Evidence from Thermal Aging Indicating That the Synergistic Effect of Glyoxal and Sodium Sulfite Improved the Thermal Stability of Conformational Modified Xanthan Gum
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Culture
2.2. Construction of X. Campestris Mutants
2.3. Preparation of Xanthan Gum Samples
2.4. Determination of Acetyl and Pyruvyl Contents
2.5. Determination of the Molecular Weight of Xanthan Gum Samples
2.6. Determination of the Thermal Stability of Xanthan Gum Samples
2.7. Structural Characterization of Xanthan Gum Samples
3. Results
3.1. Basic Properties of Natural and Pyruvate-Free Xanthan Gum Samples
3.2. Thermal Stabilities of Different Xanthan Gum Solutions
3.3. Effects of Pyruvyl Groups and Stabilizers on the Structure of Xanthan Gum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ielpi, L.; Couso, R.O.; Dankert, M.A. Sequential assembly and polymerization of the polyprenol-linked pentasaccharide repeating unit of the xanthan polysaccharide in Xanthomonas campestris. J. Bacteriol. 1993, 175, 2490–2500. [Google Scholar] [CrossRef] [Green Version]
- Jansson, P.-E.; Kenne, L.; Lindberg, B. Structure of the extracellular polysaccharide from xanthomonas campestris. Carbohydr. Res. 1975, 45, 275–282. [Google Scholar] [CrossRef]
- Celik, M.; Ahmad, S.; Al-Hashim, H. Adsorption/desorption of polymers from Saudi Arabian limestone. J. Pet. Sci. Eng. 1991, 6, 213–223. [Google Scholar] [CrossRef]
- García-Ochoa, F.; Santos, V.E.; Casas, J.A.; Gomez, E. Xanthan gum: Production, recovery, and properties. Biotechnol. Adv. 2000, 18, 549–579. [Google Scholar] [CrossRef]
- Fiume, M.M.; Heldreth, B.; Bergfeld, W.F.; Belsito, D.V.; Hill, R.A.; Klaassen, C.D.; Liebler, D.C.; Marks, J.J.G.; Shank, R.C.; Slaga, T.J.; et al. Safety Assessment of Microbial Polysaccharide Gums as Used in Cosmetics. Int. J. Toxicol. 2016, 35 (Suppl. 5S), 5S–49S. [Google Scholar] [CrossRef] [PubMed]
- Palaniraj, A.; Jayaraman, V. Production, recovery and applications of xanthan gum by Xanthomonas campestris. J. Food Eng. 2011, 106, 1–12. [Google Scholar] [CrossRef]
- Kamal, M.S.; Sultan, A.; Al-Mubaiyedh, U.A.; Hussein, I.A. Review on Polymer Flooding: Rheology, Adsorption, Stability, and Field Applications of Various Polymer Systems. Polym. Rev. 2015, 55, 491–530. [Google Scholar] [CrossRef]
- Lambert, F.; Rinaudo, M. On the thermal stability of xanthan gum. Polymer 1985, 26, 1549–1553. [Google Scholar] [CrossRef]
- Quan, H.; Hu, Y.; Huang, Z.; Wenmeng, D. Preparation and property evaluation of a hydrophobically modified xanthan gum XG-C16. J. Dispers. Sci. Technol. 2019, 41, 656–666. [Google Scholar] [CrossRef]
- Zhang, H.; Fang, B.; Lu, Y.; Qiu, X.; Jin, H.; Liu, Y.; Wang, L.; Tian, M.; Li, K. Rheological properties of water-soluble cross-linked xanthan gum. J. Dispers. Sci. Technol. 2016, 38, 361–366. [Google Scholar] [CrossRef]
- Zhu, W.; Zheng, X.; Shi, J.; Wang, Y. A high-temperature resistant colloid gas aphron drilling fluid system prepared by using a novel graft copolymer xanthan gum-AA/AM/AMPS. J. Pet. Sci. Eng. 2021, 205, 108821. [Google Scholar] [CrossRef]
- Seright, R.; Henrici, B. Xanthan Stability at Elevated Temperatures. SPE Reserv. Eng. 1990, 5, 52–60. [Google Scholar] [CrossRef]
- Howard, S.; Kaminski, L.; Downs, J. Xanthan Stability in Formate Brines-Formulating Non-damaging Fluids for High Temperature Applications. In Proceedings of the SPE European Formation Damage Conference and Exhibition, Budapest, Hungary, 3–5 June 2015. [Google Scholar] [CrossRef]
- Wellington, S.L. Biopolymer Solution Viscosity Stabilization-Polymer Degradation and Antioxidant Use. Soc. Pet. Eng. J. 1983, 23, 901–912. [Google Scholar] [CrossRef]
- Plank, J.; Keilhofer, G.; Lange, P. Use of Dicarbonyl Compounds for Increasing the Thermal Stability of Biopolymers in the Field of Oil and Gas Exploration. U.S. Patent Application US20070287638, 13 December 2007. [Google Scholar]
- Callet, F.; Milas, M.; Rinaudo, M. On the role of thermal treatments on the properties of xanthan solutions. Carbohydr. Polym. 1989, 11, 127–137. [Google Scholar] [CrossRef]
- Milas, M.; Linossier, J.L.; Contat, F. The effect of thermal aging on xanthan solutions. J. Appl. Polym. Sci. 1988, 35, 1115–1122. [Google Scholar] [CrossRef]
- Kool, M.M.; Gruppen, H.; Sworn, G.; Schols, H.A. The influence of the six constituent xanthan repeating units on the order–disorder transition of xanthan. Carbohydr. Polym. 2014, 104, 94–100. [Google Scholar] [CrossRef]
- Smith, I.; Symes, K.; Lawson, C.; Morris, E. Influence of the pyruvate content of xanthan on macromolecular association in solution. Int. J. Biol. Macromol. 1981, 3, 129–134. [Google Scholar] [CrossRef]
- Hassler, R.A.; Doherty, D.H. Genetic engineering of polysaccharide structure: Production of variants of xanthan gum in Xanthomonas campestris. Biotechnol. Prog. 1990, 6, 182–187. [Google Scholar] [CrossRef]
- Katzen, F.; Ferreiro, D.U.; Oddo, C.G.; Ielmini, M.V.; Becker, A.; Pühler, A.; Ielpi, L. Xanthomonas campestris pv. campestris gum Mutants: Effects on Xanthan Biosynthesis and Plant Virulence. J. Bacteriol. 1998, 180, 1607–1617. [Google Scholar] [CrossRef] [Green Version]
- Wu, M.; Huang, H.; Li, G.; Ren, Y.; Shi, Z.; Li, X.; Dai, X.; Gao, G.; Ren, M.; Ma, T. The evolutionary life cycle of the polysaccharide biosynthetic gene cluster based on the Sphingomonadaceae. Sci. Rep. 2017, 7, 46484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schäfer, A.; Tauch, A.; Jäger, W.; Kalinowski, J.; Thierbach, G.; Pühler, A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: Selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 1994, 145, 69–73. [Google Scholar] [CrossRef]
- Wang, X.; Zheng, D.; Liang, R. An Efficient Electro-Competent Cells Generation Method of Xanthomonas campestris pv. campestris: Its Application for Plasmid Transformation and Gene Replacement. Adv. Microbiol. 2016, 6, 79–87. [Google Scholar] [CrossRef] [Green Version]
- Cheetham, N.W.; Punruckvong, A. An HPLC method for the determination of acetyl and pyruvyl groups in polysaccharides. Carbohydr. Polym. 1985, 5, 399–406. [Google Scholar] [CrossRef]
- Wang, Z.; Wu, J.; Zhu, L.; Zhan, X. Characterization of xanthan gum produced from glycerol by a mutant strain Xanthomonas campestris CCTCC M2015714. Carbohydr. Polym. 2017, 157, 521–526. [Google Scholar] [CrossRef]
- Ngwabebhoh, F.A.; Zandraa, O.; Patwa, R.; Saha, N.; Capáková, Z.; Saha, P. Self-crosslinked chitosan/dialdehyde xanthan gum blended hypromellose hydrogel for the controlled delivery of ampicillin, minocycline and rifampicin. Int. J. Biol. Macromol. 2021, 167, 1468–1478. [Google Scholar] [CrossRef] [PubMed]
- Kang, M.; Oderinde, O.; Liu, S.; Huang, Q.; Ma, W.; Yao, F.; Fu, G. Characterization of Xanthan gum-based hydrogel with Fe3+ ions coordination and its reversible sol-gel conversion. Carbohydr. Polym. 2019, 203, 139–147. [Google Scholar] [CrossRef]
- Pourfarzad, A.; Yousefi, A.; Ako, K. Steady/dynamic rheological characterization and FTIR study on wheat starch-sage seed gum blends. Food Hydrocoll. 2021, 111, 106380. [Google Scholar] [CrossRef]
- Wu, M.; Shi, Z.; Ming, Y.; Wang, C.; Qiu, X.; Li, G.; Ma, T. Thermostable and rheological properties of natural and genetically engineered xanthan gums in different solutions at high temperature. Int. J. Biol. Macromol. 2021, 182, 1208–1217. [Google Scholar] [CrossRef]
- Gansbiller, M.; Schmid, J.; Sieber, V. In-depth rheological characterization of genetically modified xanthan-variants. Carbohydr. Polym. 2019, 213, 236–246. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.; Qu, J.; Tian, X.; Zhao, X.; Shen, Y.; Shi, Z.; Chen, P.; Li, G.; Ma, T. Tailor-made polysaccharides containing uniformly distributed repeating units based on the xanthan gum skeleton. Int. J. Biol. Macromol. 2019, 131, 646–653. [Google Scholar] [CrossRef]
- Zou, Z.; Zhao, Q.; Wang, Q.; Zhou, F. Thermal stability of xanthan gum biopolymer and its application in salt-tolerant bentonite water-based mud. J. Polym. Eng. 2019, 39, 501–507. [Google Scholar] [CrossRef]
- Ni, S.; Wang, B.; Zhang, H.; Zhang, Y.; Liu, Z.; Wu, W.; Xiao, H.; Dai, H. Glyoxal improved functionalization of starch with AZC enhances the hydrophobicity, strength and UV blocking capacities of co-crosslinked polymer. Eur. Polym. J. 2018, 110, 385–393. [Google Scholar] [CrossRef]
- Phiriyawirut, M.; Mekaroonluck, J.; Hauyam, T.; Kittilaksanon, A. Biomass-Based Foam from Crosslinked Tapioca Starch/ Polybutylene Succinate Blend. J. Renew. Mater. 2016, 4, 185–189. [Google Scholar] [CrossRef]
- Causse, B.; Spadini, L.; Martins, J.M.; Lenoir, T.; Heyraud, A.; Delolme, C. Xanthan exopolysaccharide: Acid–base reactivity related to structure and conformation. A model for understanding the reactivity of degraded and colloidal soil organic matter. Chem. Geol. 2013, 359, 150–158. [Google Scholar] [CrossRef]
- Jiang, N.; Dillon, F.M.; Silva, A.; Gomez-Cano, L.; Grotewold, E. Rhamnose in plants-from biosynthesis to diverse functions. Plant Sci. 2021, 302, 110687. [Google Scholar] [CrossRef] [PubMed]
- Kaur, V.; Bera, M.B.; Panesar, P.S.; Kumar, H.; Kennedy, J. Welan gum: Microbial production, characterization, and applications. Int. J. Biol. Macromol. 2014, 65, 454–461. [Google Scholar] [CrossRef]
- Mukherjee, I.; Sarkar, D.; Moulik, S.P. Interaction of Gums (Guar, Carboxymethylhydroxypropyl Guar, Diutan, and Xanthan) with Surfactants (DTAB, CTAB, and TX-100) in Aqueous Medium. Langmuir 2010, 26, 17906–17912. [Google Scholar] [CrossRef] [PubMed]
- Noïk, C.; Lecourtier, J. Studies on scleroglucan conformation by rheological measurements versus temperature up to 150 °C. Polymer 1993, 34, 150–157. [Google Scholar] [CrossRef]
- Morris, E.R. Ordered conformation of xanthan in solutions and “weak gels”: Single helix, double helix–or both? Food Hydrocoll. 2019, 86, 18–25. [Google Scholar] [CrossRef]
- Pawlicka, A.; Tavares, F.C.; Dörr, D.S.; Cholant, C.M.; Ely, F.; Santos, M.J.L.; Avellaneda, C.O. Dielectric behavior and FTIR studies of xanthan gum-based solid polymer electrolytes. Electrochim. Acta 2019, 305, 232–239. [Google Scholar] [CrossRef]
- Su, L.; Ji, W.; Lan, W.; Dong, X. Chemical modification of xanthan gum to increase dissolution rate. Carbohydr. Polym. 2003, 53, 497–499. [Google Scholar] [CrossRef]
- Quero, F.; Nogi, M.; Lee, K.-Y.; Poel, G.V.; Bismarck, A.; Mantalaris, A.; Yano, H.; Eichhorn, S.J. Cross-Linked Bacterial Cellulose Networks Using Glyoxalization. ACS Appl. Mater. Interfaces 2011, 3, 490–499. [Google Scholar] [CrossRef] [PubMed]
- Christensen, B.; Smidsrød, O. Hydrolysis of xanthan in dilute acid: Effects on chemical composition, conformation, and intrinsic viscosity. Carbohyd. Res. 1991, 214, 55–69. [Google Scholar] [CrossRef]
- Schweitzer, F.; Magi, L.; Mirabel, P.; George, C. Uptake Rate Measurements of Methanesulfonic Acid and Glyoxal by Aqueous Droplets. J. Phys. Chem. A 1998, 102, 593–600. [Google Scholar] [CrossRef]
- Olson, T.M.; Hoffmann, M.R. Formation kinetics, mechanism, and thermodynamics of glyoxylic acid-sulfur(IV) adducts. J. Phys. Chem. 1988, 92, 4246–4253. [Google Scholar] [CrossRef]
Primers | Sequence |
---|---|
gumL-F1 | CGCGGATCCATGGCCAACGCTTTACTGCAGAA |
gumL-R1 | AGGCCGTGCGCTGGAATCTTG |
gumL-F2 | GATTCCAGCGCACGGCCT |
gumL-R2 | CCCAAGCTTTCACCACAAATCGTAAGGGAACGCAGC |
Samples | Pyruvyl (wt.%) b | Acetyl (wt.%) b | MW (Da) | Yield (g/100 g) | Producing Strain |
---|---|---|---|---|---|
XG a | 3.86 ± 0.08 | 6.35 ± 0.06 | 1.83 × 107 | 3.05 ± 0.08 | XC |
XG-L a | 0.06 ± 0 | 7.04 ± 0.11 | 1.67 × 107 | 2.90 ± 0.03 | XC-ΔgumL |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, S.; Liang, J.; Zhang, Y.; Han, H.; Jiang, T.; Liu, Y.; Zhang, Y.; Wang, W.; Dong, X. Evidence from Thermal Aging Indicating That the Synergistic Effect of Glyoxal and Sodium Sulfite Improved the Thermal Stability of Conformational Modified Xanthan Gum. Polymers 2022, 14, 243. https://doi.org/10.3390/polym14020243
Yuan S, Liang J, Zhang Y, Han H, Jiang T, Liu Y, Zhang Y, Wang W, Dong X. Evidence from Thermal Aging Indicating That the Synergistic Effect of Glyoxal and Sodium Sulfite Improved the Thermal Stability of Conformational Modified Xanthan Gum. Polymers. 2022; 14(2):243. https://doi.org/10.3390/polym14020243
Chicago/Turabian StyleYuan, Shuai, Jiayuan Liang, Yanmin Zhang, Hongyu Han, Tianyi Jiang, Yang Liu, Yonggang Zhang, Wei Wang, and Xueqian Dong. 2022. "Evidence from Thermal Aging Indicating That the Synergistic Effect of Glyoxal and Sodium Sulfite Improved the Thermal Stability of Conformational Modified Xanthan Gum" Polymers 14, no. 2: 243. https://doi.org/10.3390/polym14020243