Agarwood Oil Nanoemulsion Attenuates Cigarette Smoke-Induced Inflammation and Oxidative Stress Markers in BCi-NS1.1 Airway Epithelial Cells
Abstract
:1. Introduction
2. Methods
2.1. Preparation of Agarwood-NE
2.2. Cell Culture and Agarwood-NE Treatment
2.3. Cell Viability
2.4. Real Time-qPCR
2.5. Human Cytokine Protein Array
2.6. Statistical Analysis
3. Results
3.1. Identification of an Optimal Concentration of Agarwood-NE for Treatment in CSE-Induced BCi-NS1.1 Cells
3.2. Agarwood-NE Inhibits the CSE-Induced Transcription of the Pro-Inflammatory Cytokine IL-8
3.3. Agarwood-NE Inhibits the CSE-Induced Protein Expression of Pro-Inflammatory Cytokines and Mediators
3.4. Agarwood-NE Stimulates the CSE-Inhibited Protein Expression of Anti-Inflammatory Cytokines and Mediators
3.5. Agarwood-NE Stimulates the CSE-Inhibited Transcription of Antioxidant Genes
3.6. Agarwood-NE Stimulates the CSE-Inhibited Transcription of the Pro-Survival Gene PI3K
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Eapen, M.S.; Myers, S.; Walters, E.H.; Sohal, S.S. Airway inflammation in chronic obstructive pulmonary disease (COPD): A true paradox. Expert Rev. Respir. Med. 2017, 11, 827–839. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Jarnicki, A.G.; Paudel, K.R.; Lu, W.; Wadhwa, R.; Philp, A.M.; Van Eeckhoutte, H.; Marshall, J.E.; Malyla, V.; Katsifis, A.; et al. Adverse roles of mast cell chymase-1 in chronic obstructive pulmonary disease. Eur. Respir. J. 2022, 60, 2101431. [Google Scholar] [CrossRef] [PubMed]
- Vogelmeier, C.F.; Criner, G.J.; Martínez, F.J.; Anzueto, A.; Barnes, P.J.; Bourbeau, J.; Celli, B.R.; Chen, R.; Decramer, M.; Fabbri, L.M.; et al. Global Strategy for the Diagnosis, Management, and Prevention of Chronic Obstructive Lung Disease 2017 Report: GOLD Executive Summary. Arch. Bronconeumol. 2017, 53, 128–149. [Google Scholar] [CrossRef] [PubMed]
- Bollmeier, S.G.; Hartmann, A.P. Management of chronic obstructive pulmonary disease: A review focusing on exacerbations. Am. J. Health Syst. Pharm. 2020, 77, 259–268. [Google Scholar] [CrossRef] [Green Version]
- Mehta, M.; Dhanjal, D.S.; Paudel, K.R.; Singh, B.; Gupta, G.; Rajeshkumar, S.; Thangavelu, L.; Tambuwala, M.M.; Bakshi, H.A.; Chellappan, D.K.; et al. Cellular signalling pathways mediating the pathogenesis of chronic inflammatory respiratory diseases: An update. Inflammopharmacology 2020, 28, 795–817. [Google Scholar] [CrossRef]
- Lugg, S.T.; Scott, A.; Parekh, D.; Naidu, B.; Thickett, D.R. Cigarette smoke exposure and alveolar macrophages: Mechanisms for lung disease. Thorax 2022, 77, 94–101. [Google Scholar] [CrossRef]
- Dua, K.; Malyla, V.; Singhvi, G.; Wadhwa, R.; Krishna, R.V.; Shukla, S.D.; Shastri, M.D.; Chellappan, D.K.; Maurya, P.K.; Satija, S.; et al. Increasing complexity and interactions of oxidative stress in chronic respiratory diseases: An emerging need for novel drug delivery systems. Chemico.-Biological. Interactions 2019, 299, 168–178. [Google Scholar] [CrossRef] [Green Version]
- Mehta, M.; Paudel, K.R.; Shukla, S.D.; Shastri, M.D.; Satija, S.; Singh, S.K.; Gulati, M.; Dureja, H.; Zacconi, F.C.; Hansbro, P.M.; et al. Rutin-loaded liquid crystalline nanoparticles attenuate oxidative stress in bronchial epithelial cells: A PCR validation. Future Med. Chem. 2021, 13, 543–549. [Google Scholar] [CrossRef]
- Malyla, V.; Paudel, K.R.; Shukla, S.D.; Donovan, C.; Wadhwa, R.; Pickles, S.; Chimankar, V.; Sahu, P.; Bielefeldt-Ohmann, H.; Bebawy, M.; et al. Recent advances in experimental animal models of lung cancer. Future Med. Chem. 2020, 12, 567–570. [Google Scholar] [CrossRef]
- Albano, G.D.; Gagliardo, R.P.; Montalbano, A.M.; Profita, M. Overview of the Mechanisms of Oxidative Stress: Impact in Inflammation of the Airway Diseases. Antioxidants 2022, 11, 2237. [Google Scholar] [CrossRef]
- Milad, N.; Pineault, M.; Lechasseur, A.; Routhier, J.; Beaulieu, M.J.; Aubin, S.; Morissette, M.C. Neutrophils and IL-1α Regulate Surfactant Homeostasis during Cigarette Smoking. J. Immunol. 2021, 206, 1923–1931. [Google Scholar] [CrossRef]
- Paudel, K.R.; Panth, N.; Manandhar, B.; Singh, S.K.; Gupta, G.; Wich, P.R.; Nammi, S.; MacLoughlin, R.; Adams, J.; Warkiani, M.E.; et al. Attenuation of Cigarette-Smoke-Induced Oxidative Stress, Senescence, and Inflammation by Berberine-Loaded Liquid Crystalline Nanoparticles: In Vitro Study in 16HBE and RAW264.7 Cells. Antioxidants 2022, 11, 873. [Google Scholar] [CrossRef]
- Mio, T.; Romberger, D.J.; Thompson, A.B.; Robbins, R.A.; Heires, A.; Rennard, S.I. Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells. Am. J. Respir. Crit. Care. Med. 1997, 155, 1770–1776. [Google Scholar] [CrossRef]
- Kaplanski, G. Interleukin-18: Biological properties and role in disease pathogenesis. Immunol. Rev. 2018, 281, 138–153. [Google Scholar] [CrossRef] [Green Version]
- Jiang, G.; Liu, C.T.; Zhang, W.D. IL-17A and GDF15 are able to induce epithelial-mesenchymal transition of lung epithelial cells in response to cigarette smoke. Exp. Ther. Med. 2018, 16, 12–20. [Google Scholar] [CrossRef] [Green Version]
- Hu, X.; Hong, B.; Sun, M. Peitu Shengjin Recipe Attenuates Airway Inflammation via the TLR4/NF-kB Signaling Pathway on Chronic Obstructive Pulmonary Disease. Evid. Based Complement. Alternat. Med. 2022, 2022, 2090478. [Google Scholar] [CrossRef]
- Mueller, T.; Leitner, I.; Egger, M.; Haltmayer, M.; Dieplinger, B. Association of the biomarkers soluble ST2, galectin-3 and growth-differentiation factor-15 with heart failure and other non-cardiac diseases. Clin. Chim. Acta 2015, 445, 155–160. [Google Scholar] [CrossRef] [Green Version]
- Novick, D.; Kim, S.-H.; Fantuzzi, G.; Reznikov, L.L.; Dinarello, C.A.; Rubinstein, M. Interleukin-18 binding protein: A novel modulator of the Th1 cytokine response. Immunity 1999, 10, 127–136. [Google Scholar] [CrossRef] [Green Version]
- Kratzer, A.; Salys, J.; Nold-Petry, C.; Cool, C.; Zamora, M.; Bowler, R.; Koczulla, A.R.; Janciauskiene, S.; Edwards, M.G.; Dinarello, C.A.; et al. Role of IL-18 in second-hand smoke-induced emphysema. Am. J. Respir. Cell Mol. Biol. 2013, 48, 725–732. [Google Scholar] [CrossRef] [Green Version]
- Soler Palacios, B.; Nieto, C.; Fajardo, P.; González de la Aleja, A.; Andrés, N.; Dominguez-Soto, Á.; Lucas, P.; Cuenda, A.; Rodríguez-Frade, J.M.; Martínez, A.C.; et al. Growth Hormone Reprograms Macrophages toward an Anti-Inflammatory and Reparative Profile in an MAFB-Dependent Manner. J. Immunol. 2020, 205, 776–788. [Google Scholar] [CrossRef]
- Tweed, J.O.; Hsia, S.H.; Lutfy, K.; Friedman, T.C. The endocrine effects of nicotine and cigarette smoke. Trends Endocrinol. Metab. 2012, 23, 334–342. [Google Scholar] [CrossRef] [Green Version]
- Kew, R.R. The Vitamin D Binding Protein and Inflammatory Injury: A Mediator or Sentinel of Tissue Damage? Front. Endocrinol. 2019, 10, 470. [Google Scholar] [CrossRef] [PubMed]
- Bortner, J.D., Jr.; Richie, J.P., Jr.; Das, A.; Liao, J.; Umstead, T.M.; Stanley, A.; Stanley, B.A.; Belani, C.P.; El-Bayoumy, K. Proteomic profiling of human plasma by iTRAQ reveals down-regulation of ITI-HC3 and VDBP by cigarette smoking. J. Proteome. Res. 2011, 10, 1151–1159. [Google Scholar] [CrossRef] [PubMed]
- Kardas, G.; Daszyńska-Kardas, A.; Marynowski, M.; Brząkalska, O.; Kuna, P.; Panek, M. Role of Platelet-Derived Growth Factor (PDGF) in Asthma as an Immunoregulatory Factor Mediating Airway Remodeling and Possible Pharmacological Target. Front. Pharmacol. 2020, 11, 47. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wei, J.; Shang, F.; Zang, K.; Ji, T. Platelet-derived growth factor B attenuates lethal sepsis through inhibition of inflammatory responses. Int. Immunopharmacol. 2019, 75, 105792. [Google Scholar] [CrossRef]
- Pini, A.; Boccalini, G.; Baccari, M.C.; Becatti, M.; Garella, R.; Fiorillo, C.; Calosi, L.; Bani, D.; Nistri, S. Protection from cigarette smoke-induced vascular injury by recombinant human relaxin-2 (serelaxin). J. Cell Mol. Med. 2016, 20, 891–902. [Google Scholar] [CrossRef]
- Thim, L.; May, F.E. Structure of mammalian trefoil factors and functional insights. Cell Mol. Life Sci. 2005, 62, 2956–2973. [Google Scholar] [CrossRef]
- Bijelić, N.; Belovari, T.; Tolušić Levak, M.; Baus Lončar, M. Localization of trefoil factor family peptide 3 (TFF3) in epithelial tissues originating from the three germ layers of developing mouse embryo. Bosn. J. Basic Med. Sci. 2017, 17, 241–247. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.H.; Zheng, F.J.; Huang, Y.; Zhong, X.G.; Guo, M.Z. Synergistic anti-inflammatory effect of Radix Platycodon in combination with herbs for cleaning-heat and detoxification and its mechanism. Chin. J. Integr. Med. 2013, 19, 29–35. [Google Scholar] [CrossRef]
- Li, T.; Fanning, K.V.; Nyunoya, T.; Chen, Y.; Zou, C. Cigarette smoke extract induces airway epithelial cell death via repressing PRMT6/AKT signaling. Aging 2020, 12, 24301–24317. [Google Scholar] [CrossRef]
- Duffney, P.F.; McCarthy, C.E.; Nogales, A.; Thatcher, T.H.; Martinez-Sobrido, L.; Phipps, R.P.; Sime, P.J. Cigarette smoke dampens antiviral signaling in small airway epithelial cells by disrupting TLR3 cleavage. Am. J. Physiol. Lung Cell Mol. Physiol. 2018, 314, L505–L513. [Google Scholar] [CrossRef] [Green Version]
- Modestou, M.A.; Manzel, L.J.; El-Mahdy, S.; Look, D.C. Inhibition of IFN-gamma-dependent antiviral airway epithelial defense by cigarette smoke. Respir. Res. 2010, 11, 64. [Google Scholar] [CrossRef] [Green Version]
- Leung, J.M.; Tiew, P.Y.; Mac Aogáin, M.; Budden, K.F.; Yong, V.F.; Thomas, S.S.; Pethe, K.; Hansbro, P.M.; Chotirmall, S.H. The role of acute and chronic respiratory colonization and infections in the pathogenesis of COPD. Respirology 2017, 22, 634–650. [Google Scholar] [CrossRef] [Green Version]
- Nucera, F.; Mumby, S.; Paudel, K.R.; Dharwal, V.; Di Stefano, A.; Casolaro, V.; Hansbro, P.M.; Adcock, I.M.; Caramori, G. Role of oxidative stress in the pathogenesis of COPD. Minerva Med. 2022, 113, 370–404. [Google Scholar] [CrossRef]
- Panth, N.; Paudel, K.R.; Parajuli, K. Reactive Oxygen Species: A Key Hallmark of Cardiovascular Disease. Adv. Med. 2016, 2016, 9152732. [Google Scholar] [CrossRef] [Green Version]
- Ketterer, B.; Coles, B.; Meyer, D.J. The role of glutathione in detoxication. Environ. Health Perspect. 1983, 49, 59–69. [Google Scholar] [CrossRef]
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative stress and antioxidant defense. World Allergy Organ. J. 2012, 5, 9–19. [Google Scholar] [CrossRef] [Green Version]
- Mao, G.E.; Morris, G.; Lu, Q.Y.; Cao, W.; Reuter, V.E.; Cordon-Cardo, C.; Dalbagni, G.; Scher, H.I.; De Kernion, J.B.; Zhang, Z.F. Glutathione S-transferase P1 Ile105Val polymorphism, cigarette smoking and prostate cancer. Cancer Detect. Prev. 2004, 28, 368–374. [Google Scholar] [CrossRef]
- Harju, T.; Mazur, W.; Merikallio, H.; Soini, Y.; Kinnula, V.L. Glutathione-S-transferases in lung and sputum specimens, effects of smoking and COPD severity. Respir. Res. 2008, 9, 80. [Google Scholar] [CrossRef] [Green Version]
- Putcha, N.; Wise, R.A. Medication Regimens for Managing COPD Exacerbations. Respir Care 2018, 63, 773–782. [Google Scholar] [CrossRef]
- Allam, V.; Paudel, K.R.; Gupta, G.; Singh, S.K.; Vishwas, S.; Gulati, M.; Gupta, S.; Chaitanya, M.; Jha, N.K.; Gupta, P.K.; et al. Nutraceuticals and mitochondrial oxidative stress: Bridging the gap in the management of bronchial asthma. Environ. Sci. Pollut. Res. Int. 2022, 29, 62733–62754. [Google Scholar] [CrossRef] [PubMed]
- Kuo, C.L.; Chi, C.W.; Liu, T.Y. The anti-inflammatory potential of berberine in vitro and in vivo. Cancer Lett. 2004, 203, 127–137. [Google Scholar] [CrossRef] [PubMed]
- Mehta, M.; Malyla, V.; Paudel, K.R.; Chellappan, D.K.; Hansbro, P.M.; Oliver, B.G.; Dua, K. Berberine loaded liquid crystalline nanostructure inhibits cancer progression in adenocarcinomic human alveolar basal epithelial cells in vitro. J. Food Biochem. 2021, 45, e13954. [Google Scholar] [CrossRef] [PubMed]
- Hardwick, J.; Taylor, J.; Mehta, M.; Satija, S.; Paudel, K.R.; Hansbro, P.M.; Chellappan, D.K.; Bebawy, M.; Dua, K. Targeting Cancer using Curcumin Encapsulated Vesicular Drug Delivery Systems. Curr. Pharm. Des. 2021, 27, 2–14. [Google Scholar] [CrossRef]
- Paudel, K.R.; Wadhwa, R.; Mehta, M.; Chellappan, D.K.; Hansbro, P.M.; Dua, K. Rutin loaded liquid crystalline nanoparticles inhibit lipopolysaccharide induced oxidative stress and apoptosis in bronchial epithelial cells in vitro. Toxicol. In Vitro 2020, 68, 104961. [Google Scholar] [CrossRef]
- Solanki, N.; Mehta, M.; Chellappan, D.K.; Gupta, G.; Hansbro, N.G.; Tambuwala, M.M.; Aa Aljabali, A.; Paudel, K.R.; Liu, G.; Satija, S.; et al. Antiproliferative effects of boswellic acid-loaded chitosan nanoparticles on human lung cancer cell line A549. Future Med. Chem. 2020, 12, 2019–2034. [Google Scholar] [CrossRef]
- Kim, E.; Kim, Y.J.; Ji, Z.; Kang, J.M.; Wirianto, M.; Paudel, K.R.; Smith, J.A.; Ono, K.; Kim, J.A.; Eckel-Mahan, K.; et al. ROR activation by Nobiletin enhances antitumor efficacy via suppression of IkappaB/NF-kappaB signaling in triple-negative breast cancer. Cell Death Dis. 2022, 13, 374. [Google Scholar] [CrossRef]
- Rodríguez-Yoldi, M.J. Anti-Inflammatory and Antioxidant Properties of Plant Extracts. Antioxidants 2021, 10, 921. [Google Scholar] [CrossRef]
- Kim, T.M.; Paudel, K.R.; Kim, D.W. Eriobotrya japonica leaf extract attenuates airway inflammation in ovalbumin-induced mice model of asthma. J. Ethnopharmacol. 2020, 253, 112082. [Google Scholar] [CrossRef]
- Lee, H.H.; Paudel, K.R.; Kim, D.W. Terminalia chebula Fructus Inhibits Migration and Proliferation of Vascular Smooth Muscle Cells and Production of Inflammatory Mediators in RAW 264.7. Evid. Based Complement. Alternat. Med. 2015, 2015, 502182. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Chen, H.; Yang, Y.; Zhang, Z.; Wei, J.; Meng, H.; Chen, W.; Feng, J.; Gan, B.; Chen, X.; et al. Whole-tree agarwood-inducing technique: An efficient novel technique for producing high-quality agarwood in cultivated Aquilaria sinensis trees. Molecules 2013, 18, 3086–3106. [Google Scholar] [CrossRef]
- Wang, S.; Yu, Z.; Wang, C.; Wu, C.; Guo, P.; Wei, J. Chemical Constituents and Pharmacological Activity of Agarwood and Aquilaria Plants. Molecules 2018, 23. [Google Scholar] [CrossRef] [Green Version]
- Alamil, J.M.R.; Paudel, K.R.; Chan, Y.; Xenaki, D.; Panneerselvam, J.; Singh, S.K.; Gulati, M.; Jha, N.K.; Kumar, D.; Prasher, P.; et al. Rediscovering the Therapeutic Potential of Agarwood in the Management of Chronic Inflammatory Diseases. Molecules 2022, 27, 3038. [Google Scholar] [CrossRef]
- Peng, D.-Q.; Yu, Z.-X.; Wang, C.-H.; Gong, B.; Liu, Y.-Y.; Wei, J.-H. Chemical Constituents and Anti-Inflammatory Effect of Incense Smoke from Agarwood Determined by GC-MS. Int. J. Anal. Chem. 2020, 2020, 4575030. [Google Scholar] [CrossRef]
- Yadav, D.K.; Mudgal, V.; Agrawal, J.; Maurya, A.K.; Bawankule, D.U.; Chanotiya, C.S.; Khan, F.; Thul, S.T. Molecular docking and ADME studies of natural compounds of Agarwood oil for topical anti-inflammatory activity. Curr. Comput. Aided Drug Des. 2013, 9, 360–370. [Google Scholar] [CrossRef]
- Chitre, T.; Bhutada, P.; Nandakumar, K.; Somani, R.; Miniyar, P.; Mundhada, Y.; Gore, S.; Jain, K. Analgesic and anti-inflammatory activity of heartwood of Aquilaria agallocha in laboratory animals. Pharmacol. Online 2007, 1, 288–298. [Google Scholar]
- Zheng, H.; Gao, J.; Man, S.; Zhang, J.; Jin, Z.; Gao, W. The protective effects of Aquilariae Lignum Resinatum extract on 5-Fuorouracil-induced intestinal mucositis in mice. Phytomedicine 2019, 54, 308–317. [Google Scholar] [CrossRef]
- Wang, C.; Wang, S.; Peng, D.; Yu, Z.; Guo, P.; Wei, J. Agarwood Extract Mitigates Intestinal Injury in Fluorouracil-Induced Mice. Biol. Pharm. Bull. 2019, 42, 1112–1119. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Peng, D.; Liu, Y.; Wu, Y.; Guo, P.; Wei, J. Agarwood Alcohol Extract Protects against Gastric Ulcer by Inhibiting Oxidation and Inflammation. Evid. Based. Complement. Alternat. Med. 2021, 2021, 9944685. [Google Scholar] [CrossRef]
- Hamouda, A.F. A biochemical study of agarwood on methanol injection in rat. J. Drug Alcohol Res. 2019, 8, 1–14. [Google Scholar]
- Liu, C.S.; Zheng, Y.R.; Zhang, Y.F.; Long, X.Y. Research progress on berberine with a special focus on its oral bioavailability. Fitoterapia 2016, 109, 274–282. [Google Scholar] [CrossRef] [PubMed]
- Ng, P.Q.; Ling, L.S.C.; Chellian, J.; Madheswaran, T.; Panneerselvam, J.; Kunnath, A.P.; Gupta, G.; Satija, S.; Mehta, M.; Hansbro, P.M.; et al. Applications of Nanocarriers as Drug Delivery Vehicles for Active Phytoconstituents. Curr. Pharm. Des. 2020, 26, 4580–4590. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.; Mehta, M.; Paudel, K.R.; Madheswaran, T.; Panneerselvam, J.; Gupta, G.; Su, Q.P.; Hansbro, P.M.; MacLoughlin, R.; Dua, K.; et al. Versatility of liquid crystalline nanoparticles in inflammatory lung diseases. Nanomedicine 2021, 16, 1545–1548. [Google Scholar] [CrossRef] [PubMed]
- Paudel, K.R.; Chellappan, D.K.; MacLoughlin, R.; Pinto, T.J.A.; Dua, K.; Hansbro, P.M. Editorial: Advanced therapeutic delivery for the management of chronic respiratory diseases. Front. Med. 2022, 9, 983583. [Google Scholar] [CrossRef] [PubMed]
- Paudel, K.R.; Dua, K.; Panth, N.; Hansbro, P.M.; Chellappan, D.K. Advances in research with rutin-loaded nanoformulations in mitigating lung diseases. Future Med. Chem. 2022, 14, 1293–1295. [Google Scholar] [CrossRef]
- Clarence, D.D.; Paudel, K.R.; Manandhar, B.; Singh, S.K.; Devkota, H.P.; Panneerselvam, J.; Gupta, V.; Chitranshi, N.; Verma, N.; Saad, S.; et al. Unravelling the Therapeutic Potential of Nano-Delivered Functional Foods in Chronic Respiratory Diseases. Nutrients 2022, 14, 3828. [Google Scholar] [CrossRef]
- Jaiswal, M.; Dudhe, R.; Sharma, P.K. Nanoemulsion: An advanced mode of drug delivery system. 3 Biotech 2015, 5, 123–127. [Google Scholar] [CrossRef] [Green Version]
- Dupuis, V.; Cerbu, C.; Witkowski, L.; Potarniche, A.V.; Timar, M.C.; Żychska, M.; Sabliov, C.M. Nanodelivery of essential oils as efficient tools against antimicrobial resistance: A review of the type and physical-chemical properties of the delivery systems and applications. Drug Deliv. 2022, 29, 1007–1024. [Google Scholar] [CrossRef]
- Alnuqaydan, A.M.; Almutary, A.G.; Azam, M.; Manandhar, B.; Yin, G.H.S.; Yen, L.L.; Madheswaran, T.; Paudel, K.R.; Hansbro, P.M.; Chellappan, D.K.; et al. Evaluation of the Cytotoxic Activity and Anti-Migratory Effect of Berberine-Phytantriol Liquid Crystalline Nanoparticle Formulation on Non-Small-Cell Lung Cancer In Vitro. Pharmaceutics 2022, 14, 1119. [Google Scholar] [CrossRef]
- Wadhwa, R.; Paudel, K.R.; Chin, L.H.; Hon, C.M.; Madheswaran, T.; Gupta, G.; Panneerselvam, J.; Lakshmi, T.; Singh, S.K.; Gulati, M.; et al. Anti-inflammatory and anticancer activities of Naringenin-loaded liquid crystalline nanoparticles in vitro. J. Food Biochem. 2021, 45, e13572. [Google Scholar] [CrossRef]
- King, P.T. Inflammation in chronic obstructive pulmonary disease and its role in cardiovascular disease and lung cancer. Clin. Transl. Med. 2015, 4, 68. [Google Scholar] [CrossRef] [Green Version]
- Chellappan, D.K.; Yee, L.W.; Xuan, K.Y.; Kunalan, K.; Rou, L.C.; Jean, L.S.; Ying, L.Y.; Wie, L.X.; Chellian, J.; Mehta, M.; et al. Targeting neutrophils using novel drug delivery systems in chronic respiratory diseases. Drug Dev. Res. 2020, 81, 419–436. [Google Scholar] [CrossRef]
- Paudel, K.R.; Dharwal, V.; Patel, V.K.; Galvao, I.; Wadhwa, R.; Malyla, V.; Shen, S.S.; Budden, K.F.; Hansbro, N.G.; Vaughan, A.; et al. Role of Lung Microbiome in Innate Immune Response Associated With Chronic Lung Diseases. Front. Med. 2020, 7, 554. [Google Scholar] [CrossRef]
- May, S.M.; Li, J.T. Burden of chronic obstructive pulmonary disease: Healthcare costs and beyond. Allergy Asthma Proc. 2015, 36, 4–10. [Google Scholar] [CrossRef] [Green Version]
- Eisner, M.D.; Anthonisen, N.; Coultas, D.; Kuenzli, N.; Perez-Padilla, R.; Postma, D.; Romieu, I.; Silverman, E.K.; Balmes, J.R. An official American Thoracic Society public policy statement: Novel risk factors and the global burden of chronic obstructive pulmonary disease. Am. J. Respir. Crit. Care. Med. 2010, 182, 693–718. [Google Scholar] [CrossRef]
- Biswas, S.K. Does the Interdependence between Oxidative Stress and Inflammation Explain the Antioxidant Paradox? Oxid. Med. Cell Longev. 2016, 2016, 5698931. [Google Scholar] [CrossRef] [Green Version]
- Chellappan, D.K.; Dharwal, V.; Paudel, K.R.; Jha, N.K.; MacLoughlin, R.; Oliver, B.G.; Dua, K. Mitochondrial dysfunctions associated with chronic respiratory diseases and their targeted therapies: An update. Future Med. Chem. 2021, 13, 1249–1251. [Google Scholar] [CrossRef]
- Watson, A.; Wilkinson, T.M.A. Digital healthcare in COPD management: A narrative review on the advantages, pitfalls, and need for further research. Ther. Adv. Respir. Dis. 2022, 16, 17534666221075493. [Google Scholar] [CrossRef]
- Alqahtani, J.S. Prevalence, incidence, morbidity and mortality rates of COPD in Saudi Arabia: Trends in burden of COPD from 1990 to 2019. PLoS ONE 2022, 17, e0268772. [Google Scholar] [CrossRef]
- Devkota, H.P.; Paudel, K.R.; Khanal, S.; Baral, A.; Panth, N.; Adhikari-Devkota, A.; Jha, N.K.; Das, N.; Singh, S.K.; Chellappan, D.K.; et al. Stinging Nettle (Urtica dioica L.): Nutritional Composition, Bioactive Compounds, and Food Functional Properties. Molecules 2022, 27, 5219. [Google Scholar] [CrossRef]
- Zhao, Q.; Zhu, L.; Wang, S.; Gao, Y.; Jin, F. Molecular mechanism of the anti-inflammatory effects of plant essential oils: A systematic review. J. Ethnopharmacol. 2022, 301, 115829. [Google Scholar] [CrossRef] [PubMed]
- Raman, S.; Murugaiyah, V.; Parumasivam, T. Andrographis paniculata Dosage Forms and Advances in Nanoparticulate Delivery Systems: An Overview. Molecules 2022, 27, 6164. [Google Scholar] [CrossRef] [PubMed]
- MacNee, W. Pulmonary and systemic oxidant/antioxidant imbalance in chronic obstructive pulmonary disease. Proc. Am. Thorac. Soc. 2005, 2, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Pahwa, R.; Goyal, A.; Jialal, I. Chronic Inflammation; StatPearls Publishing: Treasure Island, FL, USA, 2022. [Google Scholar]
- Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.; Rahu, N. Oxidative Stress and Inflammation: What Polyphenols Can Do for Us? Oxid. Med. Cell Longev. 2016, 2016, 7432797. [Google Scholar] [CrossRef] [Green Version]
- Nyunoya, T.; Mebratu, Y.; Contreras, A.; Delgado, M.; Chand, H.S.; Tesfaigzi, Y. Molecular processes that drive cigarette smoke-induced epithelial cell fate of the lung. Am. J. Respir. Cell Mol. Biol. 2014, 50, 471–482. [Google Scholar] [CrossRef] [Green Version]
- Paudel, K.R.; Mehta, M.; Shukla, S.D.; Panth, N.; Chellappan, D.K.; Dua, K.; Hansbro, P. Advancements in nanotherapeutics targeting senescence in chronic obstructive pulmonary disease. Nanomedicine 2022. [Google Scholar] [CrossRef]
- Nucera, F.; Hansbro, P.M.; Paudel, K.R.; Casolaro, V.; Appanna, R.; Kirkham, P.; Adcock, I.M.; Caramori, G. Chapter 14—Role of autoimmunity in the pathogenesis of chronic obstructive pulmonary disease and pulmonary emphysema. In Translational Autoimmunity; Rezaei, N., Ed.; Academic Press: Cambridge, MA, USA, 2022; Volume 3, pp. 311–331. [Google Scholar]
- Ma, W.J.; Sun, Y.H.; Jiang, J.X.; Dong, X.W.; Zhou, J.Y.; Xie, Q.M. Epoxyeicosatrienoic acids attenuate cigarette smoke extract-induced interleukin-8 production in bronchial epithelial cells. Prostaglandins Leukot. Essent. Fatty Acids 2015, 94, 13–19. [Google Scholar] [CrossRef]
- Pauwels, N.S.; Bracke, K.R.; Dupont, L.L.; Van Pottelberge, G.R.; Provoost, S.; Vanden Berghe, T.; Vandenabeele, P.; Lambrecht, B.N.; Joos, G.F.; Brusselle, G.G. Role of IL-1α and the Nlrp3/caspase-1/IL-1β axis in cigarette smoke-induced pulmonary inflammation and COPD. Eur. Respir. J. 2011, 38, 1019–1028. [Google Scholar] [CrossRef] [Green Version]
- Feng, K.N.; Meng, P.; Zou, X.L.; Zhang, M.; Li, H.K.; Yang, H.L.; Li, H.T.; Zhang, T.T. IL-37 protects against airway remodeling by reversing bronchial epithelial-mesenchymal transition via IL-24 signaling pathway in chronic asthma. Respir. Res. 2022, 23, 244. [Google Scholar] [CrossRef]
- Hurme, M.; Santtila, S. IL-1 receptor antagonist (IL-1Ra) plasma levels are co-ordinately regulated by both IL-1Ra and IL-1beta genes. Eur. J. Immunol. 1998, 28, 2598–2602. [Google Scholar] [CrossRef]
- Lee, A.J.; Ashkar, A.A. The Dual Nature of Type I and Type II Interferons. Front. Immunol. 2018, 9, 2061. [Google Scholar] [CrossRef] [Green Version]
- Pungsrinont, T.; Kallenbach, J.; Baniahmad, A. Role of PI3K-AKT-mTOR Pathway as a Pro-Survival Signaling and Resistance-Mediating Mechanism to Therapy of Prostate Cancer. Int. J. Mol. Sci. 2021, 22, 1088. [Google Scholar] [CrossRef]
Component | Actual % |
---|---|
Valerianol | 12.31% |
gamma-Eudesmol | 8.03% |
epi-Cyclocolorenone | 3.71% |
Nootkatone | 3.71% |
beta-Eudesmol | 3.69% |
Methyl phenethyl ketone | 3.02% |
10-epi-gamma-Eudesmol | 2.90% |
Hinesol | 1.74% |
dihydro-Columellarin | 1.68% |
alpha-Curcumene | 0.88% |
alpha-Humulene | 0.85% |
alpha-Bulnesene | 0.56% |
Selina-4,11-diene | 0.45% |
Debromofiliformin | 0.38% |
4,5-di-epi-Aristolochene | 0.26% |
Elemol | 0.25% |
alpha-Guaiene | 0.16% |
alpha-Selinene | 0.11% |
Gene Name | FW Sequence | RV Sequence |
---|---|---|
IL-8 | GCCTCAAGGAAAAGAATCTG | GGATCTACACTCTCCAGC |
GAPDH | TCGGAGTCAACGGATTTG | CAACAATATCCACTTTACCAGAG |
GCLC | TTATTAGAGACCCACTGACAC | TTCTCAAAATGGTCAGACTC |
GSTP1 | TTTCCCAGTTCGAGGC | ATAGGCAGGAGGCTTTG |
PI3K | GAGTAACAGACTAGCTAGAGAC | AGAAAATCTTTCTCCTGCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Rubis, G.; Paudel, K.R.; Manandhar, B.; Singh, S.K.; Gupta, G.; Malik, R.; Shen, J.; Chami, A.; MacLoughlin, R.; Chellappan, D.K.; et al. Agarwood Oil Nanoemulsion Attenuates Cigarette Smoke-Induced Inflammation and Oxidative Stress Markers in BCi-NS1.1 Airway Epithelial Cells. Nutrients 2023, 15, 1019. https://doi.org/10.3390/nu15041019
De Rubis G, Paudel KR, Manandhar B, Singh SK, Gupta G, Malik R, Shen J, Chami A, MacLoughlin R, Chellappan DK, et al. Agarwood Oil Nanoemulsion Attenuates Cigarette Smoke-Induced Inflammation and Oxidative Stress Markers in BCi-NS1.1 Airway Epithelial Cells. Nutrients. 2023; 15(4):1019. https://doi.org/10.3390/nu15041019
Chicago/Turabian StyleDe Rubis, Gabriele, Keshav Raj Paudel, Bikash Manandhar, Sachin Kumar Singh, Gaurav Gupta, Raniya Malik, Jessie Shen, Aniss Chami, Ronan MacLoughlin, Dinesh Kumar Chellappan, and et al. 2023. "Agarwood Oil Nanoemulsion Attenuates Cigarette Smoke-Induced Inflammation and Oxidative Stress Markers in BCi-NS1.1 Airway Epithelial Cells" Nutrients 15, no. 4: 1019. https://doi.org/10.3390/nu15041019