Cloning of Three Aflatoxin B1 Oxidases of the Dipeptidyl Peptidase III Family and Evaluation of Their Potential for Practical Applications as Decontamination Enzymes
Abstract
:1. Introduction
2. Results
2.1. Cloning and Isolation of AFO-Encoding Genes
2.2. In Silico Analysis of rAFO
2.3. rAFO Expression
2.4. Determination of Biochemical Parameters and Stability of Recombinant AFOs
3. Discussion
4. Materials and Methods
4.1. Cloning AFOs and Building of Expression Plasmids
4.2. Enzyme Expression and Purification
4.3. rAFO Activity Assay
4.4. Residual AFB1 Analysis by HPLC
4.5. rAFO pH Stability and Thermostability
4.6. Metal Ion, Chelator and Storage Effect Testing
4.7. Statistics
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Janik, E.; Niemcewicz, M.; Ceremuga, M.; Stela, M.; Saluk-Bijak, J.; Siadkowski, A.; Bijak, M. Molecular aspects of mycotoxins—A serious problem for human health. Int. J. Mol. Sci. 2020, 21, 8187. [Google Scholar] [CrossRef] [PubMed]
- Benkerroum, N. Aflatoxins: Producing-molds, structure, health issues and incidence in Southeast Asian and Sub-Saharan African countries. Int. J. Environ. Res. Public Health 2020, 17, 1215. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Mahato, D.K.; Kamle, M.; Mohanta, T.K.; Kang, S.G. Aflatoxins: A global concern for food safety, human health and their management. Front. Microbiol. 2017, 7, 2170. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Gupta, A.; Mahato, D.K.; Pandhi, S.; Pandey, A.K.; Kargwal, R.; Mishra, S.; Suhag, R.; Sharma, N.; Saurabh, V.; et al. Aflatoxins in cereals and cereal-based products: Occurrence, toxicity, impact on human health, and their detoxification and management strategies. Toxins 2022, 14, 687. [Google Scholar] [CrossRef]
- Guo, Y.; Zhao, L.; Ma, Q.; Ji, C. Novel strategies for degradation of aflatoxins in food and feed: A Review. Int. Food Res. 2021, 140, 109878. [Google Scholar] [CrossRef]
- Park, J.W.; Kim, Y.-B. Effect of pressure cooking on aflatoxin B1 in rice. J. Agric. Food Chem. 2006, 54, 2431–2435. [Google Scholar] [CrossRef]
- Wu, Y.; Cheng, J.-H.; Sun, D.-W. Blocking and degradation of aflatoxins by cold plasma treatments: Applications and mechanisms. Trends Food Sci. 2021, 109, 647–661. [Google Scholar] [CrossRef]
- Kumar, V.; Goel, R.; Chawla, R.; Silambarasan, M.; Sharma, R.K. Chemical, biological, radiological, and nuclear decontamination: Recent trends and future perspective. J. Pharm. Bioallied Sci. 2010, 2, 220–238. [Google Scholar] [CrossRef]
- Branà, M.T.; Sergio, L.; Haidukowski, M.; Logrieco, A.F.; Altomare, C. Degradation of aflatoxin B1 by a sustainable enzymatic extract from spent mushroom substrate of Pleurotus eryngii. Toxins 2020, 12, 49. [Google Scholar] [CrossRef]
- Al-Owaisi, A.; Al-Sadi, A.M.; Al-Sabahi, J.N.; Sathish Babu, S.P.; Al-Harrasi, M.M.A.; Hashil Al-Mahmooli, I.; Abdel-Jalil, R.; Velazhahan, R. In vitro detoxification of aflatoxin B1 by aqueous extracts of medicinal herbs. All Life 2022, 15, 314–324. [Google Scholar] [CrossRef]
- Jackson, L.W.; Pryor, B.M. Degradation of aflatoxin B1 from naturally contaminated maize using the edible fungus Pleurotus ostreatus. AMB Express 2017, 7, 110. [Google Scholar] [CrossRef] [PubMed]
- Shcherbakova, L.; Statsyuk, N.; Mikityuk, O.; Nazarova, T.; Dzhavakhiya, V. Aflatoxin B1 degradation by metabolites of Phoma glomerata PG41 isolated from natural substrate colonized by aflatoxigenic Aspergillus flavus. Jundishapur J. Microbiol. 2015, 8, e24324. [Google Scholar] [CrossRef] [PubMed]
- Loi, M.; Logrieco, A.F.; Pusztahelyi, T.; Leiter, É.; Hornok, L.; Pócsi, I. Advanced mycotoxin control and decontamination techniques in view of an increased aflatoxin risk in Europe due to climate change. Front. Microbiol. 2023, 13, 1085891. [Google Scholar] [CrossRef] [PubMed]
- Loi, M.; Fanelli, F.; Cimmarusti, M.T.; Mirabelli, V.; Haidukowski, M.; Logrieco, A.F.; Caliandro, R.; Mule, G. In vitro single and combined mycotoxins degradation by ETY4 laccase from Pleurotus eryngii and redox mediators. Food Control 2018, 90, 401–406. [Google Scholar] [CrossRef]
- Sun, H.; He, Z.; Xiong, D.; Long, M. Mechanisms by which microbial enzymes degrade four mycotoxins and application in animal production: A review. Anim. Nutr. 2023, 15, 256–274. [Google Scholar] [CrossRef]
- Liu, D.-L.; Yao, D.-S.; Liang, R.; Ma, L.; Cheng, W.-Q.; Gu, L.-Q. Detoxification of aflatoxin B1 by enzymes isolated from Armillariella tabescens. FCT 1998, 36, 563–574. [Google Scholar] [CrossRef]
- Wen, S.; Guan, M.; Zhou, T.; Cao, H.; Xie, C.; Liu, D.; Yao, D. Cloning, expression, purification and characterization of an aflatoxin-converting enzyme from Armillaria tabescens. Acta Microbiol. Sin. 2011, 51, 1212–1221. [Google Scholar]
- Liu, D.L.; Yao, D.S.; Liang, Y.Q.; Zhou, T.H.; Song, Y.P.; Zhao, L.; Ma, L. Production, purification, and characterization of an intracellular aflatoxin-detoxifizyme from Armillariella tabescens (E-20). Food Chem. Toxicol. 2001, 39, 461–466. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.; Liu, D.; Mo, X.; Xie, C.; Yao, D. A fungal enzyme with the ability of aflatoxin B1 conversion: Purification and ESI-MS/MS identification. Microbiol. Res. 2011, 166, 475–483. [Google Scholar] [CrossRef]
- Tomin, M.; Tomić, S. Oxidase or peptidase? A computational insight into a putative aflatoxin oxidase from Armillariella tabescens. Proteins 2019, 87, 390–400. [Google Scholar] [CrossRef]
- Xu, T.; Xie, C.; Yao, D.; Zhou, C.-Z.; Liu, J. Crystal structures of aflatoxin-oxidase from Armillariella tabescens reveal a dual activity enzyme. Biochem. Biophys. Res. Commun. 2017, 494, 621–625. [Google Scholar] [CrossRef] [PubMed]
- Karačić, Z.; Ban, Ž.; Macheroux, P. A novel member of the dipeptidyl peptidase III family from Armillariella tabescens. Curr. Top. Pept. Protein Res. 2017, 17, 41–48. [Google Scholar]
- Sinelnikov, I.; Mikityuk, O.; Shcherbakova, L.; Nazarova, T.; Denisenko, Y.; Rozhkova, A.; Statsyuk, N.; Zorov, I. Recombinant oxidase from Armillaria tabescens as a potential tool for aflatoxin B1 degradation in contaminated cereal grain. Toxins 2023, 15, 678. [Google Scholar] [CrossRef] [PubMed]
- Verheecke, C.; Liboz, T.; Mathieu, F. Microbial degradation of aflatoxin B1: Current status and future advances. Int. J. Food Microbiol. 2016, 237, 1–9. [Google Scholar] [CrossRef]
- Prajapati, S.C.; Chauhan, S.S. Dipeptidyl Peptidase III: A multifaceted oligopeptide N-end cutter. FEBS J. 2011, 278, 3256–3276. [Google Scholar] [CrossRef]
- Vanha-Perttula, T. Dipeptidyl peptidase III and alanyl aminopeptidase in the human seminal plasma: Origin and biochemical properties. Clin. Chim. Acta. 1988, 177, 179–195. [Google Scholar] [CrossRef]
- Ellis, S.; Nuenke, J.M. Dipeptidyl arylamidase III of the pituitary. Purification and characterization. J. Biol. Chem. 1967, 242, 4623–4629. [Google Scholar] [CrossRef]
- Yang, P.; Xiao, W.; Lu, S.; Jiang, S.; Jiang, S.; Chen, J.; Wu, W.; Zheng, Z.; Jiang, S. Characterization of a Trametes versicolor aflatoxin B1-degrading enzyme (TV-AFB1D) and its application in the AFB1 degradation of contaminated rice in situ. Front. Microbiol. 2022, 13, 960882. [Google Scholar] [CrossRef]
- Li, L.; Mei, M.; Wang, J.; Huang, J.; Zong, X.; Wang, X. Expression and application of aflatoxin degrading enzyme gene in Pichia pastoris. Biotechnol. J. 2023, 19, 2300167. [Google Scholar] [CrossRef]
- Yang, P.; Xiao, W.; Lu, S.; Jiang, S.; Zheng, Z.; Zhang, D.; Zhang, M.; Jiang, S.; Jiang, S. Recombinant expression of Trametes versicolor Aflatoxin B1-degrading enzyme (TV-AFB1D) in engineering Pichia pastoris GS115 and application in AFB1 degradation in AFB1-contaminated peanuts. Toxins 2021, 13, 349. [Google Scholar] [CrossRef]
- Abramić, M.; Špoljarić, J.; Šimaga, Š. Prokaryotic homologs help to define consensus sequences in peptidase family M49. Period. Biol. 2004, 106, 161. [Google Scholar]
- Abramic, M.; Schleuder, D.; Dolovcak, L.; Schröder, W.; Strupat, K.; Agi, D.; Peter-Katalinic, J.; Vitale, L. Human and rat dipeptidyl peptidase III: Biochemical and mass spectrometric arguments for similarities and differences. J. Biol. Chem. 2000, 381, 1233–1243. [Google Scholar] [CrossRef] [PubMed]
- Jajčanin-Jozić, N.; Deller, S.; Pavkov, T.; Macheroux, P.; Abramić, M. Identification of the reactive cysteine residues in yeast dipeptidyl peptidase III. Biochimie 2010, 92, 89–96. [Google Scholar] [CrossRef]
- Wu, Y.-Z.; Lu, F.-P.; Jiang, H.-L.; Tan, C.-P.; Yao, D.-S.; Xie, C.-F.; Liu, D.-L. The furofuran-ring selectivity, hydrogen peroxide-production and low Km value are the three elements for highly effective detoxification of aflatoxin oxidase. Food Chem. Toxicol. 2015, 76, 125–131. [Google Scholar] [CrossRef]
- Sentandreu, M.A.; Toldrá, F. Biochemical properties of dipeptidyl peptidase III purified from porcine skeletal muscle. J. Agric. Food Chem. 1998, 46, 3977–3984. [Google Scholar] [CrossRef]
- Lee, C.M.; Snyder, S.H. Dipeptidyl-aminopeptidase III of rat brain. Selective affinity for enkephalin and angiotensin. J. Biol. Chem. 1982, 257, 12043–12050. [Google Scholar] [CrossRef]
- Fukasawa, K.; Fukasawa, K.M.; Kanai, M.; Fujii, S.; Hirose, J.; Harada, M. Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression. Biochem. J. 1998, 329 Pt 2, 275–282. [Google Scholar] [CrossRef]
- Abramić, M.; Agić, D. Survey of dipeptidyl peptidase III inhibitors: From small molecules of microbial or synthetic origin to aprotinin. Molecules 2022, 27, 3006. [Google Scholar] [CrossRef]
- Chen, S.-B.; Zhang, H.; Chen, S.; Ye, X.-F.; Li, Z.-K.; Liu, W.-D.; Cui, Z.-L.; Huang, Y. Structural and functional characterization of a new bacterial dipeptidyl peptidase III involved in fruiting body formation in myxobacteria. Int. J. Mol. Sci. 2022, 24, 631. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Stanke, M.; Morgenstern, B. AUGUSTUS: A web server for gene prediction in eukaryotes that allows user-defined constraints. Nucleic Acids Res. 2005, 33, W465–W467. [Google Scholar] [CrossRef] [PubMed]
- Sinelnikov, I.G.; Zorov, I.N.; Denisenko, Y.A.; Mikityuk, O.O.; Sinitsyn, A.P.; Shcherbakova, L.A. A new producer of a recombinant aflatoxin-degrading enzyme obtained via heterologous expression in Pichia pastoris. Agric. Biol. 2023, 57, 1166–1177. [Google Scholar] [CrossRef]
- Aslanidis, C.; de Jong, P.J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Res. 1990, 18, 6069–6074. [Google Scholar] [CrossRef] [PubMed]
Enzyme Sources | Recombinant Enzymes (Mean ± SD) | |
---|---|---|
Activity, U/mg | Km, mM | |
A. tabescens | 185 ± 8 | 3.36 ± 0.21 |
P. eryngii | 298 ± 11 | 2.32 ± 0.15 |
L. edodes | 110 ± 16 | 6.32 ± 0.26 |
C. cibarius | 54 ± 6 | 10.5 ± 0.31 |
Name | 5′ Sequence |
---|---|
Plre_F | TACTTCCAATCCATGACTTTCTCCACTTCCATTC |
Plre _R, | TATCCACCTTTACTTCAAAGAGAACGTTCAATGAAAC |
Lede_R | TATCCACCTTTACTTCACAGTCTCCGGTCGATGAAGCTC |
Lede _F | TACTTCCAATCCATGTGGAGCCTAAGGGGCCTCAGAC |
Caci_R, | TATCCACCTTTACTTTAAATATCTCGCTCCACAAATG |
Caci _F | TACTTCCAATCCATGCGCAGCCGGTTTCCCTT |
Arta_F | TACTTCCAATCCATGGCTACTACTACAACTGTT |
Arta_R | TATCCACCTTTTTACTGCAATCTTCTCTCTCAATGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sinelnikov, I.; Zorov, I.; Denisenko, Y.; Demidova, K.; Rozhkova, A.; Shcherbakova, L. Cloning of Three Aflatoxin B1 Oxidases of the Dipeptidyl Peptidase III Family and Evaluation of Their Potential for Practical Applications as Decontamination Enzymes. Toxins 2024, 16, 419. https://doi.org/10.3390/toxins16100419
Sinelnikov I, Zorov I, Denisenko Y, Demidova K, Rozhkova A, Shcherbakova L. Cloning of Three Aflatoxin B1 Oxidases of the Dipeptidyl Peptidase III Family and Evaluation of Their Potential for Practical Applications as Decontamination Enzymes. Toxins. 2024; 16(10):419. https://doi.org/10.3390/toxins16100419
Chicago/Turabian StyleSinelnikov, Igor, Ivan Zorov, Yury Denisenko, Kristina Demidova, Alexandra Rozhkova, and Larisa Shcherbakova. 2024. "Cloning of Three Aflatoxin B1 Oxidases of the Dipeptidyl Peptidase III Family and Evaluation of Their Potential for Practical Applications as Decontamination Enzymes" Toxins 16, no. 10: 419. https://doi.org/10.3390/toxins16100419