Next Article in Journal
Carotenoids from Different Pumpkin Varieties Exert a Cytotoxic Effect on Human Neuroblastoma SH-SY5Y Cells
Previous Article in Journal
Lactiplantibacillus plantarum 06CC2 Enhanced the Expression of Intestinal Uric Acid Excretion Transporter in Mice
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Correction

Correction: Yokoi et al. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050

1
Department of Oral Disease Research, Geroscience Research Center, National Center for Geriatrics and Gerontology, Obu 474-8511, Japan
2
Department of Geriatric Oral Science, Graduate School of Dentistry, Tohoku University, Sendai 980-8575, Japan
3
Research Department, Daiichi Sankyo Healthcare Co., Ltd., Tokyo 140-8710, Japan
4
Section of Community Oral Health and Epidemiology, Division of Oral Health, Technology and Epidemiology, Faculty of Dental Science, Kyushu University, Fukuoka 812-8582, Japan
5
Department of Operative Dentistry, School of Dentistry, Aichi Gakuin University, Nagoya 464-8650, Japan
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Nutrients 2024, 16(17), 3041; https://doi.org/10.3390/nu16173041
Submission received: 16 May 2024 / Accepted: 25 May 2024 / Published: 9 September 2024
(This article belongs to the Section Carbohydrates)

Text Correction

Upon review, we have identified an error in the human TNF-α primer sequence reported in Table 1 of our paper titled “Erythritol can inhibit the expression of senescence molecules in mouse gingival tissues and human gingival fibroblasts” [1]. The incorrect sequence was inadvertently included due to an oversight during manuscript preparation. The sequence did not yield successful amplification in our experiments and was not used in the data presented. We provide here the correct primer sequences that were utilized:
TNF-α (F)—CCCAGGGACCTCTCTCTAATC
TNF-α (R)—ATGGCTACAGGCTTGTCACT
The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.
The authors thank the readers and the journal for their understanding.

Reference

  1. Yokoi, H.; Furukawa, M.; Wang, J.; Aoki, Y.; Raju, R.; Ikuyo, Y.; Yamada, M.; Shikama, Y.; Matsushita, K. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yokoi, H.; Furukawa, M.; Wang, J.; Aoki, Y.; Raju, R.; Ikuyo, Y.; Yamada, M.; Shikama, Y.; Matsushita, K. Correction: Yokoi et al. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050. Nutrients 2024, 16, 3041. https://doi.org/10.3390/nu16173041

AMA Style

Yokoi H, Furukawa M, Wang J, Aoki Y, Raju R, Ikuyo Y, Yamada M, Shikama Y, Matsushita K. Correction: Yokoi et al. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050. Nutrients. 2024; 16(17):3041. https://doi.org/10.3390/nu16173041

Chicago/Turabian Style

Yokoi, Haruna, Masae Furukawa, Jingshu Wang, Yu Aoki, Resmi Raju, Yoriko Ikuyo, Mitsuyoshi Yamada, Yosuke Shikama, and Kenji Matsushita. 2024. "Correction: Yokoi et al. Erythritol Can Inhibit the Expression of Senescence Molecules in Mouse Gingival Tissues and Human Gingival Fibroblasts. Nutrients 2023, 15, 4050" Nutrients 16, no. 17: 3041. https://doi.org/10.3390/nu16173041

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop