Ecklonia cava Polyphenols Have a Preventive Effect on Parkinson’s Disease through the Activation of the Nrf2-ARE Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. ECP Formulation
2.2. Culture of Human Neuroblastoma Cells (SH-SY5Y)
2.3. Cell Viability
2.4. Assay of Intracellular ROS Level
2.5. Gene Expression Levels
2.6. NQO1 Activity
2.7. Nuclear Nrf2 Expression: Immunofluorescence Staining
2.8. Animal Treatment
- Control group;
- Rotenone group;
- ECP(L) group—treated with a low concentration of ECP (20 mg/kg body weight);
- ECP(H) group—treated with a high concentration of ECP (240 mg/kg body weight).
2.9. Motor Function Test
2.9.1. Pole Test
2.9.2. Wire-Hang Test
2.10. Intestinal Motility: Evans Blue Dye Administration
2.11. Histopathological Analysis of Colon Tissue: Hematoxylin and Eosin (HE) Staining
2.12. Tyrosine Hydroxylase (TH) Staining in Brain Tissue
2.13. Statistical Analysis
3. Results
3.1. Effects of Rotenone and ECP on SH-SY5Y Cell Viability
3.2. Effects of Rotenone and ECP on Intracellular ROS Production
3.3. Effect of ECP on the Gene Expression Level and Activity of NQO1, an Antioxidant Enzyme
3.4. Effects of Rotenone and ECP on Nuclear Translocation of the Transcription Factor Nrf2
3.5. Effects of Rotenone and ECP on p62 mRNA Expression Levels, a Nrf2 Target Gene
3.6. Effect of Compound C (CC), an AMPK Inhibitor, on SH-SY5Y Cell Viability
3.7. Effects of Rotenone and ECP on Nrf2 Nuclear Migration by AMPK Activation
3.8. Effects of Rotenone and ECP on Motor Function in Mice
3.9. Effects of Rotenone and ECP on Intestinal Motor Function in Mice
3.10. Effects of Rotenone and ECP on the Morphology of Mouse Colon Mucosa
3.11. Effects of Rotenone and ECP on TH Expression in Midbrain Substantia Nigra of Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sveinbjornsdottir, S. The clinical symptoms of Parkinson’s disease. J. Neurochem. 2016, 139 (Suppl. S1), 318–324. [Google Scholar] [CrossRef] [PubMed]
- Poewe, W.; Seppi, K.; Tanner, C.M.; Halliday, G.M.; Brundin, P.; Volkmann, J.; Schrag, A.-E.; Lang, A.E. Parkinson disease. Nat. Rev. Dis. Primers 2017, 3, 17013. [Google Scholar] [CrossRef] [PubMed]
- Dorsey, E.R.; Bloem, B.R. The Parkinson Pandemic-A Call to Action. JAMA Neurol. 2018, 75, 9–10. [Google Scholar] [CrossRef] [PubMed]
- Lew, M. Overview of Parkinson’s disease. Pharmacotherapy 2007, 27, 155s–160s. [Google Scholar] [CrossRef] [PubMed]
- Xia, R.; Mao, Z.H. Progression of motor symptoms in Parkinson’s disease. Neurosci. Bull. 2012, 28, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Ball, N.; Teo, W.P.; Chandra, S.; Chapman, J. Parkinson’s Disease and the Environment. Front. Neurol. 2019, 10, 218. [Google Scholar] [CrossRef] [PubMed]
- Wan, N.; Lin, G. Parkinson’s Disease and Pesticides Exposure: New Findings from a Comprehensive Study in Nebraska, USA. J. Rural Health 2016, 32, 303–313. [Google Scholar] [CrossRef]
- Silva, J.; Alves, C.; Pinteus, S.; Mendes, S.; Pedrosa, R. Seaweeds’ neuroprotective potential set in vitro on a human cellular stress model. Mol. Cell. Biochem. 2020, 473, 229–238. [Google Scholar] [CrossRef]
- Trist, B.G.; Hare, D.J.; Double, K.L. Oxidative stress in the aging substantia nigra and the etiology of Parkinson’s disease. Aging Cell 2019, 18, e13031. [Google Scholar] [CrossRef]
- Rodriguez-Rocha, H.; Garcia-Garcia, A.; Pickett, C.; Li, S.; Jones, J.; Chen, H.; Webb, B.; Choi, J.; Zhou, Y.; Zimmerman, M.C.; et al. Compartmentalized oxidative stress in dopaminergic cell death induced by pesticides and complex I inhibitors: Distinct roles of superoxide anion and superoxide dismutases. Free Radic. Biol. Med. 2013, 61, 370–383. [Google Scholar] [CrossRef]
- Mounsey, R.B.; Teismann, P. Mitochondrial dysfunction in Parkinson’s disease: Pathogenesis and neuroprotection. Parkinsons Dis. 2010, 2011, 617472. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Ragheb, K.; Lawler, G.; Sturgis, J.; Rajwa, B.; Melendez, J.A.; Robinson, J.P. Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. J. Biol. Chem. 2003, 278, 8516–8525. [Google Scholar] [CrossRef] [PubMed]
- Inden, M.; Kitamura, Y.; Takeuchi, H.; Yanagida, T.; Takata, K.; Kobayashi, Y.; Taniguchi, T.; Yoshimoto, K.; Kaneko, M.; Okuma, Y.; et al. Neurodegeneration of mouse nigrostriatal dopaminergic system induced by repeated oral administration of rotenone is prevented by 4-phenylbutyrate, a chemical chaperone. J. Neurochem. 2007, 101, 1491–1504. [Google Scholar] [CrossRef] [PubMed]
- Perez-Pardo, P.; Dodiya, H.B.; Broersen, L.M.; Douna, H.; van Wijk, N.; Lopes da Silva, S.; Garssen, J.; Keshavarzian, A.; Kraneveld, A.D. Gut-brain and brain-gut axis in Parkinson’s disease models: Effects of a uridine and fish oil diet. Nutr. Neurosci. 2018, 21, 391–402. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wang, X.; Vikash, V.; Ye, Q.; Wu, D.; Liu, Y.; Dong, W. ROS and ROS-Mediated Cellular Signaling. Oxid. Med. Cell. Longev. 2016, 2016, 350965. [Google Scholar] [CrossRef] [PubMed]
- Tufekci, K.U.; Civi Bayin, E.; Genc, S.; Genc, K. The Nrf2/ARE Pathway: A Promising Target to Counteract Mitochondrial Dysfunction in Parkinson’s Disease. Park. Dis. 2011, 2011, 314082. [Google Scholar] [CrossRef]
- Kobayashi, A.; Kang, M.I.; Okawa, H.; Ohtsuji, M.; Zenke, Y.; Chiba, T.; Igarashi, K.; Yamamoto, M. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol. Cell. Biol. 2004, 24, 7130–7139. [Google Scholar] [CrossRef] [PubMed]
- Dinkova-Kostova, A.T.; Holtzclaw, W.D.; Cole, R.N.; Itoh, K.; Wakabayashi, N.; Katoh, Y.; Yamamoto, M.; Talalay, P. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl. Acad. Sci. USA 2002, 99, 11908–11913. [Google Scholar] [CrossRef] [PubMed]
- Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; Igarashi, K.; Engel, J.D.; Yamamoto, M. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 1999, 13, 76–86. [Google Scholar] [CrossRef]
- Hawkes, C.H.; Del Tredici, K.; Braak, H. Parkinson’s disease: A dual-hit hypothesis. Neuropathol. Appl. Neurobiol. 2007, 33, 599–614. [Google Scholar] [CrossRef]
- Cirmi, S.; Maugeri, A.; Lombardo, G.E.; Russo, C.; Musumeci, L.; Gangemi, S.; Calapai, G.; Barreca, D.; Navarra, M. A Flavonoid-Rich Extract of Mandarin Juice Counteracts 6-OHDA-Induced Oxidative Stress in SH-SY5Y Cells and Modulates Parkinson-Related Genes. Antioxidants 2021, 10, 539. [Google Scholar] [CrossRef] [PubMed]
- Koirala, P.; Jung, H.A.; Choi, J.S. Recent advances in pharmacological research on Ecklonia species: A review. Arch. Pharm. Res. 2017, 40, 981–1005. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.J.; Kwon, O.I.; Hwang, H.J.; Shin, H.C.; Yang, S. Therapeutic effects of phlorotannins in te treatment of neurodegenerative disorders. Front. Mol. Neurosci. 2023, 16, 1193590. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, M.; Satake, N.; Yamashita, H.; Tamura, A.; Sasaki, M.; Matsui-Yuasa, I.; Tabuchi, M.; Akahoshi, Y.; Terada, M.; Kojima-Yuasa, A. Ecklonia cava polyphenol protects the liver against ethanol-induced injury in rats. Biochim. Biophys. Acta 2012, 1820, 978–988. [Google Scholar] [CrossRef]
- Yamashita, H.; Goto, M.; Matsui-Yuasa, I.; Kojima-Yuasa, A. Ecklonia cava polyphenol has a protective effect against ethanol-induced liver injury in a cyclic AMP-dependent manner. Mar. Drugs 2015, 13, 3877–3891. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.; Park, Y.; Hwang, H.J.; Kim, S.H.; Lee, J.G.; Shin, H.C. Antioxidative properties of brown algae polyphenolics and their perspectives as chemopreventive agents against vascular risk factors. Arch. Pharm. Res. 2003, 26, 286–293. [Google Scholar] [CrossRef] [PubMed]
- De Haan, L.H.; Boerboom, A.M.; Rietjens, I.M.; van Capelle, D.; De Ruijter, A.J.; Jaiswal, A.K.; Aarts, J.M.M.J.G. A physiological threshold for protection against menadione toxicity by human NAD(P)H:quinone oxidoreductase (NQO1) in Chinese hamster ovary (CHO) cells. Biochem. Pharmacol. 2002, 64, 1597–1603. [Google Scholar] [CrossRef] [PubMed]
- Jain, A.; Lamark, T.; Sjøttem, E.; Larsen, K.B.; Awuh, J.A.; Øvervatn, A.; McMahon, M.; Hayes, J.D.; Johansen, T. p62/SQSTM1 is a target gene for transcription factor NRF2 and creates a positive feedback loop by inducing antioxidant response element-driven gene transcription. J. Biol. Chem. 2010, 285, 22576–22591. [Google Scholar] [CrossRef] [PubMed]
- Qiu, L.; Feng, R.; Wu, Q.S.; Wan, J.B.; Zhang, Q.W. Total saponins from Panax japonicus attenuate acute alcoholic liver oxidative stress and hepatosteatosis by p62-related Nrf2 pathway and AMPK-ACC/PPARα axis in vivo and in vitro. J. Ethnopharmacol. 2023, 317, 116785. [Google Scholar] [CrossRef]
- Cheng, Q.; Chen, J.; Guo, H.; Lu, J.L.; Zhou, J.; Guo, X.Y.; Shi, Y.; Zhang, Y.; Yu, S.; Zhang, Q. Pyrroloquinoline quinone promotes mitochondrial biogenesis in rotenone-induced Parkinson’s disease model via AMPK activation. Acta Pharmacol. Sin. 2021, 42, 665–678. [Google Scholar] [CrossRef]
- Nguyen, T.; Sherratt, P.J.; Pickett, C.B. Regulatory mechanisms controlling gene expression mediated by the antioxidant response element. Annu. Rev. Pharmacol. Toxicol. 2003, 43, 233–260. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Shen, J.; Xiao, J.; Chen, F.; Wang, M. Neuroprotective effect of cajaninstilbene acid against cerebral ischemia and reperfusion damages by activating AMPK/Nrf2 pathway. J. Adv. Res. 2021, 34, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Lim, J.H.; Kim, K.M.; Kim, S.W.; Hwang, O.; Choi, H.J. Bromocriptine activates NQO1 via Nrf2-PI3K/Akt signaling: Novel cytoprotective mechanism against oxidative damage. Pharmacol. Res. 2008, 57, 325–331. [Google Scholar] [CrossRef] [PubMed]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [PubMed]
- Jain, A.K.; Jaiswal, A.K. GSK-3beta acts upstream of Fyn kinase in regulation of nuclear export and degradation of NF-E2 related factor 2. J. Biol. Chem. 2007, 282, 16502–16510. [Google Scholar] [CrossRef]
- Salazar, M.; Rojo, A.I.; Velasco, D.; de Sagarra, R.M.; Cuadrado, A. Glycogen synthase kinase-3beta inhibits the xenobiotic and antioxidant cell response by direct phosphorylation and nuclear exclusion of the transcription factor Nrf2. J. Biol. Chem. 2006, 281, 14841–14851. [Google Scholar] [CrossRef] [PubMed]
- Joo, M.S.; Kim, W.D.; Lee, K.Y.; Kim, J.H.; Koo, J.H.; Kim, S.G. AMPK Facilitates Nuclear Accumulation of Nrf2 by Phosphorylating at Serine 550. Mol. Cell. Biol. 2016, 36, 1931–1942. [Google Scholar] [CrossRef]
- Ko, S.C.; Lee, M.; Lee, J.-H.; Lee, S.-H.; Lim, Y.; Jeon, Y.-J. Dieckol, a phlorotannin isolated from a brown seaweed, Ecklonia cava, inhibits adipogenesis through AMP-activated protein kinase (AMPK) activation in 3T3-L1 preadipocytes. Environ. Toxicol. Pharmacol. 2013, 36, 1253–1260. [Google Scholar]
- Leem, Y.-H.; Park, J.-S.; Park, J.-S.; Kim, D.-E.; Kim, H.-S. Creatine supplementation with exercise reduces a-synuclein oligomerization and necroptosis in Parkinson’s disease mouse model. J. Nutr. Biochem. 2024, 126, 109586. [Google Scholar] [CrossRef]
- Clairembault, T.; Leclair-Visonneau, L.; Neunlist, M.; Derkinderen, P. Enteric glial cells: New players in Parkinson’s disease? Mov. Disord. 2015, 30, 494–498. [Google Scholar] [CrossRef]
- Klingelhoefer, L.; Reichmann, H. Pathogenesis of Parkinson disease-the gut-brain axis and environmental factors. Nat. Rev. Neurol. 2015, 11, 625–636. [Google Scholar] [CrossRef] [PubMed]
- Pan-Montojo, F.; Schwarz, M.; Winkler, C.; Arnhold, M.; O’Sullivan, G.A.; Pal, A.; Said, J.; Marsico, G.; Verbavatz, J.-M.; Rodrigo-Angulo, M.; et al. Environmental toxins trigger PD-like progression via increased alpha-synuclein release from enteric neurons in mice. Sci. Rep. 2012, 2, 898. [Google Scholar] [CrossRef] [PubMed]
- Natale, G.; Pasquali, L.; Ruggieri, S.; Paparelli, A.; Fornai, F. Parkinson’s disease and the gut: A well known clinical association in need of an effective cure and explanation. Neurogastroenterol. Motil. 2008, 20, 741–749. [Google Scholar] [CrossRef] [PubMed]
- Kwak, J.H.; Yang, Z.; Yoon, B.; He, Y.; Uhm, S.; Shin, H.C.; Lee, B.H.; Yoo, Y.C.; Lee, K.B.; Han, S.-Y.; et al. Blood-brain barrier-permeable fluorone-labeled dieckols acting as neuronal ER stress signaling inhibitors. Biomaterials 2015, 61, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Myung, C.S.; Shin, H.C.; Bao, H.Y.; Yeo, S.J.; Lee, B.H.; Kang, J.S. Improvement of memory by dieckol and phlorofucofuroeckol in ethanol-treated mice; possiblle involvement of the inhibition of acetylcholineesterase. Arch. Pharm. Res. 2005, 28, 691–698. [Google Scholar] [CrossRef]
- Lee, B.H.; Stein, S.M. Inprovement of learning behavior of mice by an antiacetylcholineesterase and neuroprotective agent NX42, a Laminariales-alge extract. Korean. J. Food Aci. Technol. 2004, 36, 974–978. [Google Scholar]
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|
NQO1 * | GGATTGGACCGAGCTGGAA | AATTGCAGTGAAGATGAAGGCAAC |
p62 (SQSTM1) | CTGTACGGGCCAGTTTCTCTG | TGTCACTTGTTTTGCTGCCC |
β-Actin | AACCTAACTTGCGCAGAAAACAAG | TGCTGTCACCTTCACCGTTC |
Components (g) | Control |
---|---|
Casein | 140 |
L-cystine | 1.8 |
Cornstarch | 465.692 |
α-cornstarch | 155 |
Sucrose | 100 |
Soybean Oil | 40 |
Cellulose powder | 50 |
AIN-93M mineral | 35 |
AIN-93 vitamin | 10 |
Choline Hydrogen Tartrate | 2.5 |
tert-Butylhydroquinone | 0.008 |
Total | 1000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yasuda, Y.; Tokumatsu, T.; Ueda, C.; Sakai, M.; Sasaki, Y.; Norikura, T.; Matsui-Yuasa, I.; Kojima-Yuasa, A. Ecklonia cava Polyphenols Have a Preventive Effect on Parkinson’s Disease through the Activation of the Nrf2-ARE Pathway. Nutrients 2024, 16, 2076. https://doi.org/10.3390/nu16132076
Yasuda Y, Tokumatsu T, Ueda C, Sakai M, Sasaki Y, Norikura T, Matsui-Yuasa I, Kojima-Yuasa A. Ecklonia cava Polyphenols Have a Preventive Effect on Parkinson’s Disease through the Activation of the Nrf2-ARE Pathway. Nutrients. 2024; 16(13):2076. https://doi.org/10.3390/nu16132076
Chicago/Turabian StyleYasuda, Yuri, Tamaki Tokumatsu, Chiharu Ueda, Manami Sakai, Yutaro Sasaki, Toshio Norikura, Isao Matsui-Yuasa, and Akiko Kojima-Yuasa. 2024. "Ecklonia cava Polyphenols Have a Preventive Effect on Parkinson’s Disease through the Activation of the Nrf2-ARE Pathway" Nutrients 16, no. 13: 2076. https://doi.org/10.3390/nu16132076