.4. HTGT and EMIQ Synergistically Increased Mitochondrial Activity and Oxidative Metabolism in Adipose Tissues
3.5. HTGT and EMIQ Synergistically Upregulated cAMP-Dependent PKA Signaling in Adipose Tissues
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kopelman, P.G. Obesity as a medical problem. Nature 2000, 404, 635–643. [Google Scholar] [CrossRef]
- González-Castejón, M.; Rodriguez-Casado, A. Dietary phytochemicals and their potential effects on obesity: A review. Pharmacol. Res. 2011, 64, 438–455. [Google Scholar] [CrossRef] [PubMed]
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Kershaw, E.E.; Flier, J.S. Adipose Tissue as an Endocrine Organ. J. Clin. Endocrinol. Metab. 2004, 89, 2548–2556. [Google Scholar] [CrossRef]
- Vitali, A.; Murano, I.; Zingaretti, M.C.; Frontini, A.; Ricquier, D.; Cinti, S. The adipose organ of obesity-prone C57BL/6J mice is composed of mixed white and brown adipocytes. J. Lipid Res. 2012, 53, 619–629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cannon, B.; Nedergaard, J. Brown adipose tissue: Function and physiological significance. Physiol. Rev. 2004, 84, 277–359. [Google Scholar] [CrossRef]
- Sakers, A.; De Siqueira, M.-j.K.; Seale, P.; Villanueva, C.J. Adipose-tissue plasticity in health and disease. Cell 2022, 185, 419–446. [Google Scholar] [CrossRef]
- Lee, Y.H.; Mottillo, E.P.; Granneman, J.G. Adipose tissue plasticity from WAT to BAT and in between. Biochim. Biophys Acta 2014, 1842, 358–369. [Google Scholar] [CrossRef] [Green Version]
- Yehuda-Shnaidman, E.; Buehrer, B.; Pi, J.; Kumar, N.; Collins, S. Acute stimulation of white adipocyte respiration by PKA-induced lipolysis. Diabetes 2010, 59, 2474–2483. [Google Scholar] [CrossRef] [Green Version]
- Mottillo, E.P.; Bloch, A.E.; Leff, T.; Granneman, J.G. Lipolytic products activate peroxisome proliferator-activated receptor (PPAR) α and δ in brown adipocytes to match fatty acid oxidation with supply. J. Biol. Chem. 2012, 287, 25038–25048. [Google Scholar] [CrossRef] [Green Version]
- Ananingsih, V.K.; Sharma, A.; Zhou, W. Green tea catechins during food processing and storage: A review on stability and detection. Food Res. Int. 2013, 50, 469–479. [Google Scholar] [CrossRef]
- Ikeda, I.; Hamamoto, R.; Uzu, K.; Imaizumi, K.; Nagao, K.; Yanagita, T.; Suzuki, Y.; Kobayashi, M.; Kakuda, T. Dietary Gallate Esters of Tea Catechins Reduce Deposition of Visceral Fat, Hepatic Triacylglycerol, and Activities of Hepatic Enzymes Related to Fatty Acid Synthesis in Rats. Biosci. Biotechnol. Biochem. 2005, 69, 1049–1053. [Google Scholar] [CrossRef] [Green Version]
- Im, H.; Lee, J.; Kim, K.; Son, Y.; Lee, Y.-H. Anti-obesity effects of heat-transformed green tea extract through the activation of adipose tissue thermogenesis. Nutr. Metab. 2022, 19, 14. [Google Scholar] [CrossRef] [PubMed]
- Valentová, K.; Vrba, J.; Bancířová, M.; Ulrichová, J.; Křen, V. Isoquercitrin: Pharmacology, toxicology, and metabolism. Food Chem. Toxicol. 2014, 68, 267–282. [Google Scholar] [CrossRef] [PubMed]
- Akiyama, T.; Washino, T.; Yamada, T.; Koda, T.; Maitani, T. Constituents of enzymatically modified isoquercitrin and enzymatically modified rutin (extract). Food Hyg. Saf. Sci. Shokuhin Eiseigaku Zasshi 2000, 41, 54–60. [Google Scholar] [CrossRef] [Green Version]
- Murota, K.; Matsuda, N.; Kashino, Y.; Fujikura, Y.; Nakamura, T.; Kato, Y.; Shimizu, R.; Okuyama, S.; Tanaka, H.; Koda, T.; et al. α-Oligoglucosylation of a sugar moiety enhances the bioavailability of quercetin glucosides in humans. Arch. Biochem. Biophys. 2010, 501, 91–97. [Google Scholar] [CrossRef]
- Jiang, H.; Yoshioka, Y.; Yuan, S.; Horiuchi, Y.; Yamashita, Y.; Croft, K.D.; Ashida, H. Enzymatically modified isoquercitrin promotes energy metabolism through activating AMPKα in male C57BL/6 mice. Food Funct. 2019, 10, 5188–5202. [Google Scholar] [CrossRef]
- Kim, M.; Im, S.; Cho, Y.K.; Choi, C.; Son, Y.; Kwon, D.; Jung, Y.S.; Lee, Y.H. Anti-Obesity Effects of Soybean Embryo Extract and Enzymatically-Modified Isoquercitrin. Biomolecules 2020, 10, 1394. [Google Scholar] [CrossRef]
- Hasumura, M.; Yasuhara, K.; Tamura, T.; Imai, T.; Mitsumori, K.; Hirose, M. Evaluation of the toxicity of enzymatically decomposed rutin with 13-weeks dietary administration to Wistar rats. Food Chem. Toxicol. 2004, 42, 439–444. [Google Scholar] [CrossRef]
- Judex, S.; Luu, Y.K.; Ozcivici, E.; Adler, B.; Lublinsky, S.; Rubin, C.T. Quantification of adiposity in small rodents using micro-CT. Methods 2010, 50, 14–19. [Google Scholar] [CrossRef] [Green Version]
- Luu, Y.K.; Lublinsky, S.; Ozcivici, E.; Capilla, E.; Pessin, J.E.; Rubin, C.T.; Judex, S. In vivo quantification of subcutaneous and visceral adiposity by micro-computed tomography in a small animal model. Med. Eng. Phys. 2009, 31, 34–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, C.; Song, H.D.; Son, Y.; Cho, Y.K.; Ahn, S.Y.; Jung, Y.S.; Yoon, Y.C.; Kwon, S.W.; Lee, Y.H. Epigallocatechin-3-Gallate Reduces Visceral Adiposity Partly through the Regulation of Beclin1-Dependent Autophagy in White Adipose Tissues. Nutrients 2020, 12, 3072. [Google Scholar] [CrossRef]
- Ayala, J.E.; Samuel, V.T.; Morton, G.J.; Obici, S.; Croniger, C.M.; Shulman, G.I.; Wasserman, D.H.; McGuinness, O.P.; NIH Mouse Metabolic Phenotyping Center Consortium. Standard operating procedures for describing and performing metabolic tests of glucose homeostasis in mice. Dis. Model. Mech. 2010, 3, 525–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seo, D.-B.; Jeong, H.W.; Kim, Y.-J.; Kim, S.; Kim, J.; Lee, J.H.; Joo, K.; Choi, J.K.; Shin, S.S.; Lee, S.-J. Fermented green tea extract exhibits hypolipidaemic effects through the inhibition of pancreatic lipase and promotion of energy expenditure. Br. J. Nutr. 2017, 117, 177–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kraus, D.; Yang, Q.; Kahn, B.B. Lipid Extraction from Mouse Feces. Bio. Protoc. 2015, 5, e1375. [Google Scholar] [CrossRef] [Green Version]
- Cho, Y.K.; Yoon, Y.C.; Im, H.; Son, Y.; Kim, M.; Saha, A.; Choi, C.; Lee, J.; Lee, S.; Kim, J.H.; et al. Adipocyte lysoplasmalogenase TMEM86A regulates plasmalogen homeostasis and protein kinase A-dependent energy metabolism. Nat. Commun. 2022, 13, 4084. [Google Scholar] [CrossRef]
- Ikeda, I.; Tsuda, K.; Suzuki, Y.; Kobayashi, M.; Unno, T.; Tomoyori, H.; Goto, H.; Kawata, Y.; Imaizumi, K.; Nozawa, A.; et al. Tea catechins with a galloyl moiety suppress postprandial hypertriacylglycerolemia by delaying lymphatic transport of dietary fat in rats. J. Nutr. 2005, 135, 155–159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, J.-F.; Wang, W.-J.; Yin, Z.-P.; Zheng, G.-D.; Chen, J.-G.; Li, J.-E.; Chen, L.-L.; Zhang, Q.-F. Quercetin is a promising pancreatic lipase inhibitor in reducing fat absorption in vivo. Food Biosci. 2021, 43, 101248. [Google Scholar] [CrossRef]
- Lee, J.H.; Park, A.; Oh, K.-J.; Lee, S.C.; Kim, W.K.; Bae, K.-H. The Role of Adipose Tissue Mitochondria: Regulation of Mitochondrial Function for the Treatment of Metabolic Diseases. Int. J. Mol. Sci. 2019, 20, 4924. [Google Scholar] [CrossRef] [Green Version]
- Alberdi, G.; Rodríguez, V.M.; Miranda, J.; Macarulla, M.T.; Churruca, I.; Portillo, M.P. Thermogenesis is involved in the body-fat lowering effects of resveratrol in rats. Food Chem. 2013, 141, 1530–1535. [Google Scholar] [CrossRef]
- Lone, J.; Choi, J.H.; Kim, S.W.; Yun, J.W. Curcumin induces brown fat-like phenotype in 3T3-L1 and primary white adipocytes. J. Nutr. Biochem. 2016, 27, 193–202. [Google Scholar] [CrossRef]
- Lee, M.S.; Shin, Y.; Jung, S.; Kim, Y. Effects of epigallocatechin-3-gallate on thermogenesis and mitochondrial biogenesis in brown adipose tissues of diet-induced obese mice. Food Nutr. Res. 2017, 61, 1325307. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Osaki, N.; Shimotoyodome, A. Green tea catechins enhance norepinephrine-induced lipolysis via a protein kinase A-dependent pathway in adipocytes. Biochem. Biophys. Res. Commun. 2015, 461, 1–7. [Google Scholar] [CrossRef]
- Jiang, H.; Horiuchi, Y.; Hironao, K.Y.; Kitakaze, T.; Yamashita, Y.; Ashida, H. Prevention effect of quercetin and its glycosides on obesity and hyperglycemia through activating AMPKα in high-fat diet-fed ICR mice. J. Clin. Biochem. Nutr. 2020, 67, 74–83. [Google Scholar] [CrossRef]
- Ye, Y.; Liu, H.; Zhang, F.; Hu, F. mTOR signaling in Brown and Beige adipocytes: Implications for thermogenesis and obesity. Nutr. Metab. 2019, 16, 74. [Google Scholar] [CrossRef]
- Peng, Y.; Yu, S.; Li, H.; Xiang, H.; Peng, J.; Jiang, S. MicroRNAs: Emerging roles in adipogenesis and obesity. Cell. Signal. 2014, 26, 1888–1896. [Google Scholar] [CrossRef]
- Houde, A.-A.; Légaré, C.; Biron, S.; Lescelleur, O.; Biertho, L.; Marceau, S.; Tchernof, A.; Vohl, M.-C.; Hivert, M.-F.; Bouchard, L. Leptin and adiponectin DNA methylation levels in adipose tissues and blood cells are associated with BMI, waist girth and LDL-cholesterol levels in severely obese men and women. BMC Med. Genet. 2015, 16, 29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vahid, F.; Zand, H.; Nosrat–Mirshekarlou, E.; Najafi, R.; Hekmatdoost, A. The role dietary of bioactive compounds on the regulation of histone acetylases and deacetylases: A review. Gene 2015, 562, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Otton, R.; Bolin, A.P.; Ferreira, L.T.; Marinovic, M.P.; Rocha, A.L.S.; Mori, M.A. Polyphenol-rich green tea extract improves adipose tissue metabolism by down-regulating miR-335 expression and mitigating insulin resistance and inflammation. J. Nutr. Biochem. 2018, 57, 170–179. [Google Scholar] [CrossRef] [PubMed]
- Nettore, I.C.; Rocca, C.; Mancino, G.; Albano, L.; Amelio, D.; Grande, F.; Puoci, F.; Pasqua, T.; Desiderio, S.; Mazza, R.; et al. Quercetin and its derivative Q2 modulate chromatin dynamics in adipogenesis and Q2 prevents obesity and metabolic disorders in rats. J. Nutr. Biochem. 2019, 69, 151–162. [Google Scholar] [CrossRef]
Gene | Forward 5′-3′ | Reverse 5′-3′ |
---|---|---|
Ppia | GTGGTCTTTGGGAAGGTGAA | TTACAGGACATTGCGAGCAG |
Ucp1 | TGGCCTCTCAGTGGATGTG | CGTGGTCTCCCAGCATAGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moon, Y.-j.; Kim, H.-s.; Kim, M.-j.; Im, H.-y.; Lee, Y.-h. Synergistic Effects of Heat-Treated Green Tea Extract and Enzymatically-Modified Isoquercitrin in Preventing Obesity. Nutrients 2023, 15, 2931. https://doi.org/10.3390/nu15132931
Moon Y-j, Kim H-s, Kim M-j, Im H-y, Lee Y-h. Synergistic Effects of Heat-Treated Green Tea Extract and Enzymatically-Modified Isoquercitrin in Preventing Obesity. Nutrients. 2023; 15(13):2931. https://doi.org/10.3390/nu15132931
Chicago/Turabian StyleMoon, Ye-jin, Hee-seong Kim, Min-ji Kim, Hyeon-yeong Im, and Yun-hee Lee. 2023. "Synergistic Effects of Heat-Treated Green Tea Extract and Enzymatically-Modified Isoquercitrin in Preventing Obesity" Nutrients 15, no. 13: 2931. https://doi.org/10.3390/nu15132931