Correlations between Low Doses of Zearalenone, Its Carryover Factor and Estrogen Receptor Expression in Different Segments of the Intestines in Pre-Pubertal Gilts—A Study Protocol
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Procedures
2.2. Experimental Animals and Feeding
2.3. Toxicological Analyses
2.3.1. Determination of Mycotoxins in Feed
2.3.2. Biotransformation of ZEN
Tissue Samples
Extraction and Purification
Chromatographic Determination of the Concentrations of Zen and its Metabolites
Mass Spectrometric Conditions
Statistical Analysis
2.4. Expression of ERα, ERβ, CYP1A1, and GSTP1 Genes
2.4.1. Collection and storage of samples for RNA Extraction
2.4.2. Total RNA Extraction and CDNA Synthesis
2.4.3. qPCR
2.4.4. Statistical Analysis
3. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Thielecke, F.; Nugent, A.P. Contaminants in Grain—A Major Risk for Whole Grain Safety? Nutrients 2018, 10, 1213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fleetwood, J.; Rahman, S.; Holland, D.; Millson, D.; Thomson, L.; Poppy, G. As clean as they look? Food hygiene inspection scores, microbiological contamination, and foodborne illness. Food Control 2019, 96, 76–86. [Google Scholar] [CrossRef]
- Alassane-Kpembi, I.; Pinton, P.; Oswald, I.P. Effects of Mycotoxins on the Intestine. Toxins 2019, 11, 159. [Google Scholar] [CrossRef] [Green Version]
- Mahato, D.K.; Devi, S.; Pandhi, S.; Sharma, B.; Maurya, K.K.; Mishra, S.; Dhawan, K.; Selvakumar, R.; Kamle, M.; Mishra, A.K.; et al. Occurrence, Impact on Agriculture, Human Health, and Management Strategies of Zearalenone in Food and Feed: A Review. Toxins 2021, 13, 92. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska, M.; Sliżewska, K.; Nowak, A.; Zielonka, Ł.; Żakowska, Z.; Gajęcka, M.; Gajęcki, M. The effect of experimental fusarium mycotoxicosis on microbiota diversity in porcine ascending colon contents. Toxins 2014, 6, 2064–2081. [Google Scholar] [CrossRef] [Green Version]
- Zachariasova, M.; Dzumana, Z.; Veprikova, Z.; Hajkovaa, K.; Jiru, M.; Vaclavikova, M.; Zachariasova, A.; Pospichalova, M.; Florian, M.; Hajslova, J. Occurrence of multiple mycotoxins in European feeding stuffs, assessment of dietary intake by farm animals. Anim. Feed Sci. Technol. 2014, 193, 124–140. [Google Scholar] [CrossRef]
- Knutsen, H.-K.; Alexander, J.; Barregård, L.; Bignami, M.; Brüschweiler, B.; Ceccatelli, S.; Cottrill, B.; Dinovi, M.; Edler, L.; Grasl-Kraupp, B.; et al. Risks for animal health related to the presence of zearalenone and its modified forms in feed. EFSA J. 2017, 15, 4851. [Google Scholar] [CrossRef] [Green Version]
- Calabrese, E.J. Hormesis: Path and Progression to Significance. Int. J. Mol. Sci. 2018, 19, 2871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freir, L.; Sant’Ana, A.S. Modified mycotoxins: An updated review on their formation, detection, occurrence, and toxic effects. Food Chem. Toxicol. 2018, 111, 189–205. [Google Scholar] [CrossRef] [PubMed]
- Rykaczewska, A.; Gajęcka, M.; Dąbrowski, M.; Wiśniewska, A.; Szcześniewska, J.; Gajęcki, M.T.; Zielonka, Ł. Growth performance, selected blood biochemical parameters and body weight of pre-pubertal gilts fed diets supplemented with different doses of zearalenone (ZEN). Toxicon 2018, 152, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Cieplińska, K.; Gajęcka, M.; Dąbrowski, M.; Rykaczewska, A.; Zielonka, Ł.; Lisieska-Żołnierczyk, S.; Bulińska, M.; Gajęcki, M.T. Time-dependent changes in the intestinal microbiome of gilts exposed to low zearalenone doses. Toxins 2019, 11, 296. [Google Scholar] [CrossRef] [Green Version]
- Cieplińsk, K.; Gajęcka, M.; Nowak, A.; Dąbrowski, M.; Zielonka, Ł.; Gajęcki, M.T. The gentoxicity of caecal water in gilts exposed to low doses of zearalenone. Toxins 2018, 10, 350. [Google Scholar] [CrossRef] [Green Version]
- Gajęcka, M.; Waśkiewicz, A.; Zielonka, Ł.; Goliński, P.; Rykaczewska, A.; Lisieska-Żołnierczyk, S.; Gajęcki, M.T. Mycotoxin levels in the digestive tissues of immature gilts exposed to zearalenone and deoxynivalenol. Toxicon 2018, 153, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Tebani, A.; Afonso, C.; Marret, S.; Bekri, S. Omics-Based Strategies in Precision Medicine: Toward a Paradigm Shift in Inborn Errors of Metabolism Investigations. Int. J. Mol. Sci. 2016, 17, 1555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Celi, P.; Verlhac, V.; Pérez, C.E.; Schmeisser, J.; Kluenter, A.M. Biomarkers of gastrointestinal functionality in animal nutrition and health. Anim. Feed Sci. Technol. 2019, 250, 9–31. [Google Scholar] [CrossRef]
- Schaller, T.H.; Snyder, D.J.; Spasojevic, I.; Gedeon, P.C.; Sanchez-Perez, L.; Sampson, J.H. First in human dose calculation of a single-chain bispecific antibody targeting glioma using the MABEL approach. J. Immunother. Cancer 2020, 8, e000213. [Google Scholar] [CrossRef] [Green Version]
- Velmurugan, B.K.; Rathinasamy, B.; Lohanathan, B.P.; Thiyagarajan, V.; Weng, C.F. Neuroprotective Role of Phytochemicals. Molecules 2018, 23, 2485. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Caudle, W.M.; Pi, J.; Bhattacharya, S.; Andersen, M.E.; Kaminski, N.E.; Conolly, R.B. Embracing systems toxicology at single-cell resolution. Curr. Opin. Toxicol. 2019, 16, 49–57. [Google Scholar] [CrossRef]
- Gajęcka, M.; Otrocka-Domagała, I. Immunocytochemical expression of 3β- and 17β-hydroxysteroid dehydrogenase in bitch ovaries exposed to low doses of zearalenone. Pol. J. Vet. Sci. 2013, 16, 55–62. [Google Scholar]
- Gajęcka, M. The effect of low-dose experimental zearalenone intoxication on the immunoexpression of estrogen receptors in the ovaries of pre-pubertal bitches. Pol. J. Vet. Sci. 2012, 15, 685–691. [Google Scholar] [CrossRef]
- Gajęcka, M.; Zielonka, Ł.; Gajęcki, M. Activity of zearalenone in the porcine intestinal tract. Molecules 2017, 22, 18. [Google Scholar] [CrossRef] [Green Version]
- Dąbrowski, M.; Obremski, K.; Gajęcka, M.; Gajęcki, M.; Zielonka, Ł. Changes in the subpopulations of porcine peripheral blood lymphocytes induced by exposure to low doses of zearalenone (ZEN) and deoxynivalenol (DON). Molecules 2016, 21, 557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva-Campa, E.; Mata-Haro, V.; Mateu, E.; Hernández, J. Porcine reproductive and respiratory syndrome virus induces CD4+CD8+CD25+Foxp3+ regulatory T cells (Tregs). Virology 2012, 430, 73–80. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zielonka, Ł.; Jakimiuk, E.; Obremski, K.; Gajęcka, M.; Dąbrowski, M.; Gajęcki, M. An evaluation of the proliferative activity of immunocompetent cells in the jejunal and iliac lymph nodes of prepubertal female wild boars diagnosed with mixed mycotoxicosis. Bull. Vet. Inst. Pulawy 2015, 59, 197–203. [Google Scholar] [CrossRef] [Green Version]
- Bryden, W.L. Mycotoxin contamination of the feed supply chain: Implications for animal productivity and feed security. Anim. Feed Sci. Technol. 2012, 173, 134–158. [Google Scholar] [CrossRef]
- Grenier, B.; Applegate, T.J. Modulation of intestinal functions following mycotoxin ingestion: Meta-analysis of published experiments in animals. Toxins 2013, 5, 396–430. [Google Scholar] [CrossRef] [Green Version]
- Gajęcka, M.; Zielonka, Ł.; Gajęcki, M. The effect of low monotonic doses of zearalenone on selected reproductive tissues in pre-pubertal female dogs—A review. Molecules 2015, 20, 20669–20687. [Google Scholar] [CrossRef] [Green Version]
- Stopa, E.; Babińska, I.; Zielonka, Ł.; Gajęcki, M.; Gajęcka, M. Immunohistochemical evaluation of apoptosis and proliferation in the mucous membrane of selected uterine regions in pre-pubertal bitches exposed to low doses of zearalenone. Pol. J. Vet. Sci. 2016, 19, 175–186. [Google Scholar] [CrossRef] [Green Version]
- Kramer, H.J.; van den Ham, W.A.; Slob, W.; Pieters, M.N. Conversion Factors Estimating Indicative Chronic No-Observed-Adverse-Effect Levels from Short-Term Toxicity Data. Regul. Toxicol. Pharmacol. 1996, 23, 249–255. [Google Scholar] [CrossRef]
- Pastoor, T.P.; Bachman, A.N.; Bell, D.R.; Cohen, S.M.; Dellarco, M.; Dewhurst, I.C.; Doe, J.E.; Doerrer, N.G.; Embry, M.R.; Hines, R.N.; et al. A 21st century roadmap for human health risk assessment. Crit. Rev. Toxicol. 2014, 44, 1–5. [Google Scholar] [CrossRef] [Green Version]
- Suh, H.Y.; Peck, C.C.; Yu, K.S.; Lee, H. Determination of the starting dose in the first-in-human clinical trials with monoclonal antibodies: A systematic review of papers published between 1990 and 2013. Drug Des. Dev. Ther. 2016, 10, 4005–4016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandenberg, L.N.; Colborn, T.; Hayes, T.B.; Heindel, J.J.; Jacobs, D.R.; Lee, D.-H.; Shioda, T.; Soto, A.M.; vom Saal, F.S.; Welshons, W.V.; et al. Hormones and endocrine-disrupting chemicals: Low-dose effects and nonmonotonic dose responses. Endoc. Rev. 2012, 33, 378–455. [Google Scholar] [CrossRef] [PubMed]
- Dana, D.; Gadhiya, S.V.; Surin, L.G.S.; Li, D.; Naaz, F.; Ali, Q.; Paka, L.; Yamin, M.A.; Narayan, M.; Goldberg, I.D.; et al. Deep Learning in Drug Discovery and Medicine; Scratching the Surface. Molecules 2018, 23, 2384. [Google Scholar] [CrossRef] [Green Version]
- Gupta, R.C. Biomarkers in Toxicology; Academic Press: Hopkinsville, Kentucky USA, 2019. [Google Scholar] [CrossRef]
- Hickey, G.L.; Craig, P.S.; Luttik, R.; de Zwart, D. On the quantification of intertest variability in ecotoxicity data with application to species sensitivity distributions. Environ. Toxicol. Chem. 2012, 31, 1903–1910. [Google Scholar] [CrossRef] [Green Version]
- Pinton, P.; Suman, M.; Buck, N.; Dellafiora, L.; De Meester, J.; Stadler, D.; Rito, E. Practical guidance to mitigation of mycotoxins during food processing. In Report Commissioned by the Process-Related Compounds and Natural Toxins Task Force; Report Series; ILSI Europe: Brussels, Belgium, 2019; ISBN 9789078637455. Available online: https://www.researchgate.net/publication/336533566 (accessed on 25 May 2019).
- Zheng, W.; Feng, N.; Wang, Y.; Noll, L.; Xu, S.; Liu, X.; Lu, N.; Zou, H.; Gu, J.; Yuan, Y.; et al. Effects of zearalenone and its derivatives on the synthesis and secretion of mammalian sex steroid hormones: A review. Food Chem. Toxicol. 2019, 126, 262–276. [Google Scholar] [CrossRef] [PubMed]
- Rykaczewska, A.; Gajęcka, M.; Onyszek, E.; Cieplińska, K.; Dąbrowski, M.; Lisieska-Żołnierczyk, S.; Bulińska, M.; Babuchowski, A.; Gajęcki, M.T.; Zielonka, Ł. Imbalance in the Blood Concentrations of Selected Steroids in Prepubertal Gilts Depending on the Time of Exposure to Low Doses of Zearalenone. Toxins 2019, 11, 561. [Google Scholar] [CrossRef] [Green Version]
- Lawrenz, B.; Melado, L.; Fatemi, H. Premature progesterone rise in ART-cycles. Reprod. Biol. 2018, 18, 1–4. [Google Scholar] [CrossRef]
- Bryła, M.; Waśkiewicz, A.; Ksieniewicz-Woźniak, E.; Szymczyk, K.; Jędrzejczak, R. Modified Fusarium Mycotoxins in Cereals and Their Products—Metabolism, Occurrence, and Toxicity: An Updated Review. Molecules 2018, 23, 963. [Google Scholar] [CrossRef] [Green Version]
- Kowalska, K.; Habrowska-Górczyńska, D.E.; Piastowska-Ciesielska, A. Zearalenone as an endocrine disruptor in humans. Environ. Toxicol. Pharmacol. 2016, 48, 141–149. [Google Scholar] [CrossRef]
- Yang, D.; Jiang, T.; Lin, P.; Chen, H.; Wang, L.; Wang, N.; Zhao, F.; Tang, K.; Zhou, D.; Wang, A.; et al. Apoptosis inducing factor gene depletion inhibits zearalenone-induced cell death in a goat Leydig cell line. Reprod. Toxicol. 2017, 67, 129–139. [Google Scholar] [CrossRef]
- Benagiano, M.; Bianchi, P.; D’Elios, M.M.; Brosens, I.; Benagiano, G. Autoimmune diseases: Role of steroid hormones. Best Pract. Res. Clin. Obstet. Gynaecol. 2019, 60, 24–34. [Google Scholar] [CrossRef] [PubMed]
- Gajęcka, M.; Rybarczyk, L.; Zwierzchowski, W.; Jakimiuk, E.; Zielonka, Ł.; Obremski, K.; Gajęcki, M. The effect of experimental, long-term exposure to low-dose zearalenone mycotoxicosis on the histological condition of ovaries in sexually immature gilts. Theriogenology 2011, 75, 1085–1094. [Google Scholar] [CrossRef] [PubMed]
- Schoevers, E.J.; Santos, R.R.; Colenbrander, B.; Fink-Gremmels, J.; Roelen, B.A.J. Transgenerational toxicity of Zearalenone in pigs. Reprod. Toxicol. 2012, 34, 110–119. [Google Scholar] [CrossRef] [PubMed]
- Hennig-Pauka, I.; Koch, F.J.; Schaumberger, S.; Woechtl, B.; Novak, J.; Sulyok, M.; Nagl, V. Current challenges in the diagnosis of zearalenone toxicosis as illustrated by a field case of hyperestrogenism in suckling piglets. Porc. Health Manag. 2018, 4, 1–9. [Google Scholar] [CrossRef]
- He, J.; Wei, C.; Li, Y.; Liu, Y.; Wang, Y.; Pan, J.; Liu, J.; Wu, Y.; Cui, S. Zearalenone and alpha-zearalenol inhibit the synthesis and secretion of pig follicle stimulating hormone via the non-classical estrogen membrane receptor GPR30. Mol. Cell. Endocrinol. 2018, 461, 43–54. [Google Scholar] [CrossRef]
- Zielonka, Ł.; Waśkiewicz, A.; Beszterda, M.; Kostecki, M.; Dąbrowski, M.; Obremski, K.; Goliński, P.; Gajęcki, M. Zearalenone in the Intestinal Tissues of Immature Gilts Exposed per os to Mycotoxins. Toxins 2015, 7, 3210–3223. [Google Scholar] [CrossRef] [Green Version]
- Gajęcka, M.; Dabrowski, M.; Otrocka-Domagała, I.; Brzuzan, P.; Rykaczewska, A.; Cieplińska, K.; Barasińska, M.; Gajęcki, M.T.; Zielonka, Ł. Correlations between exposure to deoxynivalenol and zearalenone and the immunohistochemical expression of estrogen receptors in the intestinal epithelium and the mRNA expression of selected colonic enzymes in pre-pubertal gilts. Toxicon 2020, 173, 75–93. [Google Scholar] [CrossRef]
- Demaegdt, H.; Daminet, B.; Evrard, A.; Scippo, M.L.; Muller, M.; Pussemier, L.; Callebaut, A.; Vandermeiren, K. Endocrine activity of mycotoxins and mycotoxin mixtures. Food Chem. Toxicol. 2016, 96, 107–116. [Google Scholar] [CrossRef]
- Gajęcka, M.; Sławuta, P.; Nicpoń, J.; Kołacz, R.; Kiełbowicz, Z.; Zielonka, Ł.; Dąbrowski, M.; Szweda, W.; Gajęcki, M.; Nicpoń, J. Zearalenone and its metabolites in the tissues of female wild boars exposed per os to mycotoxins. Toxicon 2016, 114, 1–12. [Google Scholar] [CrossRef]
- Sevior, D.K.; Pelkonen, O.; Ahokas, J.T. Hepatocytes: The powerhouse of biotransformation. Int. J. Biochem. Cell Biol. 2012, 44, 257–261. [Google Scholar] [CrossRef]
- Agahi, F.; Juan, C.; Font, G.; Juan-García, A. In silico methods for metabolomic and toxicity prediction of zearalenone, α-zearalenone and β-zearalenone. Food Chem. Toxicol. 2020, 146, 111818. [Google Scholar] [CrossRef]
- Piotrowska-Kempisty, H.; Klupczyńska, A.; Trzybulska, D.; Kulcenty, K.; Sulej-Suchomska, A.M.; Kucińska, M.; Mikstacka, R.; Wierzchowski, M.; Murias, M.; Baer-Dubowska, W.; et al. Role of CYP1A1 in the biological activity of methylated resveratrol analogue, 3,4,5,40-tetramethoxystilbene (DMU-212) in ovarian cancer A-2780 and non-cancerous HOSE cells. Toxicol. Lett. 2017, 267, 59–66. [Google Scholar] [CrossRef] [PubMed]
- Freedland, J.; Cera, C.; Fasullo, M. CYP1A1 I462V polymorphism is associated with reduced genotoxicityin yeast despite positive association with increased cancer risk. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2017, 815, 35–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Billat, P.A.; Roger, E.; Faure, S.; Lagarce, F. Models for drug absorption from the small intestine: Where are we and where are we going? Drug Discov. Today 2017, 22, 761–775. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Basharat, Z.; Yasmin, A. Energy landscape of a GSTP1 polymorph linked with cytological function decay in response to chemical stressors. Gene 2017, 609, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Singh, H.O.; Lata, S.; Angadi, M.; Bapat, S.; Pawar, J.; Nema, V.; Ghate, M.V.; Sahay, S.; Gangakhedkar, R.R. Impact of GSTM1, GSTT1 and GSTP1 gene polymorphism and risk of ARV-associated hepatotoxicity in HIV-infected individuals and its modulation. Pharm. J. 2017, 17, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Lei, K.; Xia, Y.; Wang, X.C.; Ahn, E.H.; Jin, L.; Ye, K. C/EBPβ mediates NQO1 and GSTP1 antioxidative reductases expression in glioblastoma, promoting brain tumor proliferation. Redox Biol. 2020, 34, 101578. [Google Scholar] [CrossRef]
- Kovacevic, Z.; Sahni, S.; Lok, H.; Davies, M.J.; Wink, D.A.; Richardson, D.R. Regulation and control of nitric oxide (NO) in macrophages: Protecting the “professional killer cell” from its own cytotoxic arsenal via MRP1and GSTP1. Biochim. Biophys. Acta 2017, 1861, 995–999. [Google Scholar] [CrossRef]
- Heberer, T.; Lahrssen-Wiederholt, M.; Schat, H.; Abraham, K.; Pzyrembel, H.; Henning, K.J.; Schauzu, M.; Braeunig, J.; Goetz, M.; Niemann, L.; et al. Zero tolerances in food and animal feed—Are there any scientificalternatives? A European point of view on aninternational controversy. Toxicol. Lett. 2007, 175, 118–135. [Google Scholar] [CrossRef]
- Smith, D.; Combes, R.; Depelchin, O.; Jacobsen, S.D.; Hack, R.; Luft, J.; Lammens, L.; von Landenberg, F.; Phillips, B.; Pfister, R.; et al. Optimising the design of preliminarytoxicity studies for pharmaceutical safetytesting in the dog. Regul. Toxicol. Pharmacol. 2005, 41, 95–101. [Google Scholar] [CrossRef]
- Gajęcka, M.; Stopa, E.; Tarasiuk, M.; Zielonka, Ł.; Gajęcki, M. The expression of type-1 and type-2 nitric oxide synthase in selected tissues of the gastrointestinal tract during mixed mycotoxicosis. Toxins 2013, 5, 2281–2292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfaffl, M.W.; Lange, I.G.; Daxenberger, A.; Meyer, H.H.D. Tissue-specific expression pattern of estrogen receptors (ER): Quantification of ERa and ERb mRNA with real-time RT-PCR. APMIS 2001, 109, 345–355. [Google Scholar] [CrossRef] [PubMed]
- Tohno, M.; Shimasato, T.; Moue, M.; Aso, H.; Watanabe, K.; Kawai, Y.; Yamaguchi, T.; Saito, T.; Kitazawa, H. Toll-like receptor 2 and 9 are expressed and functional in gut associated lymphoid tissues of presuckling newborn swine. Vet. Res. 2006, 37, 791–812. [Google Scholar] [CrossRef] [Green Version]
- Śliżewska, K.; Nowak, A.; Gajęcka, M.; Piotrowska, M.; Żakowska, Z.; Zielonka, Ł.; Gajęcki, M. Cecal enzyme activity in gilts following experimentally induced Fusarium mycotoxicosis. Pol. J. Vet. Sci. 2015, 18, 191–197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Waśkiewicz, A.; Beszterda, M.; Kostecki, M.; Zielonka, Ł.; Goliński, P.; Gajęcki, M. Deoxynivalenol in the gastrointestinal tract of immature gilts under per os toxin application. Toxins 2014, 6, 973–987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liew, W.P.P.; Mohd-Redzwan, S. Mycotoxin: Its impact on Gut health and microbiota. Front. Cell. Infect. Microbiol. 2018, 8, 60. [Google Scholar] [CrossRef] [Green Version]
- Embry, M.R.; Bachman, A.N.; Bell, D.R.; Boobis, A.R.; Cohen, S.M.; Dellarco, M.; Dewhurst, I.C.; Doerrer, N.G.; Hines, R.N.; Moretto, A.; et al. Risk assessment in the 21st century: Roadmap and matrix. Crit. Rev. Toxicol. 2014, 44, 6–16. [Google Scholar] [CrossRef]
Parameters | Composition Declared by the Manufacturer (%) |
---|---|
Soybean meal | 16 |
Wheat | 55 |
Barley | 22 |
Wheat bran | 4.0 |
Chalk | 0.3 |
Zitrosan | 0.2 |
Vitamin–mineral premix 1 | 2.5 |
Analyte | Precursor (m/z) | Production (m/z) | FragmentorVoltage (V) | Collision Energy (eV) | LOD (ng mL−1) | LOQ (ng mL−1) | Linearity (%R2) |
---|---|---|---|---|---|---|---|
ZEN | 317.1 | 273.3 187.1 | 160 | 25 33 | 0.03 | 0.1 | 0.999 |
α-ZEL | 319.2 | 275.2 160.1 | 144 | 21 33 | 0.3 | 0.9 | 0.997 |
β-ZEL | 319.2 | 275.2 160.1 | 144 | 21 33 | 0.3 | 1 | 0.993 |
Primer | Sequence (5′→3′) | Amplicon Length (bp) | References | |
---|---|---|---|---|
ERALFA | Forward | Agggaagctcctattgctcc | 234 | [64] |
Reverse | cggtggatgtggtccttctct | |||
ERBETA | Forward | Gcttcgtggagctcagcctg | 262 | [64] |
Reverse | aggatcatggccttgacacaga | |||
CYP1A1 | Forward | cagagccgcagcagccaccttg | 226 | [48] |
Reverse | ggctcttgcccaaggtcagcac | |||
GSTP1 | Forward | acctgcttcggattcaccag | 178 | [48] |
Reverse | ctccagccacaaagccctta | |||
β-Actin | Forward | catcaccatcggcaaaga | 237 | [65] |
Reverse | gcgtagaggtccttcctgatgt |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gajęcka, M.; Mróz, M.; Brzuzan, P.; Onyszek, E.; Zielonka, Ł.; Lipczyńska-Ilczuk, K.; Przybyłowicz, K.E.; Babuchowski, A.; Gajęcki, M.T. Correlations between Low Doses of Zearalenone, Its Carryover Factor and Estrogen Receptor Expression in Different Segments of the Intestines in Pre-Pubertal Gilts—A Study Protocol. Toxins 2021, 13, 379. https://doi.org/10.3390/toxins13060379
Gajęcka M, Mróz M, Brzuzan P, Onyszek E, Zielonka Ł, Lipczyńska-Ilczuk K, Przybyłowicz KE, Babuchowski A, Gajęcki MT. Correlations between Low Doses of Zearalenone, Its Carryover Factor and Estrogen Receptor Expression in Different Segments of the Intestines in Pre-Pubertal Gilts—A Study Protocol. Toxins. 2021; 13(6):379. https://doi.org/10.3390/toxins13060379
Chicago/Turabian StyleGajęcka, Magdalena, Magdalena Mróz, Paweł Brzuzan, Ewa Onyszek, Łukasz Zielonka, Karolina Lipczyńska-Ilczuk, Katarzyna E. Przybyłowicz, Andrzej Babuchowski, and Maciej T. Gajęcki. 2021. "Correlations between Low Doses of Zearalenone, Its Carryover Factor and Estrogen Receptor Expression in Different Segments of the Intestines in Pre-Pubertal Gilts—A Study Protocol" Toxins 13, no. 6: 379. https://doi.org/10.3390/toxins13060379