Next Article in Journal
Increasing Natural Killer Cell Activity of Mineral Nanomaterial ALP1018 in Healthy Adults: A Randomized, Double-Blind, Placebo Comparative Clinical Trial
Previous Article in Journal
Live and Heat-Inactivated Streptococcus thermophilus MN-ZLW-002 Mediate the Gut–Brain Axis, Alleviating Cognitive Dysfunction in APP/PS1 Mice
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 16
Issue 6
10.3390/nu16060848
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oleuropein Supplementation Ameliorates Long-Course Diabetic Nephropathy and Diabetic Cardiomyopathy Induced by Advanced Stage of Type 2 Diabetes in db/db Mice

by
Shujuan Zheng
1,2,
Ruixuan Geng
1,
Jingya Guo
1,
Seong-Gook Kang
3,
Kunlun Huang
1,4,5,* and
Tao Tong
1,4,5,*
1
Key Laboratory of Precision Nutrition and Food Quality, Key Laboratory of Functional Dairy, Ministry of Education, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China
2
College of Biological and Food Engineering, Anhui Polytechnic University, Wuhu 241000, China
3
Department of Food Engineering, Solar Salt Research Center, Mokpo National University, Muangun 58554, Republic of Korea
4
Key Laboratory of Safety Assessment of Genetically Modified Organism (Food Safety), Ministry of Agriculture, Beijing 100083, China
5
Beijing Laboratory for Food Quality and Safety, Beijing 100083, China
*
Authors to whom correspondence should be addressed.
Nutrients 2024, 16(6), 848; https://doi.org/10.3390/nu16060848
Submission received: 14 February 2024 / Revised: 10 March 2024 / Accepted: 12 March 2024 / Published: 15 March 2024
(This article belongs to the Section Proteins and Amino Acids)
Browse Figures
Versions Notes

Abstract

:
Previous studies have reported the therapeutic effects of oleuropein (OP) consumption on the early stage of diabetic nephropathy and diabetic cardiomyopathy. However, the efficacy of OP on the long-course of these diabetes complications has not been investigated. Therefore, in this study, to investigate the relieving effects of OP intake on these diseases, and to explore the underlying mechanisms, db/db mice (17-week-old) were orally administrated with OP (200 mg/kg bodyweight) for 15 weeks. We found that OP reduced expansion of the glomerular mesangial matrix, renal inflammation, renal fibrosis, and renal apoptosis. Meanwhile, OP treatment exerted cardiac anti-fibrotic, anti-inflammatory, and anti-apoptosis effects. Notably, transcriptomic and bioinformatic analyses indicated 290 and 267 differentially expressed genes in the kidney and heart replying to OP treatment, respectively. For long-course diabetic nephropathy, OP supplementation significantly upregulated the cyclic guanosine monophosphate-dependent protein kinase (cGMP–PKG) signaling pathway. For long-course diabetic cardiomyopathy, p53 and cellular senescence signaling pathways were significantly downregulated in response to OP supplementation. Furthermore, OP treatment could significantly upregulate the transcriptional expression of the ATPase Na+/K+ transporting subunit alpha 3, which was enriched in the cGMP–PKG signaling pathway. In contrast, OP treatment could significantly downregulate the transcriptional expressions of cyclin-dependent kinase 1, G two S phase expressed protein 1, and cyclin B2, which were enriched in p53 and cellular senescence signal pathways; these genes were confirmed by qPCR validation. Overall, our findings demonstrate that OP ameliorated long-course diabetic nephropathy and cardiomyopathy in db/db mice and highlight the potential benefits of OP as a functional dietary supplement in diabetes complications treatment.

Graphical Abstract

1. Introduction

Long-term hyperglycemia can cause pathological changes in various organs and tissues, resulting in diabetes complications such as diabetic cardiomyopathy, diabetic nephropathy, diabetic neuropathy, and diabetic retinopathy [1,2]. The latest data (2021) from International Diabetes Federation showed that there were 537 million (20–79 years) diabetics worldwide, accounting for 10.5% of the adult population; by 2030, the number of diabetics is projected to be up to 643 million [3,4,5]. Clinical data show that approximately 30% to 40% of diabetics will develop diabetic nephropathy [6]. The morbidity of diastolic dysfunction in diabetics has been estimated to be about 52~60% [7]. In addition to harming health, diabetic nephropathy and diabetic cardiomyopathy also bring heavy financial burden to patients. Therefore, effective strategies are necessary to relieve these diabetes complications.
Oleuropein (OP), a phenolic compound which mainly presents in olive leaves, immature olive fruits, and extra virgin olive oil, exerts multiple biological functions [8,9]. OP has been shown to have beneficial effects on the early onset of diabetic nephropathy and diabetic cardiomyopathy [10,11,12]. However, the mitigating effects of OP on long-course diabetic nephropathy and diabetic cardiomyopathy have not yet been explored. Our earlier research demonstrated that OP alleviated the advanced stage of type 2 diabetes in db/db mice [13]. In detail, OP (200 mg/kg bodyweight) had been orally administered to 17-week-old db/db mice daily for 15 weeks. We found that OP significantly reduced the fasting blood glucose (339.5 mg/dL vs. 512.5 mg/dL) and the homeostasis model assessment–insulin resistance index (30.4 vs. 17.2), restored the histological characteristics of pancreatic islets and liver, and significantly upregulated the phosphorylation level of protein kinase B in the liver of db/db mice. According to our prior discoveries, we posited that supplementing with OP could effectively mitigate the long-course diabetic nephropathy and diabetic cardiomyopathy in db/db mice with advanced stage type 2 diabetes.

2. Materials and Methods

2.1. Materials

OP (analytical reagent grade) was procured from Chengdu Purify Technology Development Co., Ltd. (Chengdu, China). Chemical reagents of analytical grade were purchased from Macklin Chemical Reagent Co., Ltd. (Shanghai, China).

2.2. Animals and Experimental Design

The animal experiment was approved by the Animal Ethics Committee of China Agricultural University (AW11099102-3-4, Beijing, China). Male BKS–Leprem2Cd479/Gpt (db/db) mice (8-week-old) and age-matched wild-type control male BKS–DB (m/m) mice (SCXK (Su) 2018-0008) were purchased from Nanjing Collective Pharmachem Co., Ltd. (Nanjing, China). Mice were housed 3–4 per cage in a 12 h/12 h self-controlled daylight control system (lights on at 6:30 a.m.) in a specific pathogen-free animal room (SYXK (Jing) 2020-0052). The room temperature was 21 ± 2 °C, humidity was 40–70%, and air exchange frequency was 10~12 times/h. Studies have indicated that db/db mice at 16 weeks of age exhibit elevated casual blood glucose levels as well as high fasting blood glucose levels, making them a suitable model for studying the advanced stage of type 2 diabetes [14,15]. All animals were given free access to water and standard chow diet (Huafukang Biotechnology Co., Ltd., Beijing, China) until they reached 17 weeks of age. Then, the mice were divided into 3 groups: (1) db/db group (n = 7); (2) db/db + OP group (n = 8); (3) m/m group (n = 7). Mice in the db/db + OP group were administered OP aqueous solution via gavage at a dose of 200 mg/kg body weight daily for 15 weeks (Figure 1). The animals used in this study were the same as those in the research of Zheng et al. [13].

2.3. Sample Collection

After 15 weeks of treatment, the animals were fasted for 6 h and blood samples were collected from the posterior orbital venous plexus. Then, the mice were dissected. Part of the removed kidney and heart tissues were fixed with 4% paraformaldehyde solution, and the remaining tissue samples were snap-frozen in liquid nitrogen and subsequently stored at −80 °C.

2.4. Periodic Acid–Schiff (PAS) Staining

The fixed tissues were dehydrated using a gradient of ethanol, cleared in xylene, sealed in wax, and then sectioned into 4.5 µm slices. The sections were de-waxed and sequentially stained in periodate stain, chevron stain, and hematoxylin stain, followed by dehydration and sealing of the sections. Histopathological changes were observed under bright field using a Leica DM750 microscope (Leica, Nussloch, Germany).

2.5. Masson Staining

The fixed tissues underwent dehydration with a series of ethanol gradients, followed by clearing in xylene, wax sealing, and subsequent cutting into 4.5 µm sections. The sections were de-waxed and stained sequentially in potassium dichromate, ferric hematoxylin, ponpceau acid fuchsin, phosphomolybdic acid, and aniline blue. The sections were rinsed with 1% glacial acetic acid, dehydrated with anhydrous ethanol, and sealed with neutral gum.

2.6. Immunohistochemical Staining

The fixed tissues were dehydrated through a series of ethanol gradients, cleared in xylene, sealed in wax, and then sectioned into 4.5 µm slices. Sections were de-waxed and antigen repair was performed. Sections were then blocked with serum, incubated sequentially with primary and secondary antibodies, chromogenized with diaminobenzidine (DAB), re-stained with nuclei, and finally sealed.

2.7. Terminal Deoxynucleotidyl Transferase (TdT) dUTP Nick End Labeling (TUNEL) Staining

The fixed tissues were dehydrated through a series of ethanol gradients, cleared in xylene, sealed in wax, and then sectioned into 4.5 µm slices. After paraffin removal, antigen repair was performed on the slices, followed by TUNEL reaction, DAB staining, and finally sealing.

2.8. Real-Time Quantitative PCR

Total RNA was extracted from the tissues using TRIzolTM reagent (TIANGEN, Beijing, China) [13]. A cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) kit was used to synthesize the cDNA. Then, a SuperReal PreMix Plus (SYBR Green) (TransGen Biotech, Beijing, China) kit was used to perform real-time quantitative PCR. Primer sequences for qPCR are in Table 1. The real-time PCR quantitative amplifications were performed as follows: 95 °C for 3 min, 40 cycles of 95 °C for 10 s, and 55 °C for 30 s. The expression of β-actin was utilized as a reference to normalize mRNA expression levels.

2.9. Transcriptome Sequencing

After extracting tissue RNA, genomic DNA was removed by using DNase I (TransGen Biotech, Beijing, China). Quality inspection was conducted on the obtained RNA to meet the RNA library construction and sequencing requirements. The TruSeqTM RNA sample preparation kit was used to establish an RNA library. Then, the mRNA was enriched and braked. After amplification of cDNA using the mRNA as a template by PCR, cDNA fragments of 200~300 bp in size were screened by DNA Clean Beads. The prepared library was sequenced on an Illumina NovaSeq 6000 sequencing platform (Illumina, San Diego, CA, USA) with paired-end 150 (PE150) read length [16]. The above process was completed by Shanghai Majorbio Biomedical Technology Co., Ltd. (Shanghai, China).

2.10. Sequencing Analysis

Filtering out low-quality data from raw data yielded high-quality data. The mapped reads were spliced and compared with the annotated information of the reference genome [17]. Gene expression levels were quantified using transcripts per million reads (TPM). Differentially expressed genes (DEGs) were identified using the DESeq2 software package (version 1.24.0), with screening criteria set at |log2fold change| ≥ 1 and p < 0.05 [18]. Gene Ontology (GO) functional annotation of differential genes was performed using Goatools (https://github.com/tanghaibao/Goatools, accessed on 1 February 2022). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis of DEGs was performed using KOBAS (http://kobas.cbi.pku.edu.cn/home.do, accessed on 15 February 2022) [19].

2.11. Statistical Analyses

GraphPad Prism (version 8) was utilized to analyze the data and present the results as mean ± standard error of the mean (SEM). For the analysis of statistically significant differences, an unpaired two-tailed Student’s t-test was used; p < 0.05 was regarded as statistically significant.

3. Results

3.1. OP Supplementation Alleviated the Expansion of Mesangial Matrix, Renal Fibrosis, and Renal Inflammation

Our previous research results demonstrated that OP significantly reduced fasting blood glucose in db/db mice (339.5 mg/dL vs. 512.5 mg/dL). OP can improve glucose tolerance and reduce the homeostasis model assessment–insulin resistance index significantly (30.4 vs. 17.2) [13].
Diabetic nephropathy was characterized by expansion of the mesangial matrix, which eventually blocked the glomerular capillaries [10]. We found that the PAS-positive mesangial matrix areas (black arrows) were larger in db/db mice than in m/m mice. OP supplementation decreased the PAS-positive mesangial matrix areas (black arrows) (Figure 2a). By Masson staining, the db/db group showed increased renal fibrosis areas compared with the m/m group (black arrows). OP supplementation reduced the degree of renal fibrosis (Figure 2b). In addition, renal inflammation contributed to the progression of diabetic nephropathy [20]. F4/80 was a marker of macrophages. As shown in Figure 2c, the expression of F4/80 was higher in db/db mice compared with m/m mice (black arrows). In contrast, mice in the db/db + OP group showed fewer F4/80 positive areas than those in the db/db group.

3.2. OP Supplementation Inhibited Renal Apoptosis

Apoptosis is a factor that can lead to the onset and progression of diabetic nephropathy. Compared with the m/m group, the respective proportions of cleaved caspase-3 positive regions, Bax positive regions, and TUNEL staining positive regions in the db/db group were increased (Figure 3a,c,d) and the proportion of Bcl-2 positive regions was decreased (Figure 3b). However, these histopathology parameters were significantly rescued by OP supplementation. These results suggested that OP treatment can partially inhibit renal apoptosis.

3.3. Effects of OP on mRNA Levels of FIBROTIC Factors, Anti-Inflammatory and Pro-Inflammatory Factors, and Oxidase in the Kidney

Furthermore, mRNA levels of fibrotic factors (α-smooth muscle actin (α-SMA), transgelin, and the connective tissue growth factor (CTGF)) were assessed. The results demonstrated that the mRNA levels of α-SMA, transgelin, and CTGF were significantly upregulated in db/db mice compared with m/m mice (Figure 4a–c). However, OP treatment significantly decreased the mRNA level of α-SMA (Figure 4a). Nevertheless, the comparisons between db/db and db/db + OP groups in relation to transgelin and CTGF showed no significant differences (Figure 4b,c). We then investigated the effects of OP on the mRNA levels of anti-inflammatory and pro-inflammatory factors. Compared with the db/db group, the mRNA level of the anti-inflammatory factor mannose receptor C type 1 (Mrc1) was significantly upregulated (Figure 4d) in the db/db + OP group. Dietary intake of OP had slight but not significant effects on the mRNA levels of the anti-inflammatory factors arginase 1 (Arg1), macrophage galactose-type lectin 1 (Mgl1), and macrophage galactose-type lectin 2 (Mgl2), as well as on the mRNA level of the pro-inflammatory factor intercellular adhesion molecule-1 (ICAM1) (Figure 4e–h). We also investigated the effect of OP on oxidase-related genes. Compared with the mice in the m/m group, the mRNA level of NADPH oxidases 4 (NOX4) in the db/db mice was significantly increased. However, OP treatment significantly decreased the mRNA level of NOX4 (Figure 4i).

3.4. OP Supplementation Modifies Gene Expression Profiles of the Kidney

To investigate the potential underlying molecular mechanism of OP in alleviating long-course diabetic nephropathy, we conducted RNA-sequencing analysis of kidney tissues. Gene expression profiles were normalized using TPM (Figure 5a). A screening threshold of p < 0.05 and |log 2FC| ≥ 1 was applied to identify DEGs between the db/db and db/db + OP groups, as depicted in the volcano plot graph (Figure 5b). In total, we identified 290 DEGs, including 189 upregulated and 101 downregulated genes, between the db/db group and the db/db + OP group. These DEGs were analyzed using GO functional annotation and KEGG analysis. The GO terms with the top 20 enrichment degrees are shown in Figure 5c,d. According to the GO classification, the DEGs between the db/db and db/db + OP groups were involved in three categories, namely biological process, molecular function, and cellular component. Next, we performed KEGG pathway enrichment analysis (Figure 5e,f). By examining the top 20 key pathways (p < 0.05), we conducted an analysis to explore the specific pathways that differed between the db/db and db/db + OP groups in this study. Interestingly, some DEGs were notably enriched in certain pathways, including the cGMP–PKG signaling pathway, the ECM-receptor interaction signaling pathway, and the Gap junction signaling pathway, all of which have implications in diabetic nephropathy. The upregulation of cGMP–PKG and Gap junction signaling pathways, and the downregulation of the ECM receptor interaction signaling pathway, were considered to be beneficial to the improvement of diabetes nephropathy [21,22,23,24]. In our KEGG analysis results, OP upregulated the cGMP–PKG and ECM receptor interaction signaling pathways and downregulated the Gap junction signaling pathway. Considering the aforementioned results, we selected the cGMP–PKG signaling pathway as the focus for investigating the mechanism by which OP regulates long-course diabetic nephropathy.

3.5. OP Alleviated Cardiac Fibrosis and Inflammation

In our previous research, it was observed that mice in the m/m group exhibited neatly arranged myocardial fibers, whereas mice in the db/db group displayed disordered myocardial fibers. Following OP treatment, a notable improvement was observed, with more neatly arranged myocytes in the db/db + OP group [13]. We found that the cardiac fibrosis area in the db/db + OP group was smaller than that in the db/db group (Figure 6a). We also analyzed F4/80 expression in the heart tissue by immunohistochemical staining. Compared with that in the db/db group, the F4/80 expression level in the db/db + OP group was lower (Figure 6b). These results suggested that OP treatment ameliorated cardiac damage in db/db mice.

3.6. OP Supplementation Inhibited Cardiac Apoptosis

Immunohistochemical staining and TUNEL staining were conducted to assess the level of cardiac apoptosis. Compared with that in the db/db group, the cleaved caspase-3 and Bax expression levels in the db/db + OP group were lower, whereas the Bcl-2 level was higher (Figure 7a–c). In addition, the results of the TUNEL staining were consistent with those of the immunohistochemical staining (Figure 7d). Therefore, our results suggested that OP supplementation can partially inhibit apoptosis in the heart of db/db mice.

3.7. OP Supplementation Modifies Gene Expression Profiles of the Heart

Next, we analyzed the gene expression profiles of heart tissues by RNA-sequencing, to verify the hypothesis that OP can alleviate long-course diabetic cardiomyopathy and to investigate the potential underlying molecular mechanism of the mitigation of long-course diabetic cardiomyopathy by OP. Gene expression distributions were normalized by TPM (Figure 8a). Figure 8b shows the scatter plot for the differential expression analysis of db/db vs. db/db + OP, including 267 DEGs, of which 96 were upregulated and 171 were downregulated. These DEGs were analyzed using GO functional annotation and KEGG analysis. The GO terms with the top 20 enrichment degrees are shown in Figure 8c,d. According to the GO classification, the DEGs between the db/db and db/db + OP groups were involved in three categories, namely biological process, molecular function, and cellular component. Next, we performed KEGG pathway enrichment analysis (Figure 8e,f). Based on the top 20 key pathways, we analyzed the specific pathways in the db/db and db/db + OP groups to gain insights into how OP may alleviate long-term diabetic cardiomyopathy. It was found that some DEGs were significantly enriched in the Gap junction signaling pathway, the p53 signaling pathway, and the cellular senescence signaling pathway, which are all associated with diabetic cardiomyopathy. We found that the role of OP on Gap junction signaling pathways was not clear. OP treatment downregulated p53 and cellular senescence signaling pathways. The downregulation of these signaling pathways was deemed beneficial for the amelioration of diabetic cardiomyopathy. Based on the above results, the p53 and cellular senescence signaling pathways were chosen to investigate the mechanism by which OP regulated long-course diabetic nephropathy.

3.8. qPCR Verification

In our research, 5 DEGs were involved in the cGMP–PKG signaling pathway, namely cGMP-dependent protein kinase 2 (Prkg2), potassium channel subfamily U member 1 (Kcnu1), ATPase Na+/K+ transporting subunit alpha 3 (Atp1a3), protein kinase cGMP-dependent 1 (Prkg1), and potassium calcium-activated channel subfamily M alpha 1 (Kcnma1). The RNA-sequencing data were consistent with the qPCR result, which confirmed that the mRNA level of Atp1a3 was notably elevated in the kidneys of mice supplemented with OP (Figure 9a).
Three DEGs were involved in the p53 signaling pathway, namely cyclin-dependent kinase 1 (Cdk1), G two S phase expressed protein 1 (Gtse1), and cyclin B2 (Ccnb2). The cellular senescence signaling pathway involved 4 DEGs, namely Cdk1, Ccnb2, histocompatibility 2 T region locus 3 (H2–T3), and histocompatibility 2, Q region locus 2 (H2–Q2). Consistent with the RNA-sequencing data, the qPCR result validated the finding that Cdk1, Gtse1, and Ccnb2 mRNA levels were significantly lower in the heart of mice supplemented with OP (Figure 9b–d).

4. Discussion

In the present study, we demonstrated the salutary effects of OP on long-course diabetic nephropathy and diabetic cardiomyopathy. Several studies have shown that OP exerts no lethality or toxic effects in animal experiments [25,26,27,28]. We also found no adverse effects during the whole experiment. The dosage of OP used in this study was 200 mg/kg. This dosage corresponded to a daily intake of approximately 16.2 mg/kg of human body weight (972 mg/60 kg), as calculated using the conversion method (body surface area normalization) suggested by Reagan-Shaw et al. [29]. People on a Mediterranean diet consume on average 20 olive fruits per day, which corresponds to a daily intake of about 25 mg OP [30]. The daily intake dose of 972 mg calculated in this paper is higher than 25 mg. The OP dosage used in this study corresponds to approximately 39 times the daily intake of OP in the Mediterranean diet. Foods containing OP that people are exposed to in their daily lives include olive oil, commercial olive leaf extracts, and others [31]. Since the content of OP is low in olive oil, commercial olive leaf extracts are good sources of OP supplementation [32]. The general content of OP in commercial olive leaf extracts ranges from 20% to 50%. Based on the 200 mg/kg dose used in this study, the conversion to a human (60 kg body weight) would be approximately 1 g/d. If the olive leaf extracts contain 50% OP, 2 g daily intake would be required.
Studies have shown that lowering the level of renal inflammation can reduce fibrosis and apoptosis, thereby alleviating diabetes nephropathy [33,34,35]. Renal inflammation can lead to the activation and recruitment of renal fibroblasts, start the fibrosis process, and trigger diabetes nephropathy [33,34,35]. Excessive apoptosis can induce renal injury and promote the development of diabetes nephropathy [10,36]. In the present study, the renal inflammation level was significantly decreased by OP supplementation (Figure 2c). Moreover, the results of the Masson staining pathology analysis confirmed that OP exerted a strong alleviating effect on kidney fibrosis, which was evidenced by the decreased α-SMA mRNA level (Figure 2b and Figure 4a). In addition, OP supplementation inhibited renal apoptosis (Figure 3). In agreement with previous research, OP showed favorable effects on decreasing apoptosis [10,37].
To gain further insights into the mechanism by which OP improves long-term diabetic nephropathy, we conducted transcriptomics and bioinformatics analyses. Transcriptome analysis suggested that OP may exert its beneficial effects by activating the cGMP–PKG signaling pathway. In this signaling pathway, PKG is activated by cGMP and transmits extracellular signals to the intracellular compartment. As an important second messenger, cGMP exerts regulatory effects on multiple physiological functions, such as decreasing apoptosis and inflammation [38,39]. In the kidney, medicines that increase the cellular content of cGMP may ameliorate chronic kidney disease [37,38,39,40,41]. A previous study showed that streptozotocin-induced reduction in glomerular cGMP production in diabetic rats triggers impaired renal endothelial diastolic function and disrupts normal renal function. Glomerular cGMP production was restored in diabetic rats after insulin treatment [42]. In our research, transcriptomic results showed that OP upregulated the cGMP–PKG signaling pathway in the kidney of db/db mice. We used qPCR to validate this hypothesis. Our results showed that the DEGs of Atp1a3 were significantly increased when the cGMP–PKG signaling pathway was activated (Figure 9a). Atp1a3 encodes a protein for the α3 subunit of Na+/K+–ATPase. Na+/K+–ATPase is located downstream of PKG and responsible for establishing and maintaining an electrochemical gradient of Na+ and K+ across the cytoplasmic membrane. Activation of ATP-dependent K+ channels exerted an ameliorative effect on diabetic nephropathy [43]. This suggested that the molecular mechanism by which OP ameliorated diabetic nephropathy in db/db mice may be related to upregulation of the cGMP–PKG signaling pathway.
In type 2 diabetes, chronic myocardium inflammation induces metabolic and cardiac structural changes, including myocardial fibrosis and cardiomyocyte apoptosis, which facilitate the diabetic heart failure phenotype [44]. In our research, the cardiac inflammation level was decreased by OP supplementation (Figure 6b). Furthermore, the results from the Masson staining pathology analysis confirmed that OP had a substantial effect in alleviating heart fibrosis, as illustrated in Figure 6a. In addition, OP supplementation inhibited cardiac apoptosis (Figure 7).
Similarly, in order to enhance our understanding of the regulatory mechanism by which OP improves long-term diabetic cardiomyopathy, transcriptomics and bioinformatics analyses were carried out. According to the transcriptome analysis, it is hypothesized that OP may ameliorate long-term diabetic cardiomyopathy by downregulating the p53 signaling pathway and the cellular senescence signaling pathway. The main functions of the p53 signaling pathway include inducing cell cycle arrest and promoting cell apoptosis [45,46,47]. p53 promotes apoptosis by activating caspase-3, as well as by upregulating the expression level of Bax and downregulating the expression of Bcl-2 [48,49]. Senescent cells are in a state of cell cycle arrest but maintain metabolic activity by secreting inflammatory factors. This secretory phenotype associated with senescence is a trigger for chronic inflammation [50]. Studies have shown that cellular senescence is associated with cardiovascular disease and may cause or exacerbate myocardial dysfunction in type 2 diabetes [51]. In the present study, OP downregulated the cellular senescence signaling pathway in the heart of db/db mice and ameliorated cardiac cell inflammation. Validation of three DEGs enriched in the signaling pathway of the p53 signaling pathway using qPCR revealed that the mRNA levels of Cdk1, Gtse1, and Ccnb2 were significantly decreased in the OP group (Figure 9b–d). Validation of DEGs enriched in the cellular senescence signaling pathway revealed that OP significantly decreased the mRNA levels of Cdk1 and Ccnb2 in the heart of db/db mice (Figure 9b,d). These qPCR results were consistent with the transcriptomic results. The above results indicated that the synergy of multiple signaling pathways might directly or indirectly mediate the mitigation of OP supplementation on long-course diabetic cardiomyopathy.
Our transcriptome analysis results showed that the molecular mechanism by which OP alleviates long-course diabetes nephropathy was related to the upregulation of the cGMP–PKG signaling pathway, and that the molecular mechanism by which OP mitigates long-course diabetes cardiomyopathy was associated with the downregulation of the p53 and cellular senescence signaling pathways. Both upregulation of cGMP–PKG and downregulation of cell senescence signaling pathways can inhibit inflammation, which suggested that OP may improve long-course diabetes nephropathy and diabetes cardiomyopathy by inhibiting inflammation, though through different signaling pathways.
In the present study, we used transcriptome sequencing to explore the mechanism of OP treatment for these diabetes complications and validated the results at the mRNA level using qPCR. However, we did not further validate the results at the protein level. Therefore, western blot or proteomics methods can be used to excavate the mechanism of OP treatment for these diseases in the future.

5. Conclusions

In summary, the present research illustrates that OP supplementation alleviates long-term diabetic nephropathy and diabetic cardiomyopathy, as evidenced by the inhibition of inflammation, fibrosis, and apoptosis. The underlying mechanism of the mitigation effects of OP is associated with the upregulation of the cGMP–PKG signaling pathway in the kidney and the downregulation of the p53 and cellular senescence signaling pathways in the heart of db/db mice. These results indicate the potential of OP as a natural dietary functional ingredient to ameliorate long-course diabetic nephropathy and diabetic cardiomyopathy.

Author Contributions

S.Z.: Conceptualization, methodology, data curation, writing—original draft, writing—review & editing. R.G.: Data curation, investigation, conceptualization, methodology. J.G.: Data curation, investigation, conceptualization. S.-G.K.: Methodology, resources. K.H.: Visualization, writing—review & editing, project administration, funding acquisition. T.T.: Conceptualization, resources, supervision, writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the Scientific Research Foundation of Anhui Polytechnic University (2022YQQ071), Beijing Natural Science Foundation (7222249), the Anhui Province Higher Education Science Research Project (2023AH050945), the College Student Innovation and Entrepreneurship Training Program Project (202310363250), and the Anhui Polytechnic University Undergraduate Teaching Quality Improvement Plan Project (2023szyzk71).

Institutional Review Board Statement

The study was conducted in accordance with the Animal Ethics Committee of China Agricultural University; AW11099102-3-4; 20 August 2019.

Data Availability Statement

Data is contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Piccoli, G.B.; Grassi, G.; Cabiddu, G.; Nazha, M.; Roggero, S.; Capizzi, I.; De Pascale, A.; Priola, A.M.; Di Vico, C.; Maxia, S.; et al. Diabetic kidney disease: A syndrome rather than a single disease. Rev. Diabet. Stud. 2015, 12, 87–109. [Google Scholar] [CrossRef] [PubMed]
  2. Kanodia, K.V.; Vanikar, A.V.; Nigam, L.; Patel, R.D.; Suthar, K.S.; Patel, H. Clinicopathological study of nondiabetic renal disease in type 2 diabetic patients: A single center experience from India. Saudi J. Kidney Dis. Transpl. 2017, 28, 1330–1337. [Google Scholar] [CrossRef]
  3. Zhao, Y.H.; Li, M.J.; Wang, Y.N.; Geng, R.X.; Fang, J.J.; Liu, Q.; Kang, S.K.; Zeng, W.C.; Huang, K.L.; Tong, T. Understanding the mechanism underlying the anti-diabetic effect of dietary component: A focus on gut microbiota. Crit. Rev. Food Sci. Nutr. 2023, 63, 7378–7398. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, X.; Kang, J.; Liu, Q.; Tong, T.; Quan, H. Fighting diabetes mellitus: Pharmacological and non-pharmacological approaches. Curr. Pharm. Des. 2020, 26, 4992–5001. [Google Scholar] [CrossRef]
  5. Wang, Y.N.; Liu, Q.; Kang, S.K.; Huang, K.L.; Tong, T. Dietary bioactive ingredients modulating the cAMP signaling in diabetes treatment. Nutrients 2021, 13, 3038. [Google Scholar] [CrossRef] [PubMed]
  6. Gupta, S.; Dominguez, M.; Golestaneh, L. Diabetic kidney disease: An update. Med. Clin. N. Am. 2023, 107, 689–705. [Google Scholar] [CrossRef] [PubMed]
  7. Murtaza, G.; Virk, H.U.H.; Khalid, M.; Lavie, C.J.; Ventura, H.; Mukherjee, D.; Ramu, V.; Bhogal, S.; Kumar, G.; Shanmugasundaram, M.; et al. Diabetic cardiomyopathy—A comprehensive updated review. Prog. Cardiovasc. Dis. 2019, 62, 315–326. [Google Scholar] [CrossRef]
  8. Zheng, S.J.; Huang, K.L.; Tong, T. Efficacy and mechanisms of oleuropein in mitigating diabetes and diabetes complications. J. Agric. Food Chem. 2021, 69, 6145–6155. [Google Scholar] [CrossRef]
  9. Ahamad, J.; Toufeeq, I.; Khan, M.A.; Ameen, M.S.M.; Anwer, E.T.; Uthirapathy, S.; Mir, S.R.; Ahmad, J. Oleuropein: A natural antioxidant molecule in the treatment of metabolic syndrome. Phyther. Res. 2019, 33, 3112–3128. [Google Scholar] [CrossRef]
  10. Liu, Y.; Dai, W.; Ye, S. The olive constituent oleuropein exerts nephritic protective effects on diabetic nephropathy in db/db mice. Arch. Physiol. Biochem. 2022, 128, 455–462. [Google Scholar] [CrossRef]
  11. Nekooeian, A.; Khalili, A.; Khosravi, M. Oleuropein offers cardioprotection in rats with simultaneous type 2 diabetes and renal hypertension. Indian J. Pharmacol. 2014, 46, 398–403. [Google Scholar] [CrossRef]
  12. Jemai, H.; Sayadi, S. Heart histopathology and oxidative features in diabetic rats and protective effects of oleuropein. Adv. Biosci. Biotechnol. 2015, 6, 383–389. [Google Scholar] [CrossRef]
  13. Zheng, S.J.; Wang, Y.N.; Fang, J.J.; Geng, R.X.; Li, M.J.; Zhao, Y.H.; Kang, S.G.; Huang, K.L.; Tong, T. Oleuropein ameliorates advanced stage of type 2 diabetes in db/db mice by regulating gut microbiota. Nutrients 2021, 13, 2131. [Google Scholar] [CrossRef] [PubMed]
  14. Kimura, T.; Kaneto, H.; Shimoda, M.; Hirukawa, H.; Okauchi, S.; Kohara, K.; Hamamoto, S.; Tawaramoto, K.; Hashiramoto, M.; Kaku, K. Protective effects of pioglitazone and/or liraglutide on pancreatic β-cells in db/db mice: Comparison of their effects between in an early and advanced stage of diabetes. Mol. Cell. Endocrinol. 2015, 400, 78–89. [Google Scholar] [CrossRef] [PubMed]
  15. Kimura, T.; Obata, A.; Shimoda, M.; Okauchi, S.; Kanda-Kimura, Y.; Nogami, Y.; Moriuchi, S.; Hirukawa, H.; Kohara, K.; Nakanishi, S.; et al. Protective effects of the SGLT2 inhibitor luseogliflozin on pancreatic β-cells in db/db mice: The earlier and longer, the better. Diabetes Obes. Metab. 2018, 20, 2442–2457. [Google Scholar] [CrossRef] [PubMed]
  16. Geng, R.X.; Fang, J.J.; Kang, S.K.; Huang, K.L.; Tong, T. Chronic exposure to UVB induces nephritis and gut microbiota dysbiosis in mice based on the integration of renal transcriptome profiles and 16S rRNA sequencing data. Environ. Pollut. 2023, 333, 122035. [Google Scholar] [CrossRef] [PubMed]
  17. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
  18. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
  19. Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef]
  20. Jheng, H.F.; Hayashi, K.; Matsumura, Y.; Kawada, T.; Seno, S.; Matsuda, H.; Inoue, K.; Nomura, W.; Takahashi, H.; Goto, T. Anti-inflammatory and antioxidative properties of isoflavones provide renal protective effects distinct from those of dietary soy proteins against diabetic nephropathy. Mol. Nutr. Food Res. 2020, 64, e2000015. [Google Scholar] [CrossRef]
  21. Wang, J.; Zhang, Q.; Li, S.; Chen, Z.; Tan, J.; Yao, J.; Duan, D. Low molecular weight fucoidan alleviates diabetic nephropathy by binding fibronectin and inhibiting ECM-receptor interaction in human renal mesangial cells. Int. J. Biol. Macromol. 2020, 150, 304–314. [Google Scholar] [CrossRef]
  22. Yang, F.Y.; Cui, Z.H.; Deng, H.J.; Wang, Y.; Chen, Y.; Li, H.Q.; Yuan, L. Identification of miRNAs-genes regulatory network in diabetic nephropathy based on bioinformatics analysis. Medicine 2019, 98, e16225. [Google Scholar] [CrossRef]
  23. Takenaka, T.; Inoue, T.; Okada, H.; Ohno, Y.; Miyazaki, T.; Chaston, D.J.; Hill, C.E.; Suzuki, H. Altered gap junctional communication and renal haemodynamics in Zucker fatty rat model of type 2 diabetes. Diabetologia 2011, 54, 2192–2201. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, Y.; Burnett, J.C. Particulate guanylyl cyclase A/cGMP signaling pathway in the kidney: Physiologic and therapeutic indications. Int. J. Mol. Sci. 2018, 19, 1006. [Google Scholar] [CrossRef]
  25. Petkov, V.; Manolov, P. Pharmacological analysis of the iridoid oleuropein. Arzneimittelforschung 1972, 22, 1476–1486. [Google Scholar]
  26. Alonso, J. Tratado de Fitofármacos y Nutracéuticos (Treaty of Phytopharmaceuticals and Nutraceuticals); Corpus Libros: Rosario, Argentina, 2004. [Google Scholar]
  27. Soliman, G.A.; Saeedan, A.S.; Abdel-Rahman, R.F.; Ogaly, H.A.; Abd-Elsalam, R.M.; Abdel-Kader, M.S. Olive leaves extract attenuates type II diabetes mellitus-induced testicular damage in rats: Molecular and biochemical study. Saudi Pharm. J. 2019, 27, 326–340. [Google Scholar] [CrossRef] [PubMed]
  28. Clewell, A.E.; Béres, E.; Vértesi, A.; Glávits, R.; Hirka, G.; Endres, J.R.; Murbach, T.S.; Szakonyiné, I.P. A Comprehensive Toxicological Safety Assessment of an Extract of Olea Europaea L. Leaves (Bonolive™). Int. J. Toxicol. 2016, 35, 208–221. [Google Scholar] [CrossRef] [PubMed]
  29. Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef]
  30. Zoidou, E.; Melliou, E.; Gikas, E.; Tsarbopoulos, A.; Magiatis, P.; Skaltsounis, A.L. Identification of Throuba Thassos, a traditional Greek table olive variety, as a nutritional rich source of oleuropein. J. Agric. Food Chem. 2010, 58, 46–50. [Google Scholar] [CrossRef]
  31. Porto, A.D.; Brosol, G.; Casarsa, V.; Bulfone, L.; Scandolin, L.; Catena, C.; Sechi, L.A. The pivotal role of oleuropein in the anti-diabetic action of the mediterranean diet: A concise review. Pharmaceutics 2022, 14, 40. [Google Scholar] [CrossRef]
  32. Susalit, E.; Agus, N.; Effendi, I.; Tjandrawinata, R.R.; Nofiarny, D.; Perrinjaquet-Moccetti, T.; Verbruggen, M. Olive (Olea europaea) leaf extract effective in patients with stage-1 hypertension: Comparison with Captopril. Phytomedicine 2011, 18, 251–258. [Google Scholar] [CrossRef] [PubMed]
  33. Kanasaki, K.; Taduri, G.; Koya, D. Diabetic nephropathy: The role of inflammation in fibroblast activation and kidney fibrosis. Front. Endocrinol. 2013, 4, 7. [Google Scholar] [CrossRef] [PubMed]
  34. Navarro-Gonzalez, J.F.; Mora-Fernandez, C. The role of inflammatory cytokines in diabetic nephropathy. J. Am. Soc. Nephrol. 2008, 19, 433–442. [Google Scholar] [CrossRef]
  35. Lim, A.K.H.; Tesch, G.H. Inflammation in Diabetic Nephropathy. Mediators Inflamm. 2012, 2012, 146154. [Google Scholar] [CrossRef]
  36. Sanchez-Nino, M.D.; Sanz, A.B.; Lorz, C.; Gnirke, A.; Rastaldi, M.P.; Nair, V.; Egido, J.; Ruiz-Ortega, M.; Kretzler, M.; Ortiz, A. BASP1 promotes apoptosis in diabetic nephropathy. J. Am. Soc. Nephrol. 2010, 21, 610–621. [Google Scholar] [CrossRef]
  37. Karabag, F.; Hazman, O.; Bozkurt, M.; Ince, S. Antioxidant status and anti-inflammatory effects of oleuropein in streptozotocin-induced diabetic nephropathy in rats. European J. Med. Plants 2017, 18, 1–10. [Google Scholar] [CrossRef]
  38. Schlossmann, J.; Schinner, E. cGMP becomes a drug target. Naunyn Schmiedeberg’s Arch. Pharmacol. 2012, 385, 243–252. [Google Scholar] [CrossRef] [PubMed]
  39. Shen, K.; Johnson, D.W.; Gobe, G.C. The role of cGMP and its signaling pathways in kidney disease. Am. J. Physiol. Renal Physiol. 2016, 311, F671–F681. [Google Scholar] [CrossRef]
  40. Burnett, J.C.; Buglioni, A. New pharmacological strategies to increase cGMP. Annu. Rev. Med. 2015, 67, 229–243. [Google Scholar]
  41. Schinner, E.; Wetzl, V.; Schlossmann, J. Cyclic nucleotide signalling in kidney fibrosis. Int. J. Mol. Sci. 2015, 16, 2320–2351. [Google Scholar] [CrossRef]
  42. Wang, Y.X.; Brooks, D.P.; Edwards, R.M. Attenuated glomerular cGMP production and renal vasodilation in streptozotocin-induced diabetic rats. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1993, 264, R952–R956. [Google Scholar] [CrossRef]
  43. Tanabe, K.; Lanaspa, M.A.; Kitagawa, W.; Rivard, C.J.; Miyazaki, M.; Klawitter, J.; Schreiner, G.F.; Saleem, M.A.; Mathieson, P.W.; Makino, H.; et al. Nicorandil as a novel therapy for advanced diabetic nephropathy in the eNOS-deficient mouse. Am. J. Physiol. Renal Physiol. 2012, 302, F1151–F1160. [Google Scholar] [CrossRef]
  44. Ramesh, P.; Yeo, J.L.; Brady, E.M.; McCann, G.P. Role of inflammation in diabetic cardiomyopathy. Ther. Adv. Endocrinol. Metab. 2022, 13, 20420188221083530. [Google Scholar] [CrossRef]
  45. Rufini, A.; Tucci, P.; Celardo, I.; Melino, G. Senescence and aging: The critical roles of p53. Oncogene 2013, 32, 5129–5143. [Google Scholar] [CrossRef]
  46. Bensaad, K.; Vousden, K.H. p53: New roles in metabolism. Trends Cell Biol. 2007, 17, 286–291. [Google Scholar] [CrossRef]
  47. Lowe, S.W.; Cepero, E.; Evan, G. Intrinsic tumour suppression. Nature 2004, 432, 307–315. [Google Scholar] [CrossRef]
  48. Sha, J.; Sui, B.; Su, X.; Meng, Q.; Zhang, C. Alteration of oxidative stress and inflammatory cytokines induces apoptosis in diabetic nephropathy. Mol. Med. Rep. 2017, 16, 7715–7723. [Google Scholar] [CrossRef] [PubMed]
  49. Miyashita, T.; Krajewski, S.; Krajewska, M.; Wang, H.G.; Lin, H.K.; Liebermann, D.A.; Hoffman, B.; Reed, J.C. Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene 1994, 9, 1799–1805. [Google Scholar] [PubMed]
  50. Shakeri, H.; Lemmens, K.; Gevaert, A.B.; De Meyer, G.R.Y.; Segers, V.F.M. Cellular senescence links aging and diabetes in cardiovascular disease. Am. J. Physiol. -Hear. Circ. Physiol. 2018, 315, H448–H462. [Google Scholar] [CrossRef] [PubMed]
  51. Henson, S.M.; Aksentijevic, D. Senescence and type 2 diabetic cardiomyopathy: How young can you die of old age? Front. Pharmacol. 2021, 12, 716517. [Google Scholar] [CrossRef] [PubMed]
Nutrients 16 00848 g001
Figure 1. Schematic diagram of experimental design.
Figure 1. Schematic diagram of experimental design.
Nutrients 16 00848 g001
Nutrients 16 00848 g002
Figure 2. OP supplementation alleviated the expansion of the mesangial matrix, renal fibrosis, and renal inflammation. (a) PAS staining of the representative kidney (400× magnification), PAS staining positive area (arrows); scale bar = 50 μm; (b) Masson’s trichrome staining of the representative kidney (400× magnification), Masson’s trichrome staining positive area (arrows); (c) histo-immunostaining of the representative kidney (400× magnification), F4/80 positive area (arrows).
Figure 2. OP supplementation alleviated the expansion of the mesangial matrix, renal fibrosis, and renal inflammation. (a) PAS staining of the representative kidney (400× magnification), PAS staining positive area (arrows); scale bar = 50 μm; (b) Masson’s trichrome staining of the representative kidney (400× magnification), Masson’s trichrome staining positive area (arrows); (c) histo-immunostaining of the representative kidney (400× magnification), F4/80 positive area (arrows).
Nutrients 16 00848 g002
Nutrients 16 00848 g003
Figure 3. OP supplementation inhibited renal apoptosis. (a–c) Representative micrographs (400× magnification) of immunohistochemical pathological sections of cleaved caspase-3, Bcl-2, and Bax; (d) representative micrographs (400× magnification) of TUNEL-stained renal pathological sections. Arrows indicate positive staining regions.
Figure 3. OP supplementation inhibited renal apoptosis. (a–c) Representative micrographs (400× magnification) of immunohistochemical pathological sections of cleaved caspase-3, Bcl-2, and Bax; (d) representative micrographs (400× magnification) of TUNEL-stained renal pathological sections. Arrows indicate positive staining regions.
Nutrients 16 00848 g003
Nutrients 16 00848 g004
Figure 4. The mRNA levels of fibrotic factors, anti-inflammatory and pro-inflammatory factors, and oxidase. (a–c) mRNA expression levels of a-SMA, Transgelin, and CTGF; (d–h) mRNA expression levels of Mrc1, Arg1, Mgl1, Mgl2, and ICAM1; (i) mRNA expression levels of NOX4. Results were expressed as mean ± standard error (SEM) (n = 3). # p < 0.05, ## p < 0.01, db/db vs. m/m. * p < 0.05, ** p < 0.01, db/db + OP vs. db/db.
Figure 4. The mRNA levels of fibrotic factors, anti-inflammatory and pro-inflammatory factors, and oxidase. (a–c) mRNA expression levels of a-SMA, Transgelin, and CTGF; (d–h) mRNA expression levels of Mrc1, Arg1, Mgl1, Mgl2, and ICAM1; (i) mRNA expression levels of NOX4. Results were expressed as mean ± standard error (SEM) (n = 3). # p < 0.05, ## p < 0.01, db/db vs. m/m. * p < 0.05, ** p < 0.01, db/db + OP vs. db/db.
Nutrients 16 00848 g004
Nutrients 16 00848 g005
Figure 5. Changes in renal gene expression induced by OP in the mice. (a) Box plot indicating gene expression distribution for each sample; (b) volcano plot showing upregulated and downregulated genes induced by OP; (c,d) GO analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group; (e,f) KEGG signaling pathway analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group.
Figure 5. Changes in renal gene expression induced by OP in the mice. (a) Box plot indicating gene expression distribution for each sample; (b) volcano plot showing upregulated and downregulated genes induced by OP; (c,d) GO analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group; (e,f) KEGG signaling pathway analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group.
Nutrients 16 00848 g005
Nutrients 16 00848 g006
Figure 6. OP inhibited myocardial fibrosis and inflammation. (a) Representative micrographs of heart pathological sections stained by Masson’s trichrome (400×), Masson’s trichrome staining positive area (arrows); (b) representative micrographs of immunohistochemical pathological sections of F4/80 expression in the heart (400×), F4/80 positive area (arrows).
Figure 6. OP inhibited myocardial fibrosis and inflammation. (a) Representative micrographs of heart pathological sections stained by Masson’s trichrome (400×), Masson’s trichrome staining positive area (arrows); (b) representative micrographs of immunohistochemical pathological sections of F4/80 expression in the heart (400×), F4/80 positive area (arrows).
Nutrients 16 00848 g006
Nutrients 16 00848 g007
Figure 7. OP supplementation inhibited cardiac apoptosis. (a–c) Representative micrographs (400×) of immunohistochemical pathological sections of cleaved caspase-3, Bcl-2, and Bax expression in the heart; (d) representative micrographs (400×) of TUNEL-stained heart pathological sections. Arrows indicate positive staining regions.
Figure 7. OP supplementation inhibited cardiac apoptosis. (a–c) Representative micrographs (400×) of immunohistochemical pathological sections of cleaved caspase-3, Bcl-2, and Bax expression in the heart; (d) representative micrographs (400×) of TUNEL-stained heart pathological sections. Arrows indicate positive staining regions.
Nutrients 16 00848 g007
Nutrients 16 00848 g008
Figure 8. Changes in cardiac gene expression induced by OP in the mice. (a) Box plot indicating gene expression distribution for each sample; (b) volcano plot showing upregulated and downregulated genes induced by OP; (c,d) GO analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group; (e,f) KEGG signaling pathway analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group.
Figure 8. Changes in cardiac gene expression induced by OP in the mice. (a) Box plot indicating gene expression distribution for each sample; (b) volcano plot showing upregulated and downregulated genes induced by OP; (c,d) GO analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group; (e,f) KEGG signaling pathway analysis of upregulated and downregulated DEGs in db/db + OP group compared with db/db group.
Nutrients 16 00848 g008
Nutrients 16 00848 g009
Figure 9. Validation of candidate DEGs using qPCR. (a) mRNA level of Atp1a3 in the kidney; (b–d) mRNA levels of Cdk1, Gtse1, and Ccnb2 in the heart. Results are expressed as mean ± standard error (SEM) (n = 3). * p < 0.05, db/db vs. db/db + OP.
Figure 9. Validation of candidate DEGs using qPCR. (a) mRNA level of Atp1a3 in the kidney; (b–d) mRNA levels of Cdk1, Gtse1, and Ccnb2 in the heart. Results are expressed as mean ± standard error (SEM) (n = 3). * p < 0.05, db/db vs. db/db + OP.
Nutrients 16 00848 g009
Table 1. Primer sequences used for qPCR.
Table 1. Primer sequences used for qPCR.
GenesGene DescriptionForward Primer 5′-3′Reverse Primer 5′-3′
α-SMAα-smooth muscle actinCCGCCATGTATGTGGCTATTAGATAGGCACGTTGTGAGTC
TransgelintransgelinGCGACTAGTGGAGTGGATTGGATCCCTCAGGATACAGGCT
CTGFconnective tissue growth factorTGGCCCTGACCCAACTATGACTTAGAACAGGCGCTCCACTCT
Mrc1mannose receptor C type 1TGTGGTGAGCTGAAAGGTGACAGGTGTGGGCTCAGGTAGT
Arg1arginase 1GTATGACGTGAGAGACCACGCTCGCAAGCCAATGTACACG
Mgl1macrophage galactose-type lectin 1ATGATGTCTGCCAGAGAACCATCACAGATTTCAGCAACCTTA
Mgl2macrophage galactose-type lectin 2TTAGCCAATGTGCTTAGCTGGGGCCTCCAATTCTTGAAACCT
Cybacytochrome b light chainGGAGCGATGTGGACAGAAGTAGGTTTAGGCTCAATGGGAGTC
Nrf2nuclear transcription factor erythroid 2-related
factor 2		CCTAGGTCCTTGTTCCGCCCTAGTCCGAGCAGCGGAGA
ICAM1intercellular adhesion molecule-1CAATGGCTTCAACCCGTGCGTTCTCAAAGCACAGCGGAC
NOX4NADPH oxidases 4CCAAATGTTGGGCGATTGTGTCAGGACTGTCCGGCACATAG
Atp1a3ATPase Na+/K+ transporting subunit alpha 3ACGGACCGACAGACGCACGCAGGATGGGCTCAGGC
Cdk1cyclin-dependent kinase 1AGAAGGTACTTACGGTGTGGTGAGAGATTTCCCGAATTGCAGT
Gtse1G two S phase expressed protein 1AGAGGATCACCAGCAAGCTCCAGTTTCGTCCTCTGAATGCTGGC
Ccnb2cyclin B2GCCAAGAGCCATGTGACTATCCAGAGCTGGTACTTTGGTGTTC
β-actinβ-actinGGCTGTATTCCCCTCCATCGCCAGTTGGTAACAATGCCATGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zheng, S.; Geng, R.; Guo, J.; Kang, S.-G.; Huang, K.; Tong, T. Oleuropein Supplementation Ameliorates Long-Course Diabetic Nephropathy and Diabetic Cardiomyopathy Induced by Advanced Stage of Type 2 Diabetes in db/db Mice. Nutrients 2024, 16, 848. https://doi.org/10.3390/nu16060848

AMA Style

Zheng S, Geng R, Guo J, Kang S-G, Huang K, Tong T. Oleuropein Supplementation Ameliorates Long-Course Diabetic Nephropathy and Diabetic Cardiomyopathy Induced by Advanced Stage of Type 2 Diabetes in db/db Mice. Nutrients. 2024; 16(6):848. https://doi.org/10.3390/nu16060848

Chicago/Turabian Style

Zheng, Shujuan, Ruixuan Geng, Jingya Guo, Seong-Gook Kang, Kunlun Huang, and Tao Tong. 2024. "Oleuropein Supplementation Ameliorates Long-Course Diabetic Nephropathy and Diabetic Cardiomyopathy Induced by Advanced Stage of Type 2 Diabetes in db/db Mice" Nutrients 16, no. 6: 848. https://doi.org/10.3390/nu16060848

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop