A 1Ns Disomic Addition from Psathyrostachys Huashanica Keng Confers Resistance to Powdery Mildew in Wheat
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Assessment of Powdery Mildew Resistance
2.3. Cytogenetic Analysis
2.4. Genomic In Situ Hybridization (GISH) Analysis
2.5. Expressed Sequence Tag-Sequence-Tagged Site (EST-STS) Analysis
3. Results
3.1. Evaluations of Resistance to Powdery Mildew
3.2. Cytogenetic Analysis of H5-5-4-2
3.3. GISH Analysis of H5-5-4-2
3.4. EST-STS Analysis of H5-5-4-2
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Yang, M.J.; Huang, K.Y.; Han, Q.D. Research progresses on wheat powdery mildew and its resistance. Mol. Plant Breed. 2016, 14, 1244–1254. [Google Scholar] [CrossRef]
- Dean, R.; Van Kan, J.; Pretorius, Z.A.; E Hammond-Kosack, K.; Di Pietro, A.; Spanu, P.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morgounov, A.; Tufan, H.A.; Sharma, R.; Akin, B.; Bagci, A.; Braun, H.-J.; Kaya, Y.; Keser, M.; Payne, T.S.; Sonder, K.; et al. Global incidence of wheat rusts and powdery mildew during 1969–2010 and durability of resistance of winter wheat variety Bezostaya 1. Eur. J. Plant Pathol. 2011, 132, 323–340. [Google Scholar] [CrossRef]
- Khong, N.G.; Randoux, B.; Tayeh, C.; Coutte, F.; Bourdon, N.; Tisserant, B.; Laruelle, F.; Jacques, P.; Reignault, P. Induction of resistance in wheat against powdery mildew by bacterial cyclic lipopeptides. Commun. Agric. Appl. Boil. Sci. 2012, 77, 39–51. [Google Scholar]
- Tan, C.; Li, G.; Cowger, C.; Carver, B.F.; Xu, X. Characterization of Pm59, a novel powdery mildew resistance gene in Afghanistan wheat landrace PI 181356. Theor. Appl. Genet. 2018, 131, 1145–1152. [Google Scholar] [CrossRef]
- Ma, P.; Xu, H.; Xu, Y.; Li, L.; Qie, Y.; Luo, Q.; Zhang, X.; Li, X.; Zhou, Y.; An, D. Molecular mapping of a new powdery mildew resistance gene Pm2b in Chinese breeding line KM2939. Theor. Appl. Genet. 2015, 128, 613–622. [Google Scholar] [CrossRef]
- McDonald, B.; Linde, C. The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 2002, 124, 163–180. [Google Scholar] [CrossRef]
- Hou, L.; Zhang, X.; Li, X.; Jia, J.; Yang, H.; Zhan, H.; Qiao, L.; Guo, H.; Chang, Z. Mapping of Powdery Mildew Resistance Gene pmCH89 in a Putative Wheat-Thinopyrum intermedium Introgression Line. Int. J. Mol. Sci. 2015, 16, 17231–17244. [Google Scholar] [CrossRef] [Green Version]
- Lin, Z.-S.; Cui, Z.-F.; Zeng, X.-Y.; Ma, Y.-Z.; Zhang, Z.-Y.; Nakamura, T.; Ishikawa, G.; Nakamura, K.; Yoshida, H.; Xin, Z.-Y. Analysis of wheat-Thinopyrum intermedium derivatives with BYDV-resistance. Euphytica 2007, 158, 109–118. [Google Scholar] [CrossRef]
- Wang, X.-J.; Chen, X.-H.; Pang, Y.-H.; Jing, F.; Zhang, J.; Hu, S.-Y.; Zan, K.; Wu, J.; Yang, Q.-H.; Zhao, J.-X. Molecular Cytogenetics Identification of a wheat Psathyrostachys huashanica Substitution Line DH2322. Acta Agron. Sin. 2015, 41, 207. [Google Scholar] [CrossRef]
- Baden, C. A taxonomic revision of Psathyrostachys (Poaceae). Nord. J. Bot. 1991, 11, 3–26. [Google Scholar] [CrossRef]
- Du, W.; Wang, J.; Lu, M.; Sun, S.; Chen, X.; Zhao, J.; Yang, Q.; Wu, J. Molecular cytogenetic identification of a wheat–Psathyrostachys huashanica Keng 5Ns disomic addition line with stripe rust resistance. Mol. Breed. 2013, 31, 879–888. [Google Scholar] [CrossRef]
- Han, Y.C.; Wang, C.Y.; Chen, C.H.; Tian, Z.R.; Ji, W.Q. Molecular cytogenetic study on wheat-Psathyrostachys huashanica 1Ns disomic addition line. J. Triticeae Crop. 2015, 35, 1044–1049. [Google Scholar] [CrossRef]
- Ma, D.-F.; Hou, L.; Sun, C.; Zhang, X.; Yin, J.-L.; Guo, Q.-Y.; Zhu, Y.-X. Molecular mapping of stripe rust resistance gene YrH9017 in wheat-Psathyrostachys huashanica introgression line H9017-14-16-5-3. J. Integr. Agric. 2019, 18, 108–114. [Google Scholar] [CrossRef]
- Chen, S.Y.; Hou, W.S.; Zhang, A.J.; Fu, J.; Yang, Q.H. Breeding and cytogenetic study of Triticum aestivum-Psathyrostachys huashanica alien addition lines. Acta Genet. Sin. 1996, 23, 447–452. [Google Scholar]
- Kang, H.Y.; Wang, Y.; Sun, G.L.; Zhang, H.Q.; Fan, X.; Zhou, Y.H. Production and characterization of an amphiploid between common wheat and Psathyrostachys huashanica Keng ex Kuo. Plant Breed. 2009, 128, 36–40. [Google Scholar] [CrossRef]
- Kang, H.-Y.; Zhang, Z.-J.; Xu, L.-L.; Qi, W.-L.; Tang, Y.; Wang, H.; Zhu, W.; Li, D.-Y.; Zeng, J.; Wang, Y.; et al. Characterization of wheat–Psathyrostachys huashanica small segment translocation line with enhanced kernels per spike and stripe rust resistance. Genome 2016, 59, 221–229. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Jiang, Y.; Guo, Y.L.; Li, Y.H.; Wang, Y.; Pu, X. Cloning of Ns genome-specific sequence of Psathyrostachys huashanica and construction of molecular markers. J. Agric. Biotechnol. 2017, 25, 1391–1399. [Google Scholar] [CrossRef]
- An, D.; Zheng, Q.; Zhou, Y.; Ma, P.; Lv, Z.; Li, L.; Li, B.; Luo, Q.; Xu, H.; Xu, Y. Molecular cytogenetic characterization of a new wheat–rye 4R chromosome translocation line resistant to powdery mildew. Chromosom. Res. 2013, 21, 419–432. [Google Scholar] [CrossRef]
- Yu, X.; Ren, S.; Zhao, L.; Guo, J.; Bao, Y.; Ma, Y.; Wang, H.; Ohm, H.W.; Yu, D.; Li, H.; et al. Molecular mapping of a novel wheat powdery mildew resistance gene Ml92145E8-9 and its application in wheat breeding by marker-assisted selection. Crop. J. 2018, 6, 621–627. [Google Scholar] [CrossRef]
- Zeng, F.-S.; Yang, L.-J.; Gong, S.-J.; Shi, W.-Q.; Zhang, X.-J.; Wang, H.; Xiang, L.-B.; Xue, M.-F.; Yu, D.-Z. Virulence and Diversity of Blumeria graminis f. sp. tritici Populations in China. J. Integr. Agric. 2014, 13, 2424–2437. [Google Scholar] [CrossRef]
- Sheng, B.Q.; Duan, X.Y. Improvement of scale 0-9 method for scoring adult plant resistance to powdery mildew of wheat. J. Beijing Agric. Sci. 1991, 1, 38–39. [Google Scholar]
- Yan, Z.Y.; Fan, J.R.; Liu, W.; Zhou, Y.L. Models of disease index estimation of wheat powdery mildew based on the concentrations of Blumeria graminis f. sp. tritici conidia in the fields. Acta Phytopathol. Sin. 2017, 47, 253–261. [Google Scholar] [CrossRef]
- Tang, X.; Shi, D.; Xu, J.; Li, Y.; Li, W.; Ren, Z.; Fu, T. Molecular cytogenetic characteristics of a translocation line between common wheat and Thinopyrum intermedium with resistance to powdery mildew. Euphytica 2014, 197, 201–210. [Google Scholar] [CrossRef]
- Cota-Sánchez, J.H.; Remarchuk, K.; Ubayasena, K. Ready-to-use DNA extracted with a CTAB method adapted for herbarium specimens and mucilaginous plant tissue. Plant Mol. Boil. Rep. 2006, 24, 161–167. [Google Scholar] [CrossRef]
- Lee, M.H.; Nicholson, P. Isolation of genomic DNA from plant tissues. Nat. Biotechnol. 1997, 15, 805–806. [Google Scholar] [CrossRef]
- An, D.; Xu, H.; Xu, Y.-F. Enhancement of wheat distant hybridization germplasm. Chin. J. Eco-Agric. 2012, 19, 1011–1019. [Google Scholar] [CrossRef]
- Dong, Y.C. Wheat Breeding through Distant Crossing. In Proceedings of the International Symposium on Genetics and Breeding of Wheat, Zhengzhou, Henan, China, 9–11 May 2001. [Google Scholar]
- Howell, T.; Hale, I.; Jankuloski, L.; Bonafede, M.; Gilbert, M.; Dubcovsky, J. Mapping a region within the 1RS.1BL translocation in common wheat affecting grain yield and canopy water status. Theor. Appl. Genet. 2014, 127, 2695–2709. [Google Scholar] [CrossRef] [Green Version]
- Ren, T.-H.; Chen, F.; Yan, B.-J.; Zhang, H.-Q.; Ren, Z.-L. Genetic diversity of wheat–rye 1BL.1RS translocation lines derived from different wheat and rye sources. Euphytica 2011, 183, 133–146. [Google Scholar] [CrossRef]
- An, D.; Ma, P.; Zheng, Q.; Fu, S.; Li, L.; Han, F.; Han, G.; Wang, J.; Xu, Y.; Jin, Y.; et al. Development and molecular cytogenetic identification of a new wheat-rye 4R chromosome disomic addition line with resistances to powdery mildew, stripe rust and sharp eyespot. Theor. Appl. Genet. 2018, 132, 257–272. [Google Scholar] [CrossRef]
- Pan, C.; Li, Q.; Lu, Y.; Zhang, J.; Yang, X.; Li, X.; Li, L.; Liu, W. Chromosomal localization of genes conferring desirable agronomic traits from Agropyron cristatum chromosome 1P. PLoS ONE 2017, 12, e0175265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, W.; Wang, J.; Lu, M.; Sun, S.; Chen, X.; Zhao, J.; Yang, Q.; Wu, J. Characterization of a wheat-Psathyrostachys huashanica Keng 4Ns disomic addition line for enhanced tiller numbers and stripe rust resistance. Planta 2013, 239, 97–105. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Yao, X.; Yang, Z.; Cheng, X.; Yuan, F.; Liu, Y.; Wu, J.; Yang, Q.; Zhao, J.; Chen, X. Molecular cytogenetic characterization of a novel wheat–Psathyrostachys huashanica Keng 5Ns (5D) disomic substitution line with stripe rust resistance. Mol. Breed. 2019, 39, 109. [Google Scholar] [CrossRef]
- Cowger, C.; Miranda, L.; Griffey, C.; Hall, M.; Murphy, J.P.; Maxwell, J. Wheat powdery mildew. In Disease Resistance in Wheat; CABI Publishing: Wallingford, UK, 2012; pp. 84–119. [Google Scholar]
- He, F.; Bao, Y.; Qi, X.; Ma, Y.; Li, X.; Wang, H. Molecular cytogenetic identification of a wheat–Thinopyrum ponticum translocation line resistant to powdery mildew. J. Genet. 2017, 96, 165–169. [Google Scholar] [CrossRef]
- Xu, X.-D.; Feng, J.; Fan, J.; Liu, Z.; Li, Q.; Zhou, Y.; Ma, Z.-H. Identification of the resistance gene to powdery mildew in Chinese wheat landrace Baiyouyantiao. J. Integr. Agric. 2018, 17, 37–45. [Google Scholar] [CrossRef] [Green Version]
- Li, G.; Cowger, C.; Wang, X.; Carver, B.F.; Xu, X. Characterization of Pm65, a new powdery mildew resistance gene on chromosome 2AL of a facultative wheat cultivar. Theor. Appl. Genet. 2019, 132, 2625–2632. [Google Scholar] [CrossRef]
- Tan, C.; Li, G.; Cowger, C.; Carver, B.F.; Xu, X. Characterization of Pm63, a powdery mildew resistance gene in Iranian landrace PI 628024. Theor. Appl. Genet. 2018, 132, 1137–1144. [Google Scholar] [CrossRef]
- Zhang, D.; Zhu, K.; Dong, L.; Liang, Y.; Li, G.; Fang, T.; Guo, G.; Wu, Q.; Xie, J.; Chen, Y.; et al. Wheat powdery mildew resistance gene Pm64 derived from wild emmer (Triticum turgidum var. dicoccoides) is tightly linked in repulsion with stripe rust resistance gene Yr5. Crop. J. 2019, 7, 761–770. [Google Scholar] [CrossRef]
- Grewal, S.; Yang, C.; Hubbart-Edwards, S.; Scholefield, D.; Ashling, S.; Burridge, A.; King, I.P.; King, J. Characterisation of Thinopyrum bessarabicum chromosomes through genome-wide introgressions into wheat. Theor. Appl. Genet. 2017, 131, 389–406. [Google Scholar] [CrossRef] [Green Version]
- Rahmatov, M.; Rouse, M.N.; Nirmala, J.; Danilova, T.; Friebe, B.; Steffenson, B.J.; Johansson, E. A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat. Theor. Appl. Genet. 2016, 129, 1383–1392. [Google Scholar] [CrossRef]
- An, D.; Zheng, Q.; Luo, Q.; Ma, P.; Zhang, H.; Li, L.; Han, F.; Xu, H.; Xu, Y.; Zhang, X.; et al. Molecular Cytogenetic Identification of a New Wheat-Rye 6R Chromosome Disomic Addition Line with Powdery Mildew Resistance. PLoS ONE 2015, 10, e0134534. [Google Scholar] [CrossRef] [PubMed]
- Friebe, B.; Heun, M.; Tuleen, N.; Zeller, F.J.; Gill, B.S. Cytogenetically Monitored Transfer of Powdery Mildew Resistance from Rye into Wheat. Crop. Sci. 1994, 34, 621–625. [Google Scholar] [CrossRef]
- Zhan, H.; Zhang, X.; Li, G.; Pan, Z.; Hu, J.; Li, X.; Qiao, L.; Jia, J.; Guo, H.; Chang, Z.; et al. Molecular Characterization of a New Wheat-Thinopyrum intermedium Translocation Line with Resistance to Powdery Mildew and Stripe Rust. Int. J. Mol. Sci. 2015, 16, 2162–2173. [Google Scholar] [CrossRef] [PubMed]
- Xing, L.; Hu, P.; Liu, J.; Witek, K.; Zhou, S.; Xu, J.; Zhou, W.; Gao, L.; Huang, Z.; Zhang, R.; et al. Pm21 from Haynaldia villosa Encodes a CC-NBS-LRR Protein Conferring Powdery Mildew Resistance in Wheat. Mol. Plant 2018, 11, 874–878. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Lu, Y.; Pan, C.; Zhang, J.; Liu, W.; Yang, X.; Li, X.; Xi, Y.; Li, L. Characterization of a Novel Wheat-Agropyron cristatum 2P Disomic Addition Line with Powdery Mildew Resistance. Crop. Sci. 2016, 56, 2390–2400. [Google Scholar] [CrossRef]
- Wang, Z.L.; Li, M.X.; Xi, Y.J.; Liu, S.D. Appraisal of Resistance to Powdery Mildew and Molecular Marker Analysis of Pm4b of Wheat Varieties (Lines). Acta Agric. Boreal.-Sin. 2014, 29, 56–61. [Google Scholar] [CrossRef]
- Wang, Y.; Quan, W.; Peng, N.; Wang, C.; Yang, X.; Liu, X.; Zhang, H.; Chen, C.; Ji, W. Molecular cytogenetic identification of a wheat–Aegilops geniculata Roth 7Mg disomic addition line with powdery mildew resistance. Mol. Breed. 2016, 36. [Google Scholar] [CrossRef]
- Wang, L.-S.; Zhang, Y.-L.; Nan, G.-H. Molecular and Cytogenetic Identification of Triticum aestivum-Leymus racemosus Translocation Line T5AS-7LrL·7LrS. Acta Agron. Sin. 2018, 44, 1442–1447. [Google Scholar] [CrossRef]
- Du, W.; Wang, J.; Pang, Y.; Wu, J.; Zhao, J.; Liu, S.; Yang, Q.; Chen, X. Development and application of PCR markers specific to the 1Ns chromosome of Psathyrostachys huashanica Keng with leaf rust resistance. Euphytica 2014, 200, 207–220. [Google Scholar] [CrossRef]
- Zhao, J.X.; Wu, J.; Cheng, X.N.; Dong, J.; Chen, X.H.; Liu, S.H.; Du, W.L.; Pang, Y.Y.; Yang, Q.H.; Ji, W.Q. Agronomic and quality traits of a wheat-Psathyrostachys huashanica 1Ns disomic addition line. Acta Agron. Sin. 2010, 36, 1610–1614. [Google Scholar] [CrossRef]
Infection | Phenotype | Symptom |
---|---|---|
0 | Immune | No disease, no spots |
0 | Nearly Immune | Few dead leaf spots |
1 | High Resistance | Lesions less than 1 mm, thin and revealed green |
2 | Moderate Resistance | Lesions less than 2 mm, thick and not revealed green |
3 | Moderate Susceptibility | Lesions more than 1 mm, not contiguous, thick hyphae, with a large number of spores |
4 | Highly Susceptible | Lesions more than 1 mm and contiguous |
Resistance Type | Immune | High Resistance | Moderate Resistance | Moderate Susceptibility | Susceptible | Highly Susceptible |
---|---|---|---|---|---|---|
Range | DI = 0 | 0 < DI ≤ 5 | 5 < DI ≤ 15 | 15 < DI ≤ 25 | 25 < DI ≤ 50 | DI > 50 |
Line | Reaction | Line | Reaction |
---|---|---|---|
H1-8-1-1-2 | MR | H17-7-1-1-1 | MS |
H1-11-5-1-1 | MS | H17-7-1-1-8-2 | MS |
H2-4-18-7-1 | MS | H18-1-3-1-6-4 | HR |
H2-4-18-7-10 | MS | H19-1-1 | MS |
H2-7-8-7-7-2 | HS | H19-1-1-1 | MS |
H3-1-1-1 | MS | H20-1-1 | HS |
H3-2-1-3-5 | HS | H20-5-1-1-3-2 | MR |
H3-2-1-3-12 | MS | H24-3-1-5-19-1 | MS |
H3-2-2-1-1 | MS | H24-4-4-1-1-3 | MR |
H3-2-3-5-1 | MS | H26-1-1-1 | HS |
H3-3-6-3-7 | MS | H30-2-3-1-1 | HS |
H3-5-6-3-1-9 | MR | H30-4-4-1-6-4 | MS |
H3-7-4-2-1 | HS | H34-8-2-6-1 | MR |
H3-7-4-2-2 | MR | H42-3-1 | HS |
H5-5-4-2 | I | H62-1-1-1 | MR |
H5-9-1 | HS | H210-1-1 | MS |
H8-12-2 | MS | P. huashanica | I |
H9-46-1 | MS | 7182 | MS |
H13-4-1 | HS | Mingxian169 | HS |
Marker | Type | Primer (5′-3′) | Tm (°C) | Location |
---|---|---|---|---|
BE497584 | STS | F: CTGTTGCCAAGAGCATTGAA | 60 | 1AL 1BL 1DL |
R: GTCACAACATCATCAACCGC | ||||
BF202643 | STS | F: TTGCTGCTTGGACTTTCCTT | 60 | 1AS 1BS 1DS |
R: GAAGAACAGCAGGGCGTTAC | ||||
BG262410 | STS | F: TTCCACAAGAAAATGCCTCC | 60 | 1AS 1BS 1DS |
R: GCTCCCGTAGCTCATCAAAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, J.; Liu, Y.; Hou, C.; Li, J.; Wang, J.; Zhang, Q.; Yang, Q.; Chen, X.; Wu, J. A 1Ns Disomic Addition from Psathyrostachys Huashanica Keng Confers Resistance to Powdery Mildew in Wheat. Agronomy 2020, 10, 312. https://doi.org/10.3390/agronomy10020312
Han J, Liu Y, Hou C, Li J, Wang J, Zhang Q, Yang Q, Chen X, Wu J. A 1Ns Disomic Addition from Psathyrostachys Huashanica Keng Confers Resistance to Powdery Mildew in Wheat. Agronomy. 2020; 10(2):312. https://doi.org/10.3390/agronomy10020312
Chicago/Turabian StyleHan, Jing, Yuxiu Liu, Chenchen Hou, Jiachuang Li, Jinglin Wang, Qiaoying Zhang, Qunhui Yang, Xinhong Chen, and Jun Wu. 2020. "A 1Ns Disomic Addition from Psathyrostachys Huashanica Keng Confers Resistance to Powdery Mildew in Wheat" Agronomy 10, no. 2: 312. https://doi.org/10.3390/agronomy10020312