Korean Pine Nut Oil Attenuated Hepatic Triacylglycerol Accumulation in High-Fat Diet-Induced Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Diets
Control Diet (g) (10% of the kcal from Fat) | High-Fat Diet (g) (45% of the kcal from Fat) | |
---|---|---|
10% Oil | 10% Oil + 35% Lard | |
Casein | 200 | 200 |
l-Cystine | 3 | 3 |
Sucrose | 350 | 172.8 |
Cornstarch | 315 | 72.8 |
Dyetrose | 35 | 100 |
PNO 2 or SBO | 45 | 45 |
Lard | 0 | 157.5 |
t-Butylhydroquinone | 0.009 | 0.009 |
Cellulose | 50 | 50 |
Mineral Mix 3 | 35 | 35 |
Vitamin Mix 4 | 10 | 10 |
Choline Bitartrate | 2 | 2 |
Total | 1045.0 | 848.1 |
kcal/g diet | 3.69 | 4.64 |
SBO | PNO | |||
---|---|---|---|---|
Control Diet (SC) | High-Fat Diet (SHFD) | Control Diet (PC) | High-Fat Diet (PHFD) | |
Myristic acid (C14:0) | ND | 0.9 | ND | 0.9 |
Palmitic acid (C16:0) | 11.9 | 18.9 | 7.0 | 17.8 |
Stearic acid (C18:0) | 4.8 | 11.1 | 3.6 | 10.7 |
Total saturated fatty acid | 16.7 | 30.9 | 10.6 | 29.4 |
Palmitoleic acid (C16:1, Δ9) | ND | 1.4 | ND | 1.4 |
Oleic acid (C18:1, Δ9) | 21.1 | 34.7 | 27.4 | 36.0 |
Total monounsaturated fatty acid | 21.1 | 36.1 | 27.4 | 37.4 |
Linoleic acid (C18:2, Δ9, 12) | 54.9 | 30.3 | 47.2 | 28.6 |
α-linolenic acid (C18:3, Δ9, 12, 15) | 7.4 | 2.8 | 0.8 | 1.3 |
Pinolenic acid (C18:3, Δ5, 9, 12) | ND | ND | 14.0 | 3.3 |
Total polyunsaturated fatty acid | 62.3 | 33.1 | 62.0 | 33.2 |
2.2. Serum Lipid Concentrations
2.3. Serum Leptin and Fetuin-A Concentrations
2.4. Liver Histology
2.5. Hepatic Lipid Contents
2.6. Real-Time PCR Analysis of the Genes in Liver Tissue
Gene | Function | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|---|
Ahsg/fetuin-A | fatty liver indicator | TTGCTCAGCTCTGGGGCT | GGCAAGTGGTCTCCAGTGTG |
Ppara | transcription factor promoting fatty acid oxidation | GCAGTGGAAGAATCGGACCT | CAACCCGCCTTTTGTCATAC |
Cpt1a | mitochondrial β-oxidation | GATGTTCTTCGTCTGGCTTGA | CTTATCGTGGTGGTGGGTGT |
Acadl | mitochondrial β-oxidation | TCGCAATATAGGGCATGACA | ACTTGGGAAGAGCAAGCGTA |
Hadha | mitochondrial β-oxidation | CCCTTTGAACACTTGCTGCT | GCCCAGGTCTCTGTGGATAA |
Acox1 | peroxisomal β-oxidation | GTCAAAGGCATCCACCAAAG | GAGGGGAACATCATCACAGG |
Cyp4a10 | microsomal ω-oxidation | CAGAAAGGAGGGAAGATGGAG | CATGGTCTCCAAAATCCAAGG |
Sod2 | anti-oxidative defense | TTAGAGCAGGCAGCAATCTGT | GCGTGACTTTGGGTCTTTTG |
Ucp2 | anti-oxidative defense | CAGGTCACTGTGCCCTTACCA | CACTACGTTCCAGGATCCCAA |
Pparg | transcription factor promoting adipogenesis | CAGCAGGTTGTCTTGGATGTC | AGCCCTTTGGTGACTTTATGG |
Srebf1 | de novo lipogenesis | GTCTCCACCACTTCGGGTTT | CGACTACATCCGCTTCTTGC |
Fasn | de novo lipogenesis | GCGGTGTGAAAACGAACTTT | CTGTCTGGGCATAACGGTCT |
Slc25a1 | de novo lipogenesis | TTCCCTTTAGCCCTTGTTCC | TGACCAGACTTCCTCCAACC |
Fabp1 | fatty acid transport | GAACTCATTGCGGACCACTT | CATCCAGAAAGGGAAGGACAT |
Cd36 | fatty acid transport | CCAAGCTATTGCGACATGATT | TCTCAATGTCCGAGACTTTTCA |
Gapdh | endogenous control | GGAGAAACCTGCCAAGTA | AAGAGTGGGAGTTGCTGTTG |
2.7. Western Blot Analysis of SIRT3 in White Adipose Tissue
2.8. Statistical Analysis
3. Results
3.1. Body Weight, Energy Intake, and Body Fat Accumulation
SC (n = 10) | PC (n = 11) | SHFD (n = 11) | PHFD (n = 11) | p Value | |||
---|---|---|---|---|---|---|---|
Fat Amount | Oil Type | Interaction | |||||
Body weight at 0 week (g) | 17.3 ± 0.5 | 16.7 ± 0.4 | 17.0 ± 0.4 | 17.0 ± 0.3 | 0.97 | 0.56 | 0.50 |
Body weight at 12 weeks (g) | 32.8 ± 1.0 ab | 30.5 ± 0.6 a | 38.5 ± 1.4 c | 34.6 ± 1.4 b | 0.00 | 0.01 | 0.49 |
Weight gain (g) | 15.5 ± 0.8 ab | 13.8 ± 0.6 a | 21.5 ± 1.1 c | 17.5 ± 1.3 b | 0.00 | 0.01 | 0.32 |
Average daily food intake (g/day) | 3.20 ± 0.06 b | 3.20 ± 0.03 b | 2.82 ± 0.05 a | 2.76 ± 0.04 a | 0.00 | 0.54 | 0.48 |
Average daily energy intake (kcal/day) 1 | 11.8 ± 0.2 a | 11.8 ± 0.1 a | 13.1 ± 0.2 b | 12.8 ± 0.2 b | 0.00 | 0.50 | 0.43 |
Total white adipose tissue (g) 2 | 3.1 ± 0.2 b | 2.2 ± 0.2 a | 5.3 ± 0.4 d | 4.4 ± 0.4 c | 0.00 | 0.00 | 0.95 |
Epididymal (g) | 1.3 ± 0.1 b | 0.9 ± 0.1 a | 2.2 ± 0.2 c | 1.9 ± 0.2 c | 0.00 | 0.00 | 0.68 |
Retroperitoneal and perirenal (g) | 0.60 ± 0.04 b | 0.41 ± 0.05 a | 0.99 ± 0.06 c | 0.84 ± 0.08 c | 0.00 | 0.01 | 0.79 |
Abdominal subcutaneous (g) | 1.2 ± 0.1 a | 0.9 ± 0.1 a | 2.1 ± 0.2 c | 1.7 ± 0.2 b | 0.00 | 0.01 | 0.52 |
3.2. Serum Lipid Levels
SC (n = 10) | PC (n = 11) | SHFD (n = 11) | PHFD (n = 11) | p value | |||
---|---|---|---|---|---|---|---|
Fat Amount | Oil Type | Interaction | |||||
Serum triacylglycerol (mg/dL) | 116.0 ± 8.4 | 133.5 ± 10.4 | 163.0 ± 33.8 | 118.1 ± 16.1 | 0.44 | 0.50 | 0.13 |
Serum cholesterol (mg/dL) | 282.8 ± 10.5 | 250.2 ± 15.7 | 284.7 ± 22.1 | 258.1 ± 16.2 | 0.77 | 0.09 | 0.86 |
Serum NEFA (mmol/L) | 1.09 ± 0.08 | 1.35 ± 0.08 | 1.71 ± 0.40 | 1.62 ± 0.29 | 0.09 | 0.73 | 0.50 |
Serum leptin (ng/mL) | 19.9 ± 2.8 ab | 12.6 ± 2.0 a | 43.3 ± 6.8 c | 29.2 ± 4.5 b | <0.01 | 0.02 | 0.46 |
3.3. Liver Lipid Levels
3.4. Hepatic Fetuin-A mRNA and Serum Fetuin-A Levels
3.5. Hepatic Expression of Genes Involved in Fatty Acid Oxidation and Oxidative Stress
3.6. Hepatic Expression of Genes Involved in Lipogenic Pathways
3.7. SIRT3 Protein Expression in White Adipose Tissue
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Appendix
SC (n = 6) | PC (n = 7) | SHFD (n = 7) | PHFD (n = 7) | p Value | |||
---|---|---|---|---|---|---|---|
Fat Amount | Oil Type | Interaction | |||||
Steatosis | 1.00 ± 0.26 | 0.71 ± 0.29 | 1.00 ± 0.31 | 0.86 ± 0.26 | 0.80 | 0.46 | 0.80 |
Ballooning | 0.50 ± 0.34 | 0.57 ± 0.37 | 1.00 ± 0.38 | 0.86 ± 0.34 | 0.29 | 0.92 | 0.77 |
Inflammation | 0.50 ± 0.22 | 0.14 ± 0.14 | 0.29 ± 0.18 | 0.14 ± 0.14 | 0.54 | 0.16 | 0.54 |
NAFLD activity score (NAS) | 2.00 ± 0.52 | 1.43 ± 0.48 | 2.29 ± 0.64 | 1.86 ± 0.63 | 0.54 | 0.40 | 0.90 |
References
- Ogden, C.L.; Yanovski, S.Z.; Carroll, M.D.; Flegal, K.M. The epidemiology of obesity. Gastroenterology 2007, 132, 2087–2102. [Google Scholar] [CrossRef] [PubMed]
- Browning, J.D.; Szczepaniak, L.S.; Dobbins, R.; Nuremberg, P.; Horton, J.D.; Cohen, J.C.; Grundy, S.M.; Hobbs, H.H. Prevalence of hepatic steatosis in an urban population in the United States: Impact of ethnicity. Hepatology 2004, 40, 1387–1395. [Google Scholar] [CrossRef] [PubMed]
- Eguchi, Y.; Hyogo, H.; Ono, M.; Mizuta, T.; Ono, N.; Fujimoto, K.; Chayama, K.; Saibara, T. Prevalence and associated metabolic factors of nonalcoholic fatty liver disease in the general population from 2009 to 2010 in Japan: A multicenter large retrospective study. J. Gastroenterol. 2012, 47, 586–595. [Google Scholar] [CrossRef] [PubMed]
- Park, S.H.; Jeon, W.K.; Kim, S.H.; Kim, H.J.; Park, D.I.; Cho, Y.K.; Sung, I.K.; Sohn, C.I.; Keum, D.K.; Kim, B.I. Prevalence and risk factors of non-alcoholic fatty liver disease among Korean adults. J. Gastroenterol. Hepatol. 2006, 21, 138–143. [Google Scholar] [CrossRef] [PubMed]
- Fabbrini, E.; Sullivan, S.; Klein, S. Obesity and nonalcoholic fatty liver disease: Biochemical, metabolic, and clinical implications. Hepatology 2010, 51, 679–689. [Google Scholar] [CrossRef] [PubMed]
- Anderson, N.; Borlak, J. Molecular mechanisms and therapeutic targets in steatosis and steatohepatitis. Pharmacol. Rev. 2008, 60, 311–357. [Google Scholar] [CrossRef] [PubMed]
- Ferramosca, A.; Zara, V. Modulation of hepatic steatosis by dietary fatty acids. World J. Gastroenterol. 2014, 20, 1746–1755. [Google Scholar] [CrossRef] [PubMed]
- Leamy, A.K.; Egnatchik, R.A.; Young, J.D. Molecular mechanisms and the role of saturated fatty acids in the progression of non-alcoholic fatty liver diesease. Prog. Lipid Res. 2013, 52, 165–174. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Jones, P.J. Dietary conjugated linoleic acid and body composition. Am. J. Clin. Nutr. 2004, 79, S1153–S1158. [Google Scholar]
- Scorletti, E.; Byrne, C.D. Omega-3 fatty acids, hepatic lipid metabolism, and nonalcoholic fatty liver disease. Annu. Rev. Nutr. 2013, 33, 231–248. [Google Scholar] [CrossRef] [PubMed]
- Asset, G.; Baugé, E.; Wolff, R.L.; Fruchart, J.C.; Dallongeville, J. Pinus pinaster oil affects lipoprotein metabolism in apolipoprotein E-deficient mice. J. Nutr. 1999, 129, 1972–1978. [Google Scholar] [PubMed]
- Asset, G.; Baugé, E.; Wolff, R.L.; Fruchart, J.C.; Dallongeville, J. Effects of dietary maritime pine seed oil on lipoprotein metabolism and atherosclerosis development in mice expressing human apolipoprotein B. Eur. J. Nutr. 2001, 40, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Ferramosca, A.; Savy, V.; Einerhand, A.W.C.; Zara, V. Pinus koraiensis seed oil (PinnoThin™) supplementation reduces body weight gain and lipid concentration in liver and plasma of mice. J. Anim. Feed Sci. 2008, 17, 621–630. [Google Scholar]
- Ferramosca, A.; Savy, V.; Conte, L.; Zara, V. Dietary combination of conjugated linoleic acid (CLA) and pine nut oil prevents CLA-induced fatty liver in mice. J. Agric. Food Chem. 2008, 56, 8148–8158. [Google Scholar] [CrossRef] [PubMed]
- Hughes, G.M.; Boyland, E.J.; Williams, N.J.; Mennen, L.; Scott, C.; Kirkham, T.C.; Harrold, J.A.; Keizer, H.G.; Halford, J.C. The effect of Korean pine nut oil (PinnoThin™) on food intake, feeding behaviour and appetite: A double-blind placebo-controlled trial. Lipids Health Dis. 2008, 7, 6. [Google Scholar] [CrossRef] [PubMed]
- Pasman, W.J.; Heimerikx, J.; Rubingh, C.M.; van den Berg, R.; O’Shea, M.; Gambelli, L.; Hendriks, H.F.; Einerhand, A.W.; Scott, C.; Keizer, H.G.; et al. The effect of Korean pine nut oil on in vitro CCK release, on appetite sensations and on gut hormones in post-menopausal overweight women. Lipids Health Dis. 2008, 7, 10. [Google Scholar] [CrossRef] [PubMed]
- Nogueiras, R.; Habegger, K.M.; Chaudhary, N.; Finan, B.; Banks, A.S.; Dietrich, M.O.; Horvath, T.L.; Sinclair, D.A.; Pfluger, P.T.; Tschöp, M.H. Sirtuin 1 and sirtuin 3: Physiological modulators of metabolism. Physiol. Rev. 2012, 92, 1479–1514. [Google Scholar] [CrossRef] [PubMed]
- Sebastián, C.; Satterstrom, F.K.; Haigis, M.C.; Mostoslavsky, R. From sirtuin biology to human diseases: An update. J. Biol. Chem. 2012, 287, 42444–42452. [Google Scholar] [CrossRef] [PubMed]
- Parihar, P.; Solanki, I.; Mansuri, M.L.; Parihar, M.S. Mitochondrial sirtuins: Emerging roles in metabolic regulations, energy homeostasis and disease. Exp. Gerontol. 2015, 61, 130–141. [Google Scholar] [CrossRef] [PubMed]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [PubMed]
- Tiniakos, D.G.; Vos, M.B.; Brunt, E.M. Nonalcoholic fatty liver disease: Pathology and pathogenesis. Annu. Rev. Pathol. 2010, 5, 145–171. [Google Scholar] [CrossRef] [PubMed]
- De Vogel-van den Bosch, H.M.; de Wit, N.J.; Hooiveld, G.J.; Vermeulen, H.; van der Veen, J.N.; Houten, S.M.; Kuipers, F.; Műller, M.; van der Meer, R. A cholesterol-free, high-fat diet suppresses gene expression of cholesterol transporters in murine small intestine. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 294, G1171–G1180. [Google Scholar] [CrossRef] [PubMed]
- Desmarchelier, C.; Dahlhoff, C.; Keller, S.; Sailer, M.; Jahreis, G.; Daniel, H. C57Bl/6 N mice on a western diet display reduced intestinal and hepatic cholesterol levels despite a plasma hypercholesterolemia. BMC Genomics 2012, 13, 84. [Google Scholar] [CrossRef] [PubMed]
- Schrauwen, P.; Wagenmakers, A.J.; van Marken Lichtenbelt, W.D.; Saris, W.H.; Westerterp, K.R. Increase in fat oxidation on a high-fat diet is accompanied by an increase in triglyceride-derived fatty acid oxidation. Diabetes 2000, 49, 640–646. [Google Scholar] [CrossRef] [PubMed]
- Sunny, N.E.; Parks, E.J.; Browning, J.D.; Burgess, S.C. Excessive hepatic mitochondrial TCA cycle and gluconeogenesis in humans with nonalcoholic fatty liver disease. Cell Metab. 2011, 14, 804–810. [Google Scholar] [CrossRef] [PubMed]
- Miao, L.; St Clair, D.K. Regulation of superoxide dismutase genes: Implications in disease. Free Radic. Biol. Med. 2009, 47, 344–356. [Google Scholar] [CrossRef] [PubMed]
- Eaton, S. Control of mitochondrial β-oxidation flux. Prog. Lipid Res. 2002, 41, 197–239. [Google Scholar] [CrossRef]
- Bartlett, K.; Eaton, S. Mitochondrial β-oxidation. Eur. J. Biochem. 2004, 271, 462–469. [Google Scholar] [CrossRef] [PubMed]
- Le, N.H.; Shin, S.; Tu, T.H.; Kim, C.S.; Kang, J.H.; Tsuyoshi, G.; Teruo, K.; Han, S.N.; Yu, R. Diet enriched with Korean pine nut oil improves mitochondrial oxidative metabolism in skeletal muscle and brown adipose tissue in diet-induced obesity. J. Agric. Food Chem. 2012, 60, 11935–11941. [Google Scholar] [CrossRef] [PubMed]
- Stefan, N.; Fritsche, A.; Weikert, C.; Boeing, H.; Joost, H.G.; Häring, H.U.; Schulze, M.B. Plasma fetuin-A levels and the risk of type 2 diabetes. Diabetes 2008, 57, 2762–2767. [Google Scholar] [CrossRef] [PubMed]
- Brix, J.M.; Stingl, H.; Hollerl, F.; Schernthaner, G.H.; Kopp, H.P.; Schernthaner, G. Elevated Fetuin-A concentrations in morbid obesity decrease after dramatic weight loss. J. Clin. Endocrinol. Metab. 2010, 95, 4877–4881. [Google Scholar] [CrossRef] [PubMed]
- Reinehr, T.; Roth, C.L. Fetuin-A and its relation to metabolic syndrome and fatty liver disease in obese children before and after weight loss. J. Clin. Endocrinol. Metab. 2008, 93, 4479–4485. [Google Scholar] [CrossRef] [PubMed]
- Mathews, S.T.; Singh, G.P.; Ranalletta, M.; Cintron, V.J.; Qiang, X.; Goustin, A.S.; Jen, K.L.; Charron, M.J.; Jahnen-Dechent, W.; Grunberger, G. Improved insulin sensitivity and resistance to weight gain in mice null for the Ahsg gene. Diabetes 2002, 51, 2450–2458. [Google Scholar] [CrossRef] [PubMed]
- Stefan, N.; Hennige, A.M.; Staiger, H.; Machann, J.; Schick, F.; Kröber, S.M.; Machicao, F.; Fritsche, A.; Häring, H.U. Alpha2-Heremans-Schmid glycoprotein/fetuin-A is associated with insulin resistance and fat accumulation in the liver in humans. Diabetes Care 2006, 29, 853–857. [Google Scholar] [CrossRef] [PubMed]
- Haukeland, J.W.; Dahl, T.B.; Yndestad, A.; Gladhaug, I.P.; Løberg, E.M.; Haaland, T.; Konopski, Z.; Wium, C.; Aasheim, E.T.; Johansen, O.E.; et al. Fetuin A in nonalcoholic fatty liver disease: In vivo and in vitro studies. Eur. J. Endocrinol. 2012, 166, 503–510. [Google Scholar] [CrossRef] [PubMed]
- Donnelly, K.L.; Smith, C.I.; Schwarzenberg, S.J.; Jessurun, J.; Boldt, M.D.; Parks, E.J. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J. Clin. Investig. 2005, 115, 1343–1351. [Google Scholar] [CrossRef] [PubMed]
- Hirschey, M.D.; Shimazu, T.; Goetzman, E.; Jing, E.; Schwer, B.; Lombard, D.B.; Grueter, C.A.; Harris, C.; Biddinger, S.; Ilkayeva, O.R.; et al. SIRT3 regulates mitochondrial fatty-acid oxidation by reversible enzyme deacetylation. Nature 2010, 464, 121–125. [Google Scholar] [CrossRef] [PubMed]
- Qiu, X.; Brown, K.; Hirschey, M.D.; Verdin, E.; Chen, D. Calorie restriction reduces oxidative stress by SIRT3-mediated SOD2 activation. Cell Metab. 2010, 12, 662–667. [Google Scholar] [CrossRef] [PubMed]
- Rector, R.S.; Uptergrove, G.M.; Morris, E.M.; Borengasser, S.J.; Laughlin, M.H.; Booth, F.W.; Thyfault, J.P.; Ibdah, J.A. Daily exercise vs. caloric restriction for prevention of nonalcoholic fatty liver disease in the OLETF rat model. Am. J. Physiol. Gastrointest. Liver Physiol. 2011, 300, G874–G883. [Google Scholar] [CrossRef] [PubMed]
- Snel, M.; Jonker, J.T.; Hammer, S.; Kerpershoek, G.; Lamb, H.J.; Meinders, A.E.; Pijl, H.; de Roos, A.; Romijn, J.A.; Smit, J.W.; et al. Long-term beneficial effect of a 16-week very low calorie diet on pericardial fat in obese type 2 diabetes mellitus patients. Obesity 2012, 20, 1572–1576. [Google Scholar] [CrossRef]
- Edholm, D.; Kullberg, J.; Haenni, A.; Karlsson, F.A.; Ahlström, A.; Hedberg, J.; Ahlström, H.; Sundbom, M. Preoperative 4-week low-calorie diet reduces liver volume and intrahepatic fat, and facilitates laparoscopic gastric bypass in morbidly obese. Obes. Surg. 2011, 21, 345–350. [Google Scholar] [CrossRef] [PubMed]
- Pettinelli, P.; Videla, L.A. Up-regulation of PPAR-gamma mRNA expression in the liver of obese patients: An additional reinforcing lipogenic mechanism to SREBP-1c induction. J. Clin. Endocrinol. Metab. 2011, 96, 1424–1430. [Google Scholar] [CrossRef] [PubMed]
- Mulligan, J.D.; Stewart, A.M.; Saupe, K.W. Downregulation of plasma insulin levels and hepatic PPARgamma expression during the first week of caloric restriction in mice. Exp. Gerontol. 2008, 43, 146–153. [Google Scholar] [CrossRef] [PubMed]
- Bruss, M.D.; Khambatta, C.F.; Ruby, M.A.; Aggarwal, I.; Hellerstein, M.K. Calorie restriction increases fatty acid synthesis and whole body fat oxidation rates. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E108–E116. [Google Scholar] [CrossRef] [PubMed]
- Kleiner, D.E.; Brunt, E.M.; van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [PubMed]
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.; Shin, S.; Lim, Y.; Shin, J.H.; Seong, J.K.; Han, S.N. Korean Pine Nut Oil Attenuated Hepatic Triacylglycerol Accumulation in High-Fat Diet-Induced Obese Mice. Nutrients 2016, 8, 59. https://doi.org/10.3390/nu8010059
Park S, Shin S, Lim Y, Shin JH, Seong JK, Han SN. Korean Pine Nut Oil Attenuated Hepatic Triacylglycerol Accumulation in High-Fat Diet-Induced Obese Mice. Nutrients. 2016; 8(1):59. https://doi.org/10.3390/nu8010059
Chicago/Turabian StylePark, Soyoung, Sunhye Shin, Yeseo Lim, Jae Hoon Shin, Je Kyung Seong, and Sung Nim Han. 2016. "Korean Pine Nut Oil Attenuated Hepatic Triacylglycerol Accumulation in High-Fat Diet-Induced Obese Mice" Nutrients 8, no. 1: 59. https://doi.org/10.3390/nu8010059
APA StylePark, S., Shin, S., Lim, Y., Shin, J. H., Seong, J. K., & Han, S. N. (2016). Korean Pine Nut Oil Attenuated Hepatic Triacylglycerol Accumulation in High-Fat Diet-Induced Obese Mice. Nutrients, 8(1), 59. https://doi.org/10.3390/nu8010059