Hot Spots of Phytoene Desaturase from Rhodobacter sphaeroides Influencing the Desaturation of Phytoene
Abstract
:1. Introduction
2. Results
2.1. Reconstruction of Lycopene Biosynthesis Pathways and Directed Evolution of the R. sphaeroides Phytoene Desaturase (CrtI)
2.2. Identification of Mutation in Mutant Crtirs by Sequencing Analysis
2.3. Verification of the Effect of E186g and W142r Mutations on Activity of Phytoene Desaturase by Site-Directed Mutagenesis
2.4. Complementation of Mutant Crtirs with the P. agglomerans Crtepa and Crtbpa
2.5. Structural Evaluation of Mutant Crtirs Using Computational Model Analysis
3. Materials and Methods
3.1. Strains, Plasmids, and Culture Conditions
3.2. Error-Prone PCR Mutagenesis
3.3. Site-Directed Mutagenesis
3.4. Analysis of Carotenoid Production
3.5. Computational Modeling of Phytoene Desaturase
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Rodriguez-Concepcion, M.; Avalos, J.; Bonet, M.L.; Boronat, A.; Gomez-Gomez, L.; Hornero-Mendez, D.; Limon, M.C.; Meléndez-Martínez, A.J.; Olmedilla-Alonso, B.; Palou, A.; et al. A global perspective on ca-rotenoids: Metabolism, biotechnology, and benefits for nutrition and health. Prog. Lipid Res. 2018, 70, 62–93. [Google Scholar] [CrossRef] [Green Version]
- Maoka, T. Carotenoids as natural functional pigments. J. Nat. Med. 2020, 74, 1–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maoka, T. Recent progress in structural studies of carotenoids in animals and plants. Arch. Biochem. Biophys. 2009, 483, 191–195. [Google Scholar] [CrossRef] [PubMed]
- Carotenoids Volume 4: Natural Functions; Britton, G.; Liaaen-Jensen, S.; Pfander, H. (Eds.) Birkhäuser: Basel, Switzerland, 2008. [Google Scholar]
- Maoka, T.; Kuwahara, T.; Narita, M. Carotenoids of sea angels Clione limacina and Paedoclione doliiformis from the per-spective of the food chain. Mar. Drugs 2014, 12, 1460–1470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maoka, T.; Nishino, A.; Yasui, H.; Yamano, Y.; Wada, A. Anti-Oxidative Activity of Mytiloxanthin, a Metabolite of Fucoxan-thin in Shellfish and Tunicates. Mar. Drugs 2016, 14, 93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartley, G.; Schmidhauser, T.; Yanofsky, C.; Scolnik, P. Carotenoid desaturases from Rhodobacter capsulatus and Neurospora crassa are structurally and functionally conserved and contain domains homologous to flavoprotein disulfide oxidoreductases. J. Biol. Chem. 1990, 265, 16020–16024. [Google Scholar] [CrossRef]
- Kim, S.H.; Park, Y.H.; Schmidt-Dannert, C.; Lee, P.C. Redesign, Reconstruction, and Directed Extension of the Brevibacterium linens C 40 Carotenoid Pathway in Escherichia coli. Appl. Environ. Microbiol. 2010, 76, 5199–5206. [Google Scholar] [CrossRef] [Green Version]
- Lee, P.C.; Momen, A.Z.R.; Mijts, B.N.; Schmidt-Dannert, C. Biosynthesis of Structurally Novel Carotenoids in Escherichia coli. Chem. Biol. 2003, 10, 453–462. [Google Scholar] [CrossRef] [Green Version]
- Umeno, D.; Tobias, A.V.; Arnold, F.H. Diversifying Carotenoid Biosynthetic Pathways by Directed Evolution. Microbiol. Mol. Biol. Rev. 2005, 69, 51–78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, Z.; Deming, C.; Yongbin, H.; Zhigang, C.; Feirong, G. Optimization of carotenoids extraction from Rhodobacter sphaeroides. LWT Food Sci. Technol. 2008, 41, 1082–1088. [Google Scholar] [CrossRef]
- Schnurr, G.; Schmidt, A.; Sandmann, G. Mapping of a carotenogenic gene cluster from Erwinia herbicola and functional identification of six genes. FEMS Microbiol. Lett. 1991, 78, 157–161. [Google Scholar] [CrossRef]
- Yeliseev, A.A.; Kaplan, S. Anaerobic Carotenoid Biosynthesis in Rhodobacter Sphaeroides 2.4.1: H2O Is a Source of Oxygen for the 1-methoxy Group of Spheroidene but not for the 2-oxo Group of Spheroidenone. FEBS Lett. 1997, 403, 10–14. [Google Scholar] [CrossRef] [Green Version]
- Bartley, G.E.; Scolnik, P.A.; Beyer, P. Two Arabidopsis thaliana carotene desaturases, phytoene desaturase and zeta-carotene desaturase, expressed in Escherichia coli, catalyze a poly-cis pathway to yield pro-lycopene. Eur. J. Biochem. 1999, 259, 396–403. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, F.; Wurtzel, E.T. Isolation and Characterization of the Z-ISO Gene Encoding a Missing Component of Carotenoid Biosynthesis in Plants. Plant Physiol. 2010, 153, 66–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, H.; Kreunen, S.S.; Cuttriss, A.J.; DellaPenna, D.; Pogson, B.J. Identification of the Carotenoid Isomerase Provides Insight into Carotenoid Biosynthesis, Prolamellar Body Formation, and Photomorphogenesis. Plant Cell 2002, 14, 321–332. [Google Scholar] [CrossRef] [Green Version]
- Sandmann, G. Evolution of carotene desaturation: The complication of a simple pathway. Arch. Biochem. Biophys. 2009, 483, 169–174. [Google Scholar] [CrossRef]
- Schaub, P.; Yu, Q.; Gemmecker, S.; Poussin-Courmontagne, P.; Mailliot, J.; McEwen, A.G.; Ghisla, S.; Al-Babili, S.; Cavarelli, J.; Beyer, P. On the Structure and Function of the Phytoene Desaturase CRTI from Pantoea ananatis, a Membrane-Peripheral and FAD-Dependent Oxidase/Isomerase. PLoS ONE 2012, 7, e39550. [Google Scholar] [CrossRef] [Green Version]
- Misawa, N.; Nakagawa, M.; Kobayashi, K.; Yamano, S.; Izawa, Y.; Nakamura, K.; Harashima, K. Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli. J. Bacteriol. 1990, 172, 6704–6712. [Google Scholar] [CrossRef] [Green Version]
- Hausmann, A.; Sandmann, G. A single five-step desaturase is involved in the carotenoid biosynthesis pathway to be-ta-carotene and torulene in Neurospora crassa. Fungal Genet. Biol. 2000, 30, 147–153. [Google Scholar] [CrossRef]
- Sandmann, G. Combinatorial Biosynthesis of Carotenoids in a Heterologous Host: A Powerful Approach for the Biosynthesis of Novel Structures. ChemBioChem 2002, 3, 629–635. [Google Scholar] [CrossRef]
- Song, G.H.; Kim, S.H.; Choi, B.H.; Han, S.J.; Lee, P.C. Functional complementation of heterologous carotenoid biosynthetic enzymes and their effect on carotenoid profiles in Escherichia coli. Appl. Environ. Microbiol. 2013, 79, 610–618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, B.H.; Hwang, H.J.; Lee, J.E.; Oh, S.H.; Hwang, J.S.; Lee, B.Y.; Lee, P.C. Microbial production of retinyl palmitate and its application as a cosmeceutical. Antioxidants 2020, 9, 1130. [Google Scholar] [CrossRef]
- Choi, B.H.; Kim, J.H.; Choi, S.Y.; Han, S.J.; Lee, P.C. Redesign and reconstruction of a mevalonate pathway and its application in terpene production in Escherichia coli. Bioresour. Technol. Rep. 2019, 7, 100291. [Google Scholar] [CrossRef]
- Han, M.; Lee, P. Microbial Production of Bioactive Retinoic Acid Using Metabolically Engineered Escherichia coli. Microorganisms 2021, 9, 1520. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Kim, J.W.; Lee, P.C. Complete genome sequence of Flavobacterium kingsejongi WV39, a type species of the genus Flavobacterium and a microbial C40 carotenoid zeaxanthin producer. J. Biotechnol. 2018, 266, 9–13. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Kim, J.W.; Lee, P.C. Genome mining reveals two missing CrtP and AldH enzymes in C30 carotenoid bio-synthesis pathway of Planococcus faecalis AJ003T. Molecules 2020, 25, 5892. [Google Scholar] [CrossRef]
- Kim, S.H.; Kim, M.S.; Lee, B.Y.; Lee, P.C. Generating structurally novel short carotenoids and studying their biological activity. Sci. Rep. 2016, 6, 21987. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.; Kucukural, A.; Zhang, Y. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc. 2010, 5, 725–738. [Google Scholar] [CrossRef] [Green Version]
- Ahn, J.-W.; Kim, K.-J. Crystal structure of 1′-OH-carotenoid 3,4-desaturase from Nonlabens dokdonensis DSW-Enzym. Microb. Technol. 2015, 77, 29–37. [Google Scholar] [CrossRef]
- Wu, Q.; Peng, Z.; Zhang, Y.; Yang, J. COACH-D: Improved protein-ligand binding sites prediction with refined lig-and-binding poses through molecular docking. Nucleic Acids Res. 2018, 46, W438–W442. [Google Scholar] [CrossRef] [Green Version]
- Österberg, T.; Norinder, U. Prediction of drug transport processes using simple parameters and PLS statistics The use of ACDlogP and ACDChemSketch descriptors. Eur. J. Pharm. Sci. 2001, 12, 327–337. [Google Scholar] [CrossRef]
- Armstrong, G.A.; Alberti, M.; Hearst, J.E. Conserved enzymes mediate the early reactions of carotenoid biosynthesis in nonphotosynthetic and photosynthetic prokaryotes. Proc. Natl. Acad. Sci. USA 1990, 87, 9975–9979. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brausemann, A.; Gemmecker, S.; Koschmieder, J.; Ghisla, S.; Beyer, P.; Einsle, O. Structure of Phytoene Desaturase Provides Insights into Herbicide Binding and Reaction Mechanisms Involved in Carotene Desaturation. Structure 2017, 25, 1222–1232. [Google Scholar] [CrossRef] [PubMed]
Plasmid | Description | Source or Reference |
---|---|---|
Strains | ||
Rhodobacter sphaeroides Pantoea agglomerans | Microbial source for C40 carotenoid pathway genes | KCTC 12085 KCTC 2479 |
Plasmids | ||
pGEM® T-easy vector | Cloning vector | Promega |
pT_crtERS | Vector containing crtE gene from R. sphaeroides | This study |
pT_crtBRS | Vector containing crtB gene from R. sphaeroides | This study |
pT_crtIRS | Vector containing crtI gene from R. sphaeroides | This study |
pUCM | Cloning vector modified from pUC19. constitutive lac promoter, Amp | [8] |
pUCM_ERS | Constitutively expressed crtE gene from R. sphaeroides | This study |
pUCM_BRS | Constitutively expressed crtB gene from R. sphaeroides | This study |
pUCM_IRS | Constitutively expressed crtI gene from R. sphaeroides | This study |
pACM_ERS | Constitutively expressed crtE gene from R. sphaeroides | This study |
pACM_ERS_BRS | Constitutively expressed crtE and crtB genes from R. sphaeroides | This study |
pACM_EPA_BPA | Constitutively expressed crtE and crtB genes from P. agglomerans | [22] |
pUCM_IRS_Im1 | Constitutively expressed mutant crtI gene (I454T) | This study |
pUCM_IRS_Im2 | Constitutively expressed mutant crtI gene (A171P) | This study |
pUCM_IRS_Im3 | Constitutively expressed mutant crtI gene (I454T and E186G) | This study |
pUCM_IRS_Im4 | Constitutively expressed mutant crtI gene (I454T and L429L) | This study |
pUCM_IRS_Im5 | Constitutively expressed mutant crtI gene (A171P and W142R) | This study |
pUCM_IRS_Im6 | Constitutively expressed mutant crtI gene (L163P) | This study |
pUCM_IRS_ImA171P | Constitutively expressed mutant crtI (Site-directed mutation) | This study |
pUCM_IRS_ImL163P | Constitutively expressed mutant crtI (Site-directed mutation) | This study |
pUCM-IRS_ImW142R | Constitutively expressed mutant crtI (Site-directed mutation) | This study |
pUCM-IRS_ImE186G | Constitutively expressed mutant crtI (Site-directed mutation) | This study |
pUCM-IRS_ImI454T | Constitutively expressed mutant crtI (Site-directed mutation) | This study |
pUCM-IRS_ImA171P&I454T | Constitutively expressed mutant crtI (Site-directed mutation) | This study |
Mutants | Parental Gene | Nucleotide Changes | Amino Acid Changes | Carotenoid Profiles with CrtERS and CrtBRS | Carotenoid Profiles with CrtEPA and CrtBPA |
---|---|---|---|---|---|
RIm1 | WT | T1361C (ATC→ACC) | I454T | * Ddl (9.9%) | Ddl (11.3%) |
Lyc (72.9%) | Lyc (53.5%) | ||||
Neu (17.2%) | Neu (35.1%) | ||||
RIm2 | WT | G511C (GCC→CCC) | A171P | Ddl (1.3%) | Ddl (2.1%) |
Lyc (91.5%) | Lyc (86.7%) | ||||
Neu (7.2%) | Neu (11.2%) | ||||
RIm3 | RIm1 | T1361C (ATC→ACC) A557G (GAG→GGG) | I454T | Ddl (9.4%) | Ddl (4.7%) |
Lyc (51.2%) | Lyc (32.6%) | ||||
E186G | Neu (39.4%) | Neu (62.7%) | |||
RIm4 | RIm1 | T1361C (ATC→ACC) C1287T (CTC→CTT) | I454T | Ddl (6.2%) | Ddl (4.6%) |
Lyc (60.5%) | Lyc (82.0%) | ||||
Silent mutation | Neu (33.4%) | Neu (13.4%) | |||
RIm5 | RIm2 | G511C (GCC→CCC) T424A (TGG→AGG) | A171P | Ddl (1.1%) | Ddl (7.6%) |
Lyc (90.8%) | Lyc (41.9%) | ||||
W142R | Neu (8.1%) | Neu (50.5%) | |||
RIm6 | WT | T488C (CTG→CCG) | L163P | Ddl (0%) | Ddl (0%) |
Lyc (5.3%) | Lyc (0%) | ||||
Neu (94.7%) | Neu (100%) |
Gene | Primer Sequence | Enzyme Site |
---|---|---|
crtE | F: 5′ GCTCTAGAAGGAGGATTACAAAATGGCGTTTGAACAGCGGATTG 3′ | XbaⅠ |
R: 5′ GGAATTCTCAGACGCGGGCCGCGACCT 3′ | EcoRⅠ | |
crtB | F: 5′ GGAATTCAGGAGGATTACAAAATGATTGCCTCTGCCGATCT3′ | EcoRⅠ |
R: 5′ CATGCCATGGCTAGATCGGGTTGGCCCG3′ | NcoⅠ | |
crtI | F: 5′ GCTCTAGAAGGAGGATTACAAAATGCCCTCGATCTCGCCC 3′ | XbaⅠ |
R:5′ CGGAATTCTCATTCCGCGGCAAGCCT 3′ | EcoRⅠ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, B.H.; Kim, S.H.; Lee, P.C. Hot Spots of Phytoene Desaturase from Rhodobacter sphaeroides Influencing the Desaturation of Phytoene. Catalysts 2021, 11, 1248. https://doi.org/10.3390/catal11101248
Choi BH, Kim SH, Lee PC. Hot Spots of Phytoene Desaturase from Rhodobacter sphaeroides Influencing the Desaturation of Phytoene. Catalysts. 2021; 11(10):1248. https://doi.org/10.3390/catal11101248
Chicago/Turabian StyleChoi, Bo Hyun, Sung Hui Kim, and Pyung Cheon Lee. 2021. "Hot Spots of Phytoene Desaturase from Rhodobacter sphaeroides Influencing the Desaturation of Phytoene" Catalysts 11, no. 10: 1248. https://doi.org/10.3390/catal11101248