Unraveling the Osteogenic Activity and Molecular Mechanism of an Antioxidant Collagen Peptide in MC3T3-E1 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Alkaline Phosphatase Assay
2.5. Mineralization
2.6. RNA Isolation and Real-Time Quantitative PCR
2.7. Western Blotting
2.8. Molecular Docking Analysis
2.9. Statistical Analysis
3. Results and Discussion
3.1. Peptide UU1 Enhanced MC3T3-E1 Cell Proliferation, Differentiation, and Mineralization
3.2. Peptide UU1 Activated β-Catenin and Akt Signaling in MC3T3-E1 Cells
3.3. The Regulation of Peptide UU1 on Cell Cycle and Apoptosis
3.4. Computational Molecular Docking
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Akkawi, I.; Zmerly, H. Osteoporosis: Current Concepts. Joints 2018, 6, 122–127. [Google Scholar] [CrossRef] [PubMed]
- Ageing. Available online: https://www.who.int/health-topics/ageing (accessed on 5 August 2024).
- Caetano-Lopes, J.; Canhão, H.; Fonseca, J.E. Osteoblasts and Bone Formation. Acta Reumatol. Port. 2007, 32, 103–110. [Google Scholar] [PubMed]
- Chen, Y.; Jia, L.; Han, T.; Zhao, Z.; Yang, J.; Xiao, J.; Yang, H.-J.; Yang, K. Osteoporosis Treatment: Current Drugs and Future Developments. Front. Pharmacol. 2024, 15, 1456796. [Google Scholar] [CrossRef] [PubMed]
- Cao, C.; Xiao, Z.; Ge, C.; Wu, Y. Animal By-Products Collagen and Derived Peptide, as Important Components of Innovative Sustainable Food Systems—A Comprehensive Review. Crit. Rev. Food Sci. Nutr. 2022, 62, 8703–8727. [Google Scholar] [CrossRef]
- Tang, C.; Zhou, K.; Zhu, Y.; Zhang, W.; Xie, Y.; Wang, Z.; Zhou, H.; Yang, T.; Zhang, Q.; Xu, B. Collagen and Its Derivatives: From Structure and Properties to Their Applications in Food Industry. Food Hydrocoll. 2022, 131, 107748. [Google Scholar] [CrossRef]
- Yamanaka, H.; Okada, S.; Sanada, H. A Multicenter, Randomized, Controlled Study of the Use of Nutritional Supplements Containing Collagen Peptides to Facilitate the Healing of Pressure Ulcers. J. Nutr. Intermed. Metab. 2017, 8, 51–59. [Google Scholar] [CrossRef]
- Ren, B.; Yue, K.; Zhang, Y.; Fu, Y. Collagen-Derived Peptides as Prebiotics to Improve Gut Health. Curr. Opin. Food Sci. 2024, 55, 101123. [Google Scholar] [CrossRef]
- Kim, D.-U.; Chung, H.-C.; Choi, J.; Sakai, Y.; Lee, B.-Y. Oral Intake of Low-Molecular-Weight Collagen Peptide Improves Hydration, Elasticity, and Wrinkling in Human Skin: A Randomized, Double-Blind, Placebo-Controlled Study. Nutrients 2018, 10, 826. [Google Scholar] [CrossRef]
- Czajka, A.; Kania, E.M.; Genovese, L.; Corbo, A.; Merone, G.; Luci, C.; Sibilla, S. Daily Oral Supplementation with Collagen Peptides Combined with Vitamins and Other Bioactive Compounds Improves Skin Elasticity and Has a Beneficial Effect on Joint and General Wellbeing. Nutr. Res. 2018, 57, 97–108. [Google Scholar] [CrossRef]
- König, D.; Oesser, S.; Scharla, S.; Zdzieblik, D.; Gollhofer, A. Specific Collagen Peptides Improve Bone Mineral Density and Bone Markers in Postmenopausal Women—A Randomized Controlled Study. Nutrients 2018, 10, 97. [Google Scholar] [CrossRef]
- Zhang, H.; Qi, L.; Wang, X.; Guo, Y.; Liu, J.; Xu, Y.; Liu, C.; Zhang, C.; Richel, A. Preparation of a Cattle Bone Collagen Peptide–Calcium Chelate by the Ultrasound Method and Its Structural Characterization, Stability Analysis, and Bioactivity on MC3T3-E1 Cells. Food Funct. 2023, 14, 978–989. [Google Scholar] [CrossRef]
- Wu, W.; He, L.; Li, C.; Zhao, S.; Liang, Y.; Yang, F.; Zhang, M.; Jin, G.; Ma, M. Phosphorylation of Porcine Bone Collagen Peptide to Improve Its Calcium Chelating Capacity and Its Effect on Promoting the Proliferation, Differentiation and Mineralization of Osteoblastic MC3T3-E1 Cells. J. Funct. Foods 2020, 64, 103701. [Google Scholar] [CrossRef]
- Hong, H.; Fan, H.; Chalamaiah, M.; Wu, J. Preparation of Low-Molecular-Weight, Collagen Hydrolysates (Peptides): Current Progress, Challenges, and Future Perspectives. Food Chem. 2019, 301, 125222. [Google Scholar] [CrossRef]
- Song, Y.; Fu, Y.; Huang, S.; Liao, L.; Wu, Q.; Wang, Y.; Ge, F.; Fang, B. Identification and Antioxidant Activity of Bovine Bone Collagen-Derived Novel Peptides Prepared by Recombinant Collagenase from Bacillus Cereus. Food Chem. 2021, 349, 129143. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, Y.; Wang, X.; Wang, Y.; Liao, L.; Zhang, Y.; Fang, B.; Fu, Y. Novel Antioxidant Peptides from Yak Bones Collagen Enhanced the Capacities of Antiaging and Antioxidant in Caenorhabditis elegans. J. Funct. Foods 2022, 89, 104933. [Google Scholar] [CrossRef]
- Lu, C.; Mi, L.-Z.; Grey, M.J.; Zhu, J.; Graef, E.; Yokoyama, S.; Springer, T.A. Structural Evidence for Loose Linkage between Ligand Binding and Kinase Activation in the Epidermal Growth Factor Receptor. Mol. Cell. Biol. 2010, 30, 5432–5443. [Google Scholar] [CrossRef] [PubMed]
- Garrett, T.P.J.; McKern, N.M.; Lou, M.; Elleman, T.C.; Adams, T.E.; Lovrecz, G.O.; Zhu, H.-J.; Walker, F.; Frenkel, M.J.; Hoyne, P.A.; et al. Crystal Structure of a Truncated Epidermal Growth Factor Receptor Extracellular Domain Bound to Transforming Growth Factor Alpha. Cell 2002, 110, 763–773. [Google Scholar] [CrossRef] [PubMed]
- Emsley, J.; Knight, C.G.; Farndale, R.W.; Barnes, M.J.; Liddington, R.C. Structural Basis of Collagen Recognition by Integrin A2β1. Cell 2000, 101, 47–56. [Google Scholar] [CrossRef]
- Eberhardt, J.; Santos-Martins, D.; Tillack, A.F.; Forli, S. AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J. Chem. Inf. Model. 2021, 61, 3891–3898. [Google Scholar] [CrossRef] [PubMed]
- Laskowski, R.A.; Swindells, M.B. LigPlot+: Multiple Ligand-Protein Interaction Diagrams for Drug Discovery. J. Chem. Inf. Model. 2011, 51, 2778–2786. [Google Scholar] [CrossRef]
- Vimalraj, S. Alkaline Phosphatase: Structure, Expression and Its Function in Bone Mineralization. Gene 2020, 754, 144855. [Google Scholar] [CrossRef]
- Kuo, T.-R.; Chen, C.-H. Bone Biomarker for the Clinical Assessment of Osteoporosis: Recent Developments and Future Perspectives. Biomark. Res. 2017, 5, 18. [Google Scholar] [CrossRef] [PubMed]
- Komori, T. Regulation of Proliferation, Differentiation and Functions of Osteoblasts by Runx2. Int. J. Mol. Sci. 2019, 20, 1694. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Chi, G.; Li, P.; Lv, S.; Xu, J.; Xu, Z.; Xia, Y.; Tan, Y.; Xu, J.; Li, L.; et al. Effects of Matrix Stiffness on the Morphology, Adhesion, Proliferation and Osteogenic Differentiation of Mesenchymal Stem Cells. Int. J. Med. Sci. 2018, 15, 257–268. [Google Scholar] [CrossRef]
- Zhang, X.; Yang, M.; Lin, L.; Chen, P.; Ma, K.T.; Zhou, C.Y.; Ao, Y.F. Runx2 Overexpression Enhances Osteoblastic Differentiation and Mineralization in Adipose--Derived Stem Cells in Vitro and in Vivo. Calcif. Tissue Int. 2006, 79, 169–178. [Google Scholar] [CrossRef]
- Bruderer, M.; Richards, R.G.; Alini, M.; Stoddart, M.J. Role and Regulation of RUNX2 in Osteogenesis. Eur. Cells Mater. 2014, 28, 269–286. [Google Scholar] [CrossRef] [PubMed]
- Kern, B.; Shen, J.; Starbuck, M.; Karsenty, G. Cbfa1 Contributes to the Osteoblast-Specific Expression of Type I Collagen Genes. J. Biol. Chem. 2001, 276, 7101–7107. [Google Scholar] [CrossRef]
- Blair, H.C.; Larrouture, Q.C.; Li, Y.; Lin, H.; Beer-Stoltz, D.; Liu, L.; Tuan, R.S.; Robinson, L.J.; Schlesinger, P.H.; Nelson, D.J. Osteoblast Differentiation and Bone Matrix Formation In Vivo and In Vitro. Tissue Eng. Part B Rev. 2017, 23, 268–280. [Google Scholar] [CrossRef] [PubMed]
- Chekroun, A.; Pujo-Menjouet, L.; Falcoz, S.; Tsuen, K.; Yueh-Hsun Yang, K.; Berteau, J.-P. Theoretical Evidence of Osteoblast Self-Inhibition after Activation of the Genetic Regulatory Network Controlling Mineralization. J. Theor. Biol. 2022, 537, 111005. [Google Scholar] [CrossRef] [PubMed]
- Zoch, M.L.; Clemens, T.L.; Riddle, R.C. New Insights into the Biology of Osteocalcin. Bone 2016, 82, 42–49. [Google Scholar] [CrossRef]
- Liu, T.M.; Lee, E.H. Transcriptional Regulatory Cascades in Runx2-Dependent Bone Development. Tissue Eng. Part B Rev. 2013, 19, 254–263. [Google Scholar] [CrossRef]
- Heo, S.-Y.; Ko, S.-C.; Nam, S.Y.; Oh, J.; Kim, Y.-M.; Kim, J.-I.; Kim, N.; Yi, M.; Jung, W.-K. Fish Bone Peptide Promotes Osteogenic Differentiation of MC3T3-E1 Pre-Osteoblasts through Upregulation of MAPKs and Smad Pathways Activated BMP-2 Receptor. Cell Biochem. Funct. 2018, 36, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Nelson, W.J. Regulation of Cell–Cell Adhesion by the Cadherin–Catenin Complex. Biochem. Soc. Trans. 2008, 36, 149–155. [Google Scholar] [CrossRef] [PubMed]
- Winiarska, A.; Knysak, M.; Nabrdalik, K.; Gumprecht, J.; Stompór, T. Inflammation and Oxidative Stress in Diabetic Kidney Disease: The Targets for SGLT2 Inhibitors and GLP-1 Receptor Agonists. Int. J. Mol. Sci. 2021, 22, 10822. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Zhang, X.; He, B.; Yang, R.; Zhang, Y.; Shen, Z.; Chen, P.; Du, W. Geraniin Promotes Osteoblast Proliferation and Differentiation via the Activation of Wnt/β-Catenin Pathway. Biomed. Pharmacother. 2018, 99, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Ye, M.; Jia, W.; Zhang, C.; Shen, Q.; Zhu, L.; Wang, L. Preparation, Identification and Molecular Docking Study of Novel Osteoblast Proliferation-Promoting Peptides from Yak (Bos Grunniens) Bones. RSC Adv. 2019, 9, 14627–14637. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Xie, Y.; Wen, B.; Ye, M.; Liu, Y.; Imam, K.M.S.U.; Cai, H.; Zhang, C.; Wang, F.; Xin, F. Porcine Bone Collagen Peptides Promote Osteoblast Proliferation and Differentiation by Activating the PI3K/Akt Signaling Pathway. J. Funct. Foods 2020, 64, 103697. [Google Scholar] [CrossRef]
- Wolf, D.; Witte, V.; Laffert, B.; Blume, K.; Stromer, E.; Trapp, S.; d’Aloja, P.; Schürmann, A.; Baur, A.S. HIV-1 Nef Associated PAK and PI3-Kinases Stimulate Akt-Independent Bad-Phosphorylation to Induce Anti-Apoptotic Signals. Nat. Med. 2001, 7, 1217–1224. [Google Scholar] [CrossRef] [PubMed]
- Patschan, D.; Loddenkemper, K.; Buttgereit, F. Molecular Mechanisms of Glucocorticoid-Induced Osteoporosis. Bone 2001, 29, 498–505. [Google Scholar] [CrossRef] [PubMed]
- Ruijtenberg, S.; van den Heuvel, S. Coordinating Cell Proliferation and Differentiation: Antagonism between Cell Cycle Regulators and Cell Type-Specific Gene Expression. Cell Cycle 2016, 15, 196. [Google Scholar] [CrossRef]
- Ding, L.; Cao, J.; Lin, W.; Chen, H.; Xiong, X.; Ao, H.; Yu, M.; Lin, J.; Cui, Q. The Roles of Cyclin-Dependent Kinases in Cell-Cycle Progression and Therapeutic Strategies in Human Breast Cancer. Int. J. Mol. Sci. 2020, 21, 1960. [Google Scholar] [CrossRef]
- Sherr, C.J. Mammalian G1 Cyclins. Cell 1993, 73, 1059–1065. [Google Scholar] [CrossRef] [PubMed]
- Aaseth, J.; Boivin, G.; Andersen, O. Osteoporosis and Trace Elements—An Overview. J. Trace Elem. Med. Biol. Organ Soc. Miner. Trace Elem. GMS 2012, 26, 149–152. [Google Scholar] [CrossRef] [PubMed]
- Kale, J.; Osterlund, E.J.; Andrews, D.W. BCL-2 Family Proteins: Changing Partners in the Dance towards Death. Cell Death Differ. 2018, 25, 65–80. [Google Scholar] [CrossRef]
- Wiren, K.M.; Toombs, A.R.; Semirale, A.A.; Zhang, X. Osteoblast and Osteocyte Apoptosis Associated with Androgen Action in Bone: Requirement of Increased Bax/Bcl-2 Ratio. Bone 2006, 38, 637–651. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Ognjenovic, J.; Karandur, D.; Miller, K.; Merk, A.; Subramaniam, S.; Kuriyan, J. A Molecular Mechanism for the Generation of Ligand-Dependent Differential Outputs by the Epidermal Growth Factor Receptor. eLife 2021, 10, e73218. [Google Scholar] [CrossRef] [PubMed]
- Chin, Y.K.-Y.; Headey, S.J.; Mohanty, B.; Patil, R.; McEwan, P.A.; Swarbrick, J.D.; Mulhern, T.D.; Emsley, J.; Simpson, J.S.; Scanlon, M.J. The Structure of Integrin α1I Domain in Complex with a Collagen-Mimetic Peptide. J. Biol. Chem. 2013, 288, 36796–36809. [Google Scholar] [CrossRef] [PubMed]
- Mizuno, M.; Fujisawa, R.; Kuboki, Y. Type I Collagen-Induced Osteoblastic Differentiation of Bone-Marrow Cells Mediated by Collagen-Alpha2beta1 Integrin Interaction. J. Cell. Physiol. 2000, 184, 207–213. [Google Scholar] [CrossRef]
- Graham, K.L.; Zeng, W.; Takada, Y.; Jackson, D.C.; Coulson, B.S. Effects on Rotavirus Cell Binding and Infection of Monomeric and Polymeric Peptides Containing A2β1 and Axβ2 Integrin Ligand Sequences. J. Virol. 2004, 78, 11786–11797. [Google Scholar] [CrossRef] [PubMed]
- Popov, C.; Radic, T.; Haasters, F.; Prall, W.C.; Aszodi, A.; Gullberg, D.; Schieker, M.; Docheva, D. Integrins A2β1 and A11β1 Regulate the Survival of Mesenchymal Stem Cells on Collagen I. Cell Death Dis. 2011, 2, e186. [Google Scholar] [CrossRef]
Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) |
---|---|---|
ALP | CCAACTCTTTTGTGCCAGAGA | GGCTACATTGGTGTTGAGCTTTT |
Akt | ATGAACGACGTAGCCATTGTG | TTGTAGCCAATAAAGGTGCCAT |
β-Catenin | TCATCATTCTGGCCAGTG | AGAGCAGACAGACAGCACT |
β-Actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Wang, Y.; Zhuang, X.; Zhang, Y.; Fang, B.; Fu, Y. Unraveling the Osteogenic Activity and Molecular Mechanism of an Antioxidant Collagen Peptide in MC3T3-E1 Cells. Nutrients 2025, 17, 824. https://doi.org/10.3390/nu17050824
Wang Y, Wang Y, Zhuang X, Zhang Y, Fang B, Fu Y. Unraveling the Osteogenic Activity and Molecular Mechanism of an Antioxidant Collagen Peptide in MC3T3-E1 Cells. Nutrients. 2025; 17(5):824. https://doi.org/10.3390/nu17050824
Chicago/Turabian StyleWang, Yali, Yue Wang, Xiaoyan Zhuang, Yonghui Zhang, Baishan Fang, and Yousi Fu. 2025. "Unraveling the Osteogenic Activity and Molecular Mechanism of an Antioxidant Collagen Peptide in MC3T3-E1 Cells" Nutrients 17, no. 5: 824. https://doi.org/10.3390/nu17050824
APA StyleWang, Y., Wang, Y., Zhuang, X., Zhang, Y., Fang, B., & Fu, Y. (2025). Unraveling the Osteogenic Activity and Molecular Mechanism of an Antioxidant Collagen Peptide in MC3T3-E1 Cells. Nutrients, 17(5), 824. https://doi.org/10.3390/nu17050824