In Vitro and In Vivo Antioxidant and Immune Stimulation Activity of Wheat Product Extracts
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Hydroalcoholic Extraction of Durum Wheat Samples
2.3. Total Phenolic Content (TPC)
2.4. Total Flavonoid Content (TFC)
2.5. Antioxidant Activity Determination by ABTS and DPPH Assays
2.6. Biogenic Amines Determination in Durum Wheat Samples
2.7. NMR Spectroscopy
2.8. In Vitro Tests
2.8.1. Cytotoxicity Analysis by Trypan Blue Assay
2.8.2. Real-Time qPCR
2.8.3. Immunofluorescence
2.9. In Vivo Tests
2.9.1. C. elegans Strains and Growth Conditions
2.9.2. C. elegans Lifespan Assay
2.9.3. Fluorescence Analysis in C. elegans Transgenic Strains
2.9.4. Evaluation of Reactive Oxygen Species (ROS) Levels in C. elegans
2.9.5. RT-qPCR
3. Results
3.1. Phenolic and Antioxidant Properties of “Senatore Cappelli” Durum Wheat Samples
3.2. Biogenic Amines Content Among Senatore Cappelli Durum Wheat Samples
3.3. Extracts Chemical Profile
3.4. Cytotoxicity of “Senatore Cappelli” Durum Wheat
3.5. M1–M2 Polarization Markers Expression Following Incubation of BV2 Cells with Seeds, Flower, Pasta Extracts, and LPS Treatment
3.6. Antioxidant Response to Wheat Extract Supplementation in C. elegans
3.7. Innate Immunity Stimulation in C. elegans
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vinci, G.; Prencipe, S.A.; Armeli, F.; Businaro, R. A Multimethodological Approach for the Valorization of “Senatore Cappelli” Wheat Milling By-Products as a Source of Bioactive Compounds and Nutraceutical Activity. Int. J. Environ. Res. Public Health 2023, 20, 5057. [Google Scholar] [CrossRef] [PubMed]
- Meneely, P.M.; Dahlberg, C.L.; Rose, J.K. Working with Worms: Caenorhabditis elegans as a Model Organism. Curr. Protoc. Essent. Lab. Tech. 2019, 19, e35. [Google Scholar] [CrossRef]
- Shen, P.; Yue, Y.; Zheng, J.; Park, Y. Caenorhabditis Elegans: A Convenient In Vivo Model for Assessing the Impact of Food Bioactive Compounds on Obesity, Aging, and Alzheimer’s Disease. Annu. Rev. Food Sci. Technol. 2018, 9, 1–22. [Google Scholar] [CrossRef]
- Zhang, W.; Xiao, D.; Mao, Q.; Xia, H. Role of Neuroinflammation in Neurodegeneration Development. Signal Transduct. Target. Ther. 2023, 8, 267. [Google Scholar] [CrossRef]
- Kurek, M.A.; Krzemińska, A. Effect of Modified Atmosphere Packaging on Quality of Bread with Amaranth Flour Addition. Food Sci. Technol. Int. 2020, 26, 44–52. [Google Scholar] [CrossRef]
- Abdel-Naeem, H.H.S.; Sallam, K.I.; Malak, N.M.L. Improvement of the Microbial Quality, Antioxidant Activity, Phenolic and Flavonoid Contents, and Shelf Life of Smoked Herring (Clupea harengus) during Frozen Storage by Using Chitosan Edible Coating. Food Control 2021, 130, 108317. [Google Scholar] [CrossRef]
- Pierre, E.O.; Nicolas, N.; Pierre, F.O.D.; Martine, L.O.; Denis, O.N. Heritability of Polyphenols, Anthocyanins and Antioxidant Capacity of Cameroonian Cocoa (Theobroma cacao L.) Beans. Afr. J. Biotechnol. 2015, 14, 2672–2682. [Google Scholar] [CrossRef]
- Mietz, J.L.; Karmas, E. Chemical quality index of canned tuna as determined by high-pressure liquid chromatography. J. Food Sci. 1977, 42, 155–158. [Google Scholar] [CrossRef]
- Verni, M.; Torreggiani, A.; Patriarca, A.; Brasili, E.; Sciubba, F.; Rizzello, C.G. Sourdough Fermentation for the Valorization of Sorghum Flour: Microbiota Characterization and Metabolome Profiling. Int. J. Food Microbiol. 2024, 421, 110805. [Google Scholar] [CrossRef]
- Schifano, E.; Tomassini, A.; Preziosi, A.; Montes, J.; Aureli, W.; Mancini, P.; Miccheli, A.; Uccelletti, D. Leuconostoc Mesenteroides Strains Isolated from Carrots Show Probiotic Features. Microorganisms 2021, 9, 2290. [Google Scholar] [CrossRef]
- Bianchi, L.; Laghi, L.; Correani, V.; Schifano, E.; Landi, C.; Uccelletti, D.; Mattei, B. A Combined Proteomics, Metabolomics and In Vivo Analysis Approach for the Characterization of Probiotics in Large-Scale Production. Biomolecules 2020, 10, 157. [Google Scholar] [CrossRef] [PubMed]
- Yoon, D.; Lee, M.-H.; Cha, D. Measurement of Intracellular ROS in Caenorhabditis Elegans Using 2′,7′-Dichlorodihydrofluorescein Diacetate. Bio-Protocol 2018, 8, e2774. [Google Scholar] [CrossRef] [PubMed]
- Schifano, E.; Zinno, P.; Guantario, B.; Roselli, M.; Marcoccia, S.; Devirgiliis, C.; Uccelletti, D. The Foodborne Strain Lactobacillus Fermentum MBC2 Triggers Pept-1-Dependent Pro-Longevity Effects in Caenorhabditis Elegans. Microorganisms 2019, 7, 45. [Google Scholar] [CrossRef] [PubMed]
- Fardet, A.; Canlet, C.; Gottardi, G.; Lyan, B.; Llorach, R.; Rémésy, C.; Mazur, A.; Paris, A.; Scalbert, A. Whole-Grain and Refined Wheat Flours Show Distinct Metabolic Profiles in Rats as Assessed by a 1H NMR-Based Metabonomic Approach1. J. Nutr. 2007, 137, 923–929. [Google Scholar] [CrossRef]
- Podio, N.S.; Baroni, M.V.; Pérez, G.T.; Wunderlin, D.A. Assessment of Bioactive Compounds and Their In Vitro Bioaccessibility in Whole-Wheat Flour Pasta. Food Chem. 2019, 293, 408–417. [Google Scholar] [CrossRef]
- Wang, H.; Fu, Y.; Zhao, Q.; Hou, D.; Yang, X.; Bai, S.; Diao, X.; Xue, Y.; Shen, Q. Effect of Different Processing Methods on the Millet Polyphenols and Their Anti-Diabetic Potential. Front. Nutr. 2022, 9, 780499. [Google Scholar] [CrossRef]
- ElGamal, R.; Song, C.; Rayan, A.M.; Liu, C.; Al-Rejaie, S.; ElMasry, G. Thermal Degradation of Bioactive Compounds during Drying Process of Horticultural and Agronomic Products: A Comprehensive Overview. Agronomy 2023, 13, 1580. [Google Scholar] [CrossRef]
- Prior, R.L.; Wu, X.; Schaich, K. Standardized Methods for the Determination of Antioxidant Capacity and Phenolics in Foods and Dietary Supplements. J. Agric. Food Chem. 2005, 53, 4290–4302. [Google Scholar] [CrossRef]
- González-Hernández, A.I.; Scalschi, L.; Vicedo, B.; Marcos-Barbero, E.L.; Morcuende, R.; Camañes, G. Putrescine: A Key Metabolite Involved in Plant Development, Tolerance and Resistance Responses to Stress. Int. J. Mol. Sci. 2022, 23, 2971. [Google Scholar] [CrossRef]
- Karayigit, B.; Colak, N.; Ozogul, F.; Gundogdu, A.; Inceer, H.; Bilgiçli, N.; Ayaz, F.A. The Biogenic Amine and Mineral Contents of Different Milling Fractions of Bread and Durum Wheat (Triticum L.) Cultivars. Food Biosci. 2020, 37, 100676. [Google Scholar] [CrossRef]
- Sánchez-Pérez, S.; Comas-Basté, O.; Rabell-González, J.; Veciana-Nogués, M.T.; Latorre-Moratalla, M.L.; Vidal-Carou, M.C. Biogenic Amines in Plant-Origin Foods: Are They Frequently Underestimated in Low-Histamine Diets? Foods 2018, 7, 205. [Google Scholar] [CrossRef] [PubMed]
- Kurz, C.L.; Ewbank, J.J. Caenorhabditis Elegans: An Emerging Genetic Model for the Study of Innate Immunity. Nat. Rev. Genet. 2003, 4, 380–390. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Chen, W.-D.; Wang, Y.-D. DAF-16/FOXO Transcription Factor in Aging and Longevity. Front. Pharmacol. 2017, 8, 548. [Google Scholar] [CrossRef]
- Kim, D.H.; Feinbaum, R.; Alloing, G.; Emerson, F.E.; Garsin, D.A.; Inoue, H.; Tanaka-Hino, M.; Hisamoto, N.; Matsumoto, K.; Tan, M.-W.; et al. A Conserved P38 MAP Kinase Pathway in Caenorhabditis elegans Innate Immunity. Science 2002, 297, 623–626. [Google Scholar] [CrossRef]
- Gugliandolo, A.; Bramanti, P.; Mazzon, E. Activation of Nrf2 by Natural Bioactive Compounds: A Promising Approach for Stroke? Int. J. Mol. Sci. 2020, 21, 4875. [Google Scholar] [CrossRef]
- De Paula, R.; Rabalski, I.; Messia, M.C.; Abdel-Aal, E.-S.M.; Marconi, E. Effect of Processing on Phenolic Acids Composition and Radical Scavenging Capacity of Barley Pasta. Food Res. Int. 2017, 102, 136–143. [Google Scholar] [CrossRef]
- Ciudad-Mulero, M.; Barros, L.; Fernandes, Â.; Ferreira, I.C.F.R.; Callejo, M.J.; Matallana-González, M.C.; Fernández-Ruiz, V.; Morales, P.; Carrillo, J.M. Potential Health Claims of Durum and Bread Wheat Flours as Functional Ingredients. Nutrients 2020, 12, 504. [Google Scholar] [CrossRef]
- Đorđević, T.; Antov, M. Wheat Chaff Utilization: Evaluation of Antioxidant Capacity of Waste Streams Generated by Different Pretreatments. Ind. Crops Prod. 2016, 94, 649–657. [Google Scholar] [CrossRef]
- Adom, K.K.; Sorrells, M.E.; Liu, R.H. Phytochemicals and Antioxidant Activity of Milled Fractions of Different Wheat Varieties. J. Agric. Food Chem. 2005, 53, 2297–2306. [Google Scholar] [CrossRef]
- Park, J.; Kil, Y.-S.; Ryoo, G.-H.; Jin, C.H.; Hong, M.J.; Kim, J.-B.; Jung, C.-H.; Nam, J.-W.; Han, A.-R. Phytochemical Profile and Anti-Inflammatory Activity of the Hull of γ-Irradiated Wheat Mutant Lines (Triticum aestivum L.). Front. Nutr. 2023, 10, 1334344. [Google Scholar] [CrossRef]
- Guo, S.; Wang, H.; Yin, Y. Microglia Polarization from M1 to M2 in Neurodegenerative Diseases. Front. Aging Neurosci. 2022, 14, 815347. [Google Scholar] [CrossRef] [PubMed]
- Nakaso, K. Roles of Microglia in Neurodegenerative Diseases. Yonago Acta Med. 2024, 67, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Colonna, M.; Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annu. Rev. Immunol. 2017, 35, 441–468. [Google Scholar] [CrossRef]
- Cuadrado, A.; Rojo, A.I.; Wells, G.; Hayes, J.D.; Cousin, S.P.; Rumsey, W.L.; Attucks, O.C.; Franklin, S.; Levonen, A.-L.; Kensler, T.W.; et al. Therapeutic Targeting of the NRF2 and KEAP1 Partnership in Chronic Diseases. Nat. Rev. Drug Discov. 2019, 18, 295–317. [Google Scholar] [CrossRef]
- Hannan, M.A.; Dash, R.; Sohag, A.A.M.; Haque, M.N.; Moon, I.S. Neuroprotection Against Oxidative Stress: Phytochemicals Targeting TrkB Signaling and the Nrf2-ARE Antioxidant System. Front. Mol. Neurosci. 2020, 13, 116. [Google Scholar] [CrossRef]
- Bellavite, P. Neuroprotective Potentials of Flavonoids: Experimental Studies and Mechanisms of Action. Antioxidants 2023, 12, 280. [Google Scholar] [CrossRef]
- Armeli, F.; Mengoni, B.; Laskin, D.L.; Businaro, R. Interplay among Oxidative Stress, Autophagy, and the Endocannabinoid System in Neurodegenerative Diseases: Role of the Nrf2-P62/SQSTM1 Pathway and Nutraceutical Activation. Curr. Issues Mol. Biol. 2024, 46, 6868–6884. [Google Scholar] [CrossRef]
- He, D.; Fu, S.; Zhou, A.; Su, Y.; Gao, X.; Zhang, Y.; Huang, B.; Du, J.; Liu, D. Camptothecin Regulates Microglia Polarization and Exerts Neuroprotective Effects via Activating AKT/Nrf2/HO-1 and Inhibiting NF-κB Pathways In Vivo and In Vitro. Front. Immunol. 2021, 12, 619761. [Google Scholar] [CrossRef]
- Zhuang, M.; Li, J.; Wang, A.; Li, G.; Ke, S.; Wang, X.; Ning, M.; Sheng, Z.; Wang, B.; Zhou, Z. Structurally Manipulated Antioxidant Peptides Derived from Wheat Bran: Preparation and Identification. Food Chem. 2024, 442, 138465. [Google Scholar] [CrossRef]
- Li, R.; Li, X.; Wu, H.; Yang, Z.; Fei, L.; Zhu, J. Theaflavin Attenuates Cerebral Ischemia/Reperfusion Injury by Abolishing miRNA-128-3p-mediated Nrf2 Inhibition and Reducing Oxidative Stress. Mol. Med. Rep. 2019, 20, 4893–4904. [Google Scholar] [CrossRef]
- Khan, J.; Gul, P.; Rashid, M.T.; Li, Q.; Liu, K. Composition of Whole Grain Dietary Fiber and Phenolics and Their Impact on Markers of Inflammation. Nutrients 2024, 16, 1047. [Google Scholar] [CrossRef] [PubMed]
- Edwards, C.B.; Copes, N.; Brito, A.G.; Canfield, J.; Bradshaw, P.C. Malate and fumarate extend lifespan in Caenorhabditis elegans. PLoS ONE 2013, 8, e58345. [Google Scholar] [CrossRef] [PubMed]
- Edwards, C.; Canfield, J.; Copes, N.; Brito, A.; Rehan, M.; Lipps, D.; Brunquell, J.; Westerheide, S.D.; Bradshaw, P.C. Mechanisms of amino acid-mediated lifespan extension in Caenorhabditis elegans. BMC Genet. 2015, 16, 8. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Yan, M.; Xu, H.; Liang, H.; Zhang, J.; Li, M.; Wang, C. Antioxidant and Antiaging Activity of Fermented Coix Seed Polysaccharides on Caenorhabditis elegans. Nutrients 2023, 15, 2474. [Google Scholar] [CrossRef]
- Tian, W.; Zheng, Y.; Wang, W.; Wang, D.; Tilley, M.; Zhang, G.; He, Z.; Li, Y. A Comprehensive Review of Wheat Phytochemicals: From Farm to Fork and Beyond. Compr. Rev. Food Sci. Food Saf. 2022, 21, 2274–2308. [Google Scholar] [CrossRef]
Biogenic Amines | Linear Range (mg/L) | Regression Eq. | Correlation Coefficient (R2) | RSD (%) | LOD (mg/L) | LOQ (mg/L) |
---|---|---|---|---|---|---|
B-PEA | 0.1–25 | y = 8 × 106x − 51,893 | 0.999 | 1.32 | 0.04 | 0.12 |
PUT | 0.1–25 | y = 3 × 107x − 177,123 | 0.997 | 1.02 | 0.03 | 0.09 |
CAD | 0.1–25 | y = 1 × 107x − 116,338 | 0.997 | 1.06 | 0.02 | 0.07 |
HIS | 0.1–25 | y = 632,568x − 7223.8 | 0.998 | 2.71 | 0.08 | 0.24 |
SER | 0.2–8 | y = 73,089x +28,843 | 0.996 | 0.05 | 0.07 | 0.23 |
TYR | 0.1–25 | y = 1 × 106x + 4302.6 | 0.996 | 0.71 | 0.30 | 0.96 |
SPD | 0.1–25 | y = 1 × 107x − 85,162 | 0.997 | 1.14 | 0.05 | 0.15 |
SPM | 0.1–25 | y = 1 × 107x + 24,850 | 0.997 | 1.89 | 0.09 | 0.29 |
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Accession Number |
---|---|---|---|
mARG1 | ATGTGCCCTCTGTCTTTTAGGG | CTCTCACGTCATACTCTGT | NM_007482.3 |
miNOS | GGCAGCCTGTGAGACCTTTG | GCATTGGAAGTGAAGCGTTTC | AF427516.1 |
mACT-β | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT | NM_007393.5 |
mSOD1 | GCCCGCTAAGTGCTGAGTC | AGCCCCAGAAGGATAACGGA | NM_017050 |
mNRF2 | TCTGAGCCAGGACTACGACG | GAGGTGGTGGTGTCTCTGC | NM_031789 |
mIL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG | NM_008361.4 |
mTNF-α | CTGAACTTCGGGGTGATCGG | GGCTTGTCACTCGAATTTTGAGA | BC137720.1 |
mIL-10 | GCCCTTTGCTATGGTGTCCTTTC | TCCCTGGTTTCTCTTCCCAAGAC | NM_010548.2 |
mIL-6 | CGGAGAGGAGACTTCACAGAGGA | TTTCCACGATTTCCCAGAGAACA | NM_001314054.1 |
mGPX | AGGGTAGAGGCCGGATAAGG | CGAGCAGCACACATACTGGA | NM_008160 |
sek-1 | CAGAGCCGTTTATTGGGAA | TGCATCCGGCTTGTACAGT | AB060731.2 |
pmk-1 | AAATGACTCGCCGTGATTTC | CATCGTGATAAGCAGCCAGA | NM_068964.7 |
daf-16 | TCAAGACCTCAAAGCCAAT | ACGAGAAAGAAGGAGTAAG | AF032112.1 |
Act-1 | GAGCGTGGTTACTCTTTCAC | CAGAGCTTCTCCTTGATGTC | NM_073418.9 |
Samples | TPC (mg GAE/100 g) | TFC (mg RE/100 g) | ABTS Assay (mg TE/100 g) | DPPH Assay (EC50 in mg/100 g) |
---|---|---|---|---|
Seeds | 159.58 ± 2.02 * | 133.71 ± 1.44 * | 11.28 ± 0.24 * | 7.74 ± 0.15 * |
Flour | 146.81 ± 2.33 * | 125.14 ± 1.79 * | 10.05 ± 0.89 * | 3.19 ± 0.09 * |
Pasta | 148.13 ± 1.21 * | 121.57 ± 2.13 * | 9.23 ± 0.12 * | 2.29 ± 0.01 * |
Chaff | 164.17 ± 3.01 * | 136.21 ± 2.51 * | 12.30 ± 0.17 * | 4.86 ± 0.02 * |
Biogenic Amines Content (mg/kg) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Sample | BPEA | PUT | CAD | HIS | SER | TYR | SPD | SPM | Tot BAs | BAQI |
Seeds | <LOD | 2.39 ± 0.03 * | 0.15 ± 0.01 * | <LOD | <LOD | <LOD | 15.79 ± 0.25 * | 8.41 ± 0.16 * | 26.74 | 0.101 |
Flour | <LOD | 1.34 ± 0.01 * | 0.14 ± 0.03 * | <LOD | <LOD | <LOD | 9.49 ± 0.02 * | 4.66 ± 0.02 * | 15.36 | 0.097 |
Pasta | <LOD | 1.06 ± 0.02 * | 0.16 ± 0.01 * | <LOD | <LOD | <LOD | 8.51 ± 0.07 * | 3.97 ± 0.11 * | 13.69 | 0.091 |
Chaff | <LOD | 0.83 ± 0.03 * | 0.36 ± 0.01* | <LOD | <LOD | <LOD | 3.73 ± 0.14 * | 1.63 ± 0.03 * | 6.55 | 0.187 |
Molecule | Amount (mg/100 g of Dried Extract) | ||||
---|---|---|---|---|---|
Chaff | Seed | Flour | Pasta | ||
Amino Acids | Leucine | 1.23 ± 0.11 a | 0.20 ± 0.06 b | 0.21 ± 0.01 b | 0.645 ± 0.03 c |
Isoleucine | 1.37 ± 0.07 a | 0.18 ± 0.01 b | 0.18 ± 0.01 b | 0.64 ± 0.03 c | |
Valine | 2.19 ± 0.11 a | 0.52 ± 0.03 b | 0.34 ± 0.02 c | 0.92 ± 0.05 d | |
Threonine | 9.49 ± 0.48 a | 1.32 ± 0.07 b | 0.58 ± 0.03 c | 0.88 ± 0.05 d | |
Alanine | 8.63 ± 0.43 a | 1.16 ± 0.06 b | 0.76 ± 0.04 c | 1.47 ± 0.08 d | |
GABA | 3.09 ± 0.16 a | 0.12 ± 0.01 b | 0.06 ± 0.01 c | 2.49 ± 0.13 a | |
Glutamate | 3.34 ± 0.17 a | 1.57 ± 0.08 b | 1.07 ± 0.06 c | 0.46 ± 0.03 c | |
Glutamine | 2.85 ± 0.14 a | 0.20 ± 0.01 b | 0.09 ± 0.01 c | 0.29 ± 0.02 d | |
Asparagine | 2.11 ± 0.11 a | 2.59 ± 0.13 a | 1.07 ± 0.06 b | 1.24 ± 0.06 b | |
Tyrosine | 1.99 ± 0.11 a | 1.09 ± 0.06 b | 0.50 ± 0.03 c | 0.60 ± 0.03 c | |
Phenylalanine | 3.36 ± 0.17 a | 0.77 ± 0.04 b | 0.75 ± 0.04 b | 1.76 ± 0.09 c | |
Tryptophan | 1.33 ± 0.07 a | 6.02 ± 0.31 b | 2.56 ± 0.13 c | 3.34 ± 0.17 d | |
Organic acids | 3-hydroxybutyric acid | 2.17 ± 0.11 a | 0.34 ± 0.02 b | 0.57 ± 0.03 c | 0.72 ± 0.04 d |
Acetic acid | 7.11 ± 0.36 a | 0.78 ± 0.04 b | 0.45 ± 0.02 c | 0.53 ± 0.03 c | |
Succinic acid | 2.27 ± 0.12 a | 0.29 ± 0.02 b | 0.47 ± 0.03 c | 0.91 ± 0.05 d | |
Malic acid | 6.66 ± 0.34 a | 1.73 ± 0.09 b | 1.91 ± 0.11 b | 5.97 ± 0.31 a | |
Caffeic acid | 0.17 ± 0.01 a | N.D. | N.D. | N.D. | |
Fumaric acid | 0.42 ± 0.02 a | 0.24 ± 0.01 b | 0.15 ± 0.02 c | 0.78 ± 0.04 d | |
Gallic acid | 0.18 ± 0.01 a | N.D. | N.D. | N.D. | |
4-hydroxybenzoic acid | 0.17 ± 0.01 a | N.D. | N.D. | N.D. | |
Formic acid | 0.74 ± 0.04 a | 0.24 ± 0.01 b | 0.24 ± 0.01 b | 0.32 ± 0.02 c | |
Carbohydrates | Sucrose | 176.8 ± 8.8 a | 271.7 ± 13.6 b | 185.1 ± 9.3 a | 198.4 ± 9.9 a |
Raffinose | 42.58 ± 2.13 a | 145.0 ± 7.3 b | 61.2 ± 3.1 c | 48.7 ± 2.5 a | |
Glucose | 34.2 ± 1.7 a | 4.60 ± 0.23 b | 8.59 ± 0.43 c | 258.9 ± 12.9 d | |
Threalose | 11.16 ± 0.56 a | 1.81 ± 0.09 b | 0.43 ± 0.02 c | 2.41 ± 0.12 d | |
Other molecules | Fatty Acids | 43.26 ± 2.17 a | 4.95 ± 0.25 b | 4.54 ± 0.23 b | 3.88 ± 0.21 b |
Trimethilamine | 0.08 ± 0.01 a | N.D. | N.D. | N.D. | |
Choline | 8.78 ± 0.44 a | 4.45 ± 0.22 b | 2.14 ± 0.11 c | 7.51 ± 0.38 a | |
Betaine | 24.92 ± 1.25 a | 29.8 ± 1.49 a | 17.26 ± 0.86 b | 18.13 ± 0.91 b | |
Uracile | 0.42 ± 0.02 a | 0.13 ± 0.01 b | 0.09 ± 0.02 b | 0.88 ± 0.11 c | |
Trigonelline | 0.90 ± 0.05 a | 0.25 ± 0.01 b | 0.21 ± 0.01 b | 0.16 ± 0.01 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mengoni, B.; Armeli, F.; Schifano, E.; Prencipe, S.A.; Pompa, L.; Sciubba, F.; Brasili, E.; Giampaoli, O.; Mura, F.; Reverberi, M.; et al. In Vitro and In Vivo Antioxidant and Immune Stimulation Activity of Wheat Product Extracts. Nutrients 2025, 17, 302. https://doi.org/10.3390/nu17020302
Mengoni B, Armeli F, Schifano E, Prencipe SA, Pompa L, Sciubba F, Brasili E, Giampaoli O, Mura F, Reverberi M, et al. In Vitro and In Vivo Antioxidant and Immune Stimulation Activity of Wheat Product Extracts. Nutrients. 2025; 17(2):302. https://doi.org/10.3390/nu17020302
Chicago/Turabian StyleMengoni, Beatrice, Federica Armeli, Emily Schifano, Sabrina Antonia Prencipe, Laura Pompa, Fabio Sciubba, Elisa Brasili, Ottavia Giampaoli, Francesco Mura, Massimo Reverberi, and et al. 2025. "In Vitro and In Vivo Antioxidant and Immune Stimulation Activity of Wheat Product Extracts" Nutrients 17, no. 2: 302. https://doi.org/10.3390/nu17020302
APA StyleMengoni, B., Armeli, F., Schifano, E., Prencipe, S. A., Pompa, L., Sciubba, F., Brasili, E., Giampaoli, O., Mura, F., Reverberi, M., Beccaccioli, M., Pinto, A., De Giusti, M., Uccelletti, D., Businaro, R., & Vinci, G. (2025). In Vitro and In Vivo Antioxidant and Immune Stimulation Activity of Wheat Product Extracts. Nutrients, 17(2), 302. https://doi.org/10.3390/nu17020302