Next Article in Journal
Selection of New Late-Season Mandarin Cultivars Based on Sensory Changes and Consumer Acceptance after Fruit Cold Storage
Next Article in Special Issue
Spatial Proximity of ‘Ataulfo’ to ‘Haden’ Cultivar Increases Mango Yield and Decreases Incidence of Nubbins
Previous Article in Journal
Incidence and Ramifications of Armed Conflict in Countries with Major Desert Locust Breeding Areas
Previous Article in Special Issue
Developing Heterotic Groups for Successful Hybrid Breeding in Perennial Ryegrass
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 11
Issue 1
10.3390/agronomy11010115
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Stacking Resistance Genes in Multiparental Interspecific Potato Hybrids to Anticipate Late Blight Outbreaks

by
Elena V. Rogozina
1,
Mariya P. Beketova
2,
Oksana A. Muratova
2,
Mariya A. Kuznetsova
3 and
Emil E. Khavkin
2,*
1
N.I. Vavilov Institute of Plant Genetic Resources (VIR), St. Petersburg 190000, Russia
2
Institute of Agricultural Biotechnology, Moscow 127550, Russia
3
Institute of Phytopathology, Bol’shiye Vyazemy, Moscow 143050, Russia
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(1), 115; https://doi.org/10.3390/agronomy11010115
Submission received: 9 December 2020 / Revised: 6 January 2021 / Accepted: 7 January 2021 / Published: 8 January 2021
(This article belongs to the Special Issue Hybrid Breeding: Future Status and Future Prospects)
Browse Figures
Review Reports Versions Notes

Abstract

:
Stacking (pyramiding) several resistance genes of diverse race specificity in one and the same plant by hybridization provides for high and durable resistance to major diseases, such as potato late blight (LB), especially when breeders combine highly efficient genes for broad-spectrum resistance that are novel to the intruding pathogens. Our collection of potato hybrids manifesting long-lasting LB resistance comprises, as a whole, the germplasm of 26 or 22 Solanum species (as treated by Bukasov and Hawkes, respectively), with up to 8–9 species listed in the pedigree of an individual hybrid. This collection was screened with the markers of ten genes for race-specific resistance to Phytophthora infestans (Rpi genes) initially identified in S. demissum (R1, R2, R3a, R3b, and R8), S. bulbocastanum/S. stoloniferum (Rpi-blb1/ Rpi-sto1, Rpi-blb2, Rpi-blb3) and S. venturii (Rpi-vnt1). The hybrids comprised the markers for up to four-six Rpi genes per plant, and the number of markers was significantly related to LB resistance. Nevertheless, a considerable portion of resistance apparently depended on presently insufficiently characterized resistance genes. Bred from these multiparental hybrids, the advanced lines with the stacks of broad-specificity Rpi genes will help anticipate LB outbreaks caused by rapid pathogen evolution and the arrival of new pathogen strains.

Graphical Abstract

1. Introduction

Persistent and unrelenting, late blight (LB) of potato (Solanum tuberosum L.) caused by the oomycete Phytophthora infestans (Mont.) de Bary levies a permanent tax on potato growers: up to $10 billion is lost annually as direct crop losses and costs of chemical protection; the losses rise dramatically in the years of epidemic disease development [1,2,3]. The most economical and environment-friendly way to effectively contest and contain LB is to breed new cultivars with durable resistance. Durable resistance is empirically defined as resistance efficient over long periods of widespread crop cultivation under conditions favorable to disease, a compromise between plant defense capacity and the evolutionary potential of the pathogen [4]. Such resistance is reached by transferring the genes for resistance to P. infestans (Rpi genes) into cultivated potato [5]. Wild potatoes readily supply the necessary germplasm, and multiple Rpi genes have already been introgressed into marketable cultivars by the marker-assisted sexual and somatic hybridization or with the technologies of genetic engineering [3,5,6,7,8,9,10,11]. This resistance is gained slowly and with hard labor—and can be disappointedly lost, sometimes within few years, due to the rapid evolution of P. infestans genome and the arrival of new pathogen strains with novel repertoire of (a)virulence genes (Avr genes) [1,2,3,6,10,11].
An efficient strategy to overcome or at least alleviate this problem, when aiming at long-lasting and durable LB resistance, is to combine in one plant the Rpi genes that recognize several Avr genes. This strategy is called gene stacking, or pyramiding. Such gene pyramids will remain sustainable and effective as long as at least one Rpi component of the pyramid can recognize the corresponding Avr gene of the pathogen and trigger the defense response. Theoretically, a pyramid of four resistance genes would withstand pathogen invasion—on condition that both the resistance gene pyramids and the colonizing pathogen population(s) would concurrently fulfill several criteria. First, the stacked resistance genes should be highly effective and not leaky. Second, the best resistance genes and their combinations are those truly novel to the infecting pathogen population. Third, the pathogen genome should only rarely recombine, a criterion easily met only in a primarily asexual population. Fourth, the resistance will stay durable at a low level of gene flow due to pathogen migration [1,6,12,13,14,15,16].
In the case of potato, the most evident way to achieve long-lasting resistance against P. infestans is to recruit new Rpi genes into breeding schemes and to stack as many Rpi genes as possible into a single cultivar. The genetic diversity of cultivated potatoes that may provide such resources has been substantially pauperized in the process of conventional breeding [6,9,10,11]. Therefore within the last two decades, combining multiple resistance genes into a single plant genotype has heavily relied on the identification and cloning of Rpi genes of interest from the vast resource offered by wild Solanum species. Particularly inviting sources of germplasm enhancement are insufficiently explored South American wild potatoes, which have not been conspicuously involved in practical breeding, and the species that were never before reported to resist LB [7,9,10,11,17,18,19,20].
In the past centuries preceding the informed breeding, many cultivated genotypes in Mexico and South America had already harbored a significant contribution of wild germplasm [9]. Current germplasm enrichment by identifying and introgressing new Rpi genes and new alleles of already known Rpi genes must also include careful study of the gene pools presently used by breeders. Among other things, such exploration would lower the chance to undermine the efforts of breeders if they deploy Rpi genes that have already been broken by local pathogen strains [3,6,9,10,12,13,14,15,16].
The search for new Rpi genes and new alleles of previously characterized Rpi genes (allele mining) brings us to the mission of a wider span: identification of the full complement of Solanum genes contributing to the resistance to P. infestans [7,10,17,19,20,21]. For more than three decades, this field was successfully searched using various DNA markers [5,7,9,21,22,23]. Later, over 20 Rpi genes were identified and cloned from wild Solanum species. Recent breakthrough technologies of resistance gene enrichment sequencing (RenSeq) and the diagnostic version of this technology (dRenSeq) have opened new vistas to comprehensive exploration of Solanum Rpi genes and their introduction to advanced breeding schemes [24,25]; in addition, these technologies facilitate the wide-ranging characterization of allelic diversity enabling the evolutionary analysis of Rpi genes and prediction of new sources of these genes in genetic collections.
The multiparental potato hybrids described in this paper were obtained by remote crosses and combine genetic material from 20 wild and two cultivated Solanum species as treated by Hawkes [26], with up to 8–9 species reported per single hybrid pedigree. For over a decade, many of these hybrids and derived advanced lines have manifested high LB resistance. They are prospective donors containing pyramids of broad specificity genes that nowadays are readily involved in breeding, such as Rpi-blb1 = Rpi-sto1, Rpi-blb2, Rpi-vnt1, R2 = Rpi-blb3, etc. An important advantage of these breeding donors is that the introgressed Rpi genes maintain the genetic environment inherited from parental forms, including race-nonspecific resistance genes [5,18]. Rather than single genes, the remote crosses would transfer whole clusters of genes combining the Rpi genes of diverse race specificity and even the genes for resistance concurrently to several pests. These hybrid characteristics would ensure the stability of future cultivars and slow down the onset of more adapted pathogen forms in potato stands [5,17,18]. Here we present the evidence obtained with the markers of ten Rpi genes characterized in more detail. Some data presented below have been reported earlier [27,28] at the Euroblight workshops (https://agro.au.dk/forskning/internationale-platforme/euroblight/).

2. Materials & Methods

2.1. Plant Material

The plant material explored in this study is predominantly represented by multiparental interspecific hybrids. The pedigrees of these hybrids combine from two to nine species of Solanum L., section Petota Dumort. (Table 1). The sample under study includes ten hybrids with high field resistance to LB bred by I.M. Yashina at the Russian Potato Research Center (Korenevo, Moscow region), hereinafter Yashina’s hybrids [29], by crossing demissoid potato varieties and/or breeding lines, which were backcrosses comprising the genetic material of S. andigenum Juz. & Buk. (=S. tuberosum ssp. andigena Hawkes), S. chacoense Bitt. and S. chilotanum (Buk. & Lechn.) Hawkes (=S. tuberosum ssp. tuberosum L.). Hereinafter, the names of Solanum species in the pedigrees of hybrids (Table 1) are listed according to Hawkes [26] and those of cultivars follow the information provided by breeders. Ten hybrids originally obtained by V.A. Kolobaev at the Institute of Plant Protection (Pushkin, St. Petersburg), hereinafter Kolobaev’s hybrids [30], were bred using the accessions of wild Solanum species from the VIR collection, which were previously recognized as the sources of high LB resistance: S. berthaultii Hawkes, S. pinnatisectum Dunal., S. polytrichon Rydb., S. simplicifolium Bitt., and S. verrucosum Schlechtd. Thirty seven hybrids produced by E.V. Rogozina at VIR, hereinafter Rogozina’s hybrids [30,31], represent two-species hybrids and backcrosses with the participation of South American species S. alandiae Cárd. and S. okadae Hawkes & Hjert., which have not been previously involved in potato breeding. They also include the hybrids obtained by crossing potato cultivars and breeding lines comprising the genetic material of cultivated and wild potato species: S. andigenum (=S. tuberosum ssp andigena), S. leptostigma Juz. (=S. tuberosum ssp. tuberosum L.), S. phureja Juz. & Buk., S. rybinii Juz. & Buk. (=S. phureja), S. demissum Lindl., S. stoloniferum Schlechtd. & Bché, S. vallis-mexici Juz., and S. vernei Bitt. & Wittm. It is significant to emphasize that the development of these hybrids involved many South American species rarely used by the Russian breeders. Many of these hybrids bred over several decades are particularly important as they possibly preserved the Rpi alleles that could have been lost in the world collections of wild Solanum species due to genetic drift and loss of individual accessions.
In addition to all these hybrids, our study also included several registered varieties, some of which come from complex interspecific hybrids: Alouette (https://varieties.ahdb.org.uk/varieties/view/Alouette; [25]), Sarpo Mira and Sarpo Axona (http://sarpo.co.uk/portfolio/; https://pomidom.ru/sarpo-mira-potatoes/), Mastenbroeck-Black potato differential set plants R5, R8 and R9 [34] and others. These varieties were used to verify SCAR markers of the Rpi genes; besides, they also served as positive and negative controls for PCR screening. Other cultivars, some of which are also interspecific hybrids, were employed as controls when assessing plant LB resistance (Table 2).
As a whole, this collection (Table 1 and Table 2) contains potato hybrids with their pedigrees representing nine series of Solanum L. section Petota Dumort. and listing 22 wild and four cultivated Solanum species as treated by Bukasov [32], which correspond to 20 wild and two cultivated Solanum species as treated by Hawkes [26] and 15 wild and one cultivated species as treated by Spooner [33]. The pedigrees of some individuals include as many as nine Solanum species. To verify SCAR markers of Rpi genes we also employed the accessions of wild Solanum species in the VIR collection.

2.2. Resistance to Pathogens

Late blight resistance of leaves was evaluated in long-term field trials under conditions of natural infestation in two European regions of the Russian Federation, i.e., the Northwest (VIR, Pushkin, St. Petersburg; 59.42′ E, 30.25′ N) and the Central (Institute of Phytopathology, Ramenskaya Gorka, Moscow region; 55.63′ E, 36.95′ N).
In the Northwest region, the growing seasons during the period of field trials were different: in 2016 and 2017, abundant precipitation and cool temperatures were favorable for the early manifestation and development of LB; in 2014, 2019 and 2020, moderate rainfall and unstable temperatures delayed the appearance of disease. In the Central region, dry weather early in the 2014 growing season delayed the LB progress; however, heavy rainfall and a drop in temperature early in August provided extremely favorable conditions for the LB development on potato haulms and later, damage to tubers. Through the following six years (2015–2020), the weather conditions were favorable for a fairly early (the middle of June) LB development, and later LB epiphytoty. Within this period, the air temperatures in June and the first half of July were below the long-term values. In addition, significant precipitation was recorded annually.
Pathogen population at two sites was represented by numerous diverse and highly aggressive complex races of P. infestans comprising seven to eleven virulence genes [35].
The field assessment of the partial LB resistance of potato plants was carried out every 10–12 days, and these data were used to calculate the area under the disease progress curve (AUDPC) in the course of the growth season and the corresponding yield losses caused by the early destruction of leaves (%). To evaluate the LB resistance level, the calculated yield losses were converted into 1–9-point scores, where 9 points correspond to the highest resistance level [35].
Resistance to LB in the laboratory tests was evaluated with detached leaves according to the Eucablight protocol (www.euroblight.net/). Detached leaves of plants grown in a greenhouse were infected with a highly virulent and aggressive isolate of P. infestans N161 (race 1.2.3.4.5.6.7.8.9.10.11, mating type A1) isolated in the Moscow region (the collection of the Institute of Phytopathology), using cv. Santé as a reference [35]. The aggressiveness of N161 in the Lapwood test [36] with Santé tubers exceeded the indices registered with all isolates collected in the potato stands under study. The experimental data for LB resistance were transformed to 1–9-point scores.
The experimental data were processed by the methods of nonparametric statistics (Kruskal-Wallis test of variance, Spearman’s rank correlation and cluster analysis) using the STATISTICA Advanced package (StatSoft Russia; http://statsoft.ru/products/).

2.3. Molecular and Bioinformatics Methods

Genomic DNA from young plant leaves was isolated with the AxyPrep Multisource Genomic DNA Miniprep Kit (Axygen Biosciences, Union City, CA, USA) or DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). DNA concentration was measured with an UV/Vis NanoPhotometer P300 (IMPLEN, München, Germany). Oligonucleotide primers were designed using the programs BLAST 2.0 (http://blast.ncbi.nlm.nih.gov/Blast.cgi.), SeqMan, Lasergene 7.0 (http://www.dnastar.com), Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html) and synthesized by Syntol, Moscow (www.syntol.ru). Primer melting temperatures were adjusted empirically. DNA amplification was run in a MJ PTC-200 thermocycler (Bio-Rad, Hercules, CA, USA). The PCR mix contained 1 μL of 10× PCR buffer Mg2+ Plus for Taq DNA polymerase (Fermentas, St. Leon-Rot, Germany), 1 μL of dNTP mix (2.5 mM of each), 1 μL each of forward and reverse primers (1 μM), 5 U of Taq DNA polymerase, 30–60 ng/μL of genomic DNA, and sterile deionized water to 10 ul. PCR products were separated by electrophoresis in 1% (w/v) agarose in 1× TAE buffer for 40 min at 6 V/cm and visualized under UV after staining with ethidium bromide using a Gel Logic 100 Imaging System (Eastman Kodak Company, Rochester, NY, USA). Following electrophoretic separation, PCR-amplified DNA fragments were purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The fragments were cloned using pGEM-T Easy Vector System I (Promega, Madison, WI, USA) and sequenced with nucleic acid analyzers ABI PRISM 3130xl (Applied Biosystems, Foster City, CA, USA) or Nanophor 05 (Institute for Analytical Instrumentation, St. Petersburg, Russia). Sequenced fragments were assembled using SeqMan package, Lasergene 7.0. BLAST 2.0. and SeqMan, Lasergene 7.0 programs were used to mine genomic databases for Rpi genes and their homologues, and their phylogenetic analysis was performed with the MEGA6 package [37].

2.4. SCAR Markers for Resistance Genes

All SCAR markers (Table 3, Figure 1) were derived from the sequences of already well-characterized Rpi prototype genes deposited in the NCBI Genbank (https://www.ncbi.nlm.nih. gov/nucleotide/). Most markers were already reported elsewhere, and some were designed or modified following multiple alignment of the prototype gene sequences, their structural homologues and anonymous genome fragments lifted from the NCBI Genbank using BLAST and Vector NTI Suite 8 package (Invitrogen, Carlsbad, CA, USA). In the case of R2/Rpi-blb3 and Rpi-blb1/Rpi-sto1, more than one marker was used to recognize the particular gene. Wherever possible, marker specificity was verified against wild species that were the initial sources of the prototype genes in the NCBI Genbank, including amplification, cloning and sequencing the marker amplicons and phylogenetic analysis of the marker sequences. To this end, multiple alignments of nucleotide sequences assembled using a combination of the Martinez and Needleman-Wunsch algorithms were performed with SeqMan, Lasergene 7.0 Sequences. The phylogenetic analysis was performed with MEGA6 (https://www.megasoftware.net/).

3. Results & Discussion

3.1. LB Resistance of the Multiparental Potato Hybrids

In the field experiments, 50 hybrids and cultivars were assessed for their LB resistance in the span of seven years (2014–2020). Ten Yashina’s hybrids, ten Kolobaev’s hybrids and 23 Rogozina’s hybrids were evaluated together with seven standard cultivars. For the sake of comparison, another seven cultivars (Alouette, Atzimba, Elizaveta, Nayada, Priekul’skij rannij, Svitanok kievskij and Zagadka Pitera) were tested in field trials for four years within the 2014–2020 period. The cvs. Alouette (8–9), Sarpo Mira (8) and Yashina’s hybrid 2372-60 (8 points of resistance) were highly resistant to LB; Rogozina’s hybrids 24-1, 24-2 and 123 (128-6) (6–8), 97-155-1, 160-1 and 190-4 (7–8), 139 (4-1- 2012) (7–9), Kolobaev’s hybrid 111 (38 KVA) (6.5–8), Yashina’s hybrids 2585-67 and 97.1.17 (both 7 points) were resistant (Table 2). Resistance indices of hybrids 2585-67, 2372-60, 97.1.17, 13 /11-09, 111 (38 KVA), 24-1, 24-2, 139 (4-1-2012) and cvs. Alouette and Sarpo Mira significantly differ from those of LB-susceptible cvs. Alpha and Bintje (3–4 points) by Kruskal-Wallis criterion (H = 270.01, p = 0.001). Resistance indices of cvs. Alouette and Sarpo Mira significantly differ from those of cvs. Priekul’skij rannij, Elizaveta, Eersteling, Gloria, Robijn and hybrids 2585-70, 97.12.18, 97.13-9, 25-1-2007, 25-2-2007, 97-162-2 and 134-3-2006 (3–5 points). In cvs. Escort, Atzimba, Nayada, Svitanok kievskij, Zagadka Pitera and 27 hybrids, the indices of field resistance varied from 5 to 7 points depending on the year of trial. These cultivars and hybrids manifested moderate LB resistance in the field trials as compared to resistant and susceptible potato genotypes.
Ten Yashina’s hybrids, ten Kolobaev’s hybrids, 24 Rogozina’s hybrids and 16 cultivars were evaluated in laboratory tests with detached leaves. Resistant (7–8 points) were hybrids 24-1 and 24-2 and cvs. Alouette, Sarpo Axona and Sarpo Mira. Susceptible (2–3 points) were cvs. Alpha, Bintje, Desiree, Eersteling and hybrids 97.13-9, 2522-173, 134-3-2006 (Table 2). The data from field trials and laboratory assessments run in parallel for many years are in good agreement (Spearman’s correlation coefficient r = 0.75 at p < 0.05).
Based on the evidence from long-term field trials and laboratory assessment, 55 hybrids and cultivars were grouped in the following way (Figure 2 and Figure 3). Full coupling grouping using Euclidean distance and k-means clustering gave similar results. By the hierarchical classification, the sample of 55 hybrids and cultivars is separated into three groups with a similarity level >0.4. The k-means method also formed three disjoint subsets: each cluster consists of similar objects, and objects from different clusters differ significantly from each other. Cluster 1 comprises potato genotypes, which are moderately resistant to LB in the field trials and moderately susceptible in laboratory tests: cvs Nayada and Zagadka Pitera and hybrids 14/8-09; 18/40-2000; 10/5-09; 13/11-09; 16/27-09; 25-1-2007; 134-6-2006; 34-5-2003; 117-2; 128-05-03; 135-1-2006; 135-2-2006; 93-5-30; 99-4-1; 118-6-2011; 2584-7; 97.1.17. Potato cultivars and hybrids resistant to LB are pooled into cluster 2, which includes 16 genotypes: cvs. Alouette, Sarpo Mira and Escort, hybrids 11/06-09, 12/1-09, 113 (50/1 KVA), 111 (38 KVA), 134-2-2006, 118-5-2011, 128-6, 139 (4-1-2012), 24-1, 24-2, 2585-67, 2585-80, 2359-13. Susceptible genotypes are combined into cluster 3, which includes cultivars Alpha, Bintje, Eersteling, Elizaveta, Gloria, Priekul’skij rannij, Robijn, Svitanok kievskij, and hybrids 2585-70, 97.12.18, 97.13- 9, 2522-173, 25-2-2007 and 134-3-2006 (Table 2).

3.2. Rpi Genes in the Multiparental Potato Hybrids

As expected, the hybrids and standard cultivars with Demissa species in their pedigrees, including cvs Atzimba [46] and both Sarpos (https://pomidom.ru/sarpo-mira-potatoes/) contain as many as three to five markers of genes Rpi-R1—Rpi-R8 (Table 4). However, several demissoid hybrids, such as 2585-80, 2584-7, 97.1.17, 12/1-09, 97-153-2, and 99-4-1 seem to comprise only one or two of Rpi-R1—Rpi-R8 genes. Potato differentials R5, R8 и R9 each harbored four to five markers of these genes. The Rpi-R8 gene is expected in differentials R8 and R9 [38], but not in R5.
To recognize the Rpi-R2/Rpi-blb3 genes, we used three SCAR markers corresponding to different regions of this gene (Figure 1, Table 3). Marker Rpi-R2-686 covers about half of the Rpi-R2-1137 sequence, and the evidence for these two markers matches in most cases (Table 4). The third marker Rpi-blb3-305 usually follows Rpi-R2-1137. The Rpi-R2/Rpi-blb3 family of genes in the cluster on chromosome 4 has been reported in many Mexican species [20,40,47,48], and to distinguish the input of particular germplasms in the interspecific hybrids should become the goal of future studies. It is difficult to explain the presence of Rpi-R2 markers in S. chacoense × S. okadae hybrid (135-3-2005)—especially when other segregants of this combination are free of these markers.
The marker Rpi-R3a was previously reported in several Demissa and Longipedicellata species and also in S. microdontum [21]. The functional Rpi-R3a analogues were found in several series of Petota species with the effectoromics technology [47], whereas the complete Rpi-R3a cdc was cloned from S. stoloniferum (Genbank accession HQ731037). Two genes, Rpi-R3a and Rpi-R3b, are located in one cluster on chromosome 11, and their markers go together in most though not all hybrids (Table 4).
Using the effectoromics technology to mine cv. Sarpo Mira, Rietman et al. [40] reported five Rpi genes: Rpi-3a, Rpi-3b, Rpi-R4, Rpi-Smira1 (Rpi-R9) and Rpi-Smira2 (Rpi-R8). Our marker analysis of this cultivar confirmed the presence of genes Rpi-3a, Rpi-3b, and Rpi-R8. All these genes were most probably transferred from S. demissum and S. stoloniferum (https://pomidom.ru/sarpo-mira-potatoes/).
Now, let us turn to one more gene assayed with several SCAR markers: Rpi-blb1/Rpi-sto1. Two markers, Rpi-blb1-821 и Rpi-sto1-890, which cover different regions of the gene sequence (Figure 1), perfectly concurred in a range of Bulbocastana and Longipedicellata accessions [49] and now in most hybrids containing the genetic material of these species (Table 4). In addition to the predictable presence of the markers Rpi-blb1-821 and Rpi-sto1-890 in such hybrids, these markers were unexpectedly found in the Atzimba × S. alandiae hybrid 39-1-2005. Only single marker Rpi-blb1-821 was found in cvs Priekulskiy rannij and Svitanok kievskij. Previously this marker was also reported in a highly resistant accession VIR5399 of S. microdontum [49].The short marker Rpi-blb1-226 usually accompanied two longer markers of the gene; however, Rpi-blb1-226 alone was found in four genotypes that contained Longipedicellata genetic material (113 (50/1 KVA), 118(118-5-2001), 190-4 and cv. Elizaveta), whereas the hybrids 134-2-2006, 135-2-2006, 90-6-2, 90-6-5, 99-6-6 and Atzimba also containing this marker are free from the stoloniferum germplasm as the most probable source of this gene.
Our collection lacks the hybrids with the genetic material of S. venturii. However, the Rpi-vnt1 analogues and pseudogenes are widely distributed in South American Tuberosa species, including S. microdontum and S. okadae [45]. Indeed, we registered one allele of this gene, Rpi-vnt1-3, in two thirds of hybrids containing the germplasm of S. alandiae and S. microdontum: the comparison of this allele sequence to that of the prototype Rpi-vnt1 gene indicated 92–98% identity [50]. In addition, the S. alandiae genome comprised the structural homologues of R2/Rpi-blb3, R8, R9a, Rpi-vnt1 and Rpi-blb2; respective homologues were 94–99, 94–99, 86–89, and 91% identical with the prototype genes [50]. It is also relevant to mention that the complete Rpi-vnt1-like sequence was cloned from S. microdontum ssp. gigantophyllum (Genbank accession GU338312). We failed to find the marker Rpi-vnt1.3-612 in all hybrids comprising S. okadae genetic material (Table. 4), whereas this marker was found in the S. okadae accession k-25397-1 different from the accession к-20921 used as the male parent of the hybrids [50].
In each group of hybrids of similar descent created by Yashina and Kolobaev and hybrids with the participation of S. alandiae bred by Rogozina, we find a highly consistent inheritance of markers. Thus, the Yashina’s hybrids 2585-67, 2585-70, 2585-80, 2359-13, 2584-7 and 97.13-9 (descended from cv. Nikulinsky as a female parent), seem to comprise the Rpi-R2/Rpi-blb3, Rpi-R3a and Rpi-R3b genes. The Kolobaev’s hybrids 10/5-09 and 11/6-09 (descended from cv. Zagadka Peter as a female parent) inherited the Rpi-R2/Rpi-blb3, Rpi-R3a, Rpi-R3b, Rpi-R8 and Rpi-blb2 genes. In Rogozina’s hybrids 25-1-2007 and 25-2-2007, the Rpi-R1 and Rpi-R3b genes were inherited from the female parent cv. Elizaveta, whereas the Rpi-blb2 gene was transferred from the paternal form—hybrid 24-1. In most hybrids based on S. alandiae, the first generation from crosses and backcrosses inherited the marker of Rpi-vnt1.
Of special interest are resistant and moderately resistant hybrids (6 and more points) that nonetheless contain only one or two markers of Rpi genes. Such discrepancy is especially surprising as many of these hybrids seem to include demissum and/or stoloniferum germplasm: 2585-80, 2584-7, 97.1.17, 12/1-09, 160-17, 106 (171-3), 97-153-2, 99-4-1, and 53 (34-5-2003) (Table 2 and Table 4). Presumably, these hybrids comprise as yet unidentified Rpi genes or new alleles of already known Rpi genes [7,9] that are not recognized with our markers. Two Rpi genes (Rpi1 and Rpi2) on chromosome 7 of S. pinnatisectum [20,51] may exemplify such case in hybrid 12/1-09. Three hybrids with low numbers of markers: 97-162-2, 34-6 and 53 (34-5-2003) reportedly include genetic material of S. microdontum insufficiently researched by molecular methods. SCAR marker analysis of the South American species S. alandiae and S. okadae accessions in the VIR collection also revealed several structural homologues of already known Rpi-R2, Rpi-R8 and Rpi-blb2 genes of the Mexican species S. demissum and S. bulbocastanum [50].

3.3. LB Resistance is Enhanced by Pyramiding Rpi Genes

The numbers of Rpi genes combined in particular potato hybrids are clearly in line with plant LB resistance in the field experiments. We compared LB resistance in field trials in cultivars and hybrids in two contrasting subsets of potato genotypes: those containing only one Rpi gene and those with five genes. The former subset of nine genotypes comprises six cultivars (Desiree, Bintje, Alpha, Negr, Eersteling, and Robijn) and three hybrids (134-3-2006, 2585-80, and 97.1.17), wherein only one Rpi gene, either Rpi-R2/Rpi-blb3 or Rpi-R8, was found (Table 4). In the latter subset of 18 genotypes five-six genes were recognized (Table 4 and Table 5). Two subsets significantly differ in their LB resistance in field trials by the Mann-Whitney criterion: Uobserved = 33 < Ucritical = 42 at p < 0.05. The Spearman’ correlation coefficient (Robserved = 0.514 > Rcritical = 0.382 at p < 0.05) is another proof of statistically significant relationship between the number of Rpi genes and LB resistance in these subsets of potato cultivars and hybrids.
Mundt [14] demonstrated that under optimal conditions, a stack of four efficient resistance genes would provide a durable protection against the pathogen. We therefore focused on the genotypes that comprised four and more Rpi genes per plant (Table 5). Over 80% of these hybrids, together with the cultivars derived from multiparental hybrids, manifest significant and long-lasting field resistance to LB (6 points and higher). The predominant resistance genes of these genotypes are demissoid Rpi-R3b (with the frequency of 0.79), Rpi-R2/Rpi-blb3 (0.74), Rpi-R8 (0.66), and Rpi-R3a (0.59); the frequencies of other genes are 0.41-0.44 (Table 5).

4. Conclusions

High and long-lasting LB resistance is a major prerequisite for sustainable potato production. In this project, a considerable collection of potato interspecific hybrids and standard cultivars was assayed with SCAR markers for ten Rpi genes, and plant LB resistance was evaluated in the field trials and laboratory tests with detached leaves. These hybrids combine several Rpi genes that are currently in high demand with potato breeders, such as Rpi-R2/Rpi-blb3, Rpi-blb1/Rpi-sto1, Rpi-blb2, and Rpi-vnt1. The level of LB resistance manifested by these hybrids is significantly related to the number of Rpi genes stacked in a single hybrid. This evidence seems to support the concept of pyramiding Rpi genes for durable LB resistance. However, when the patterns of gene stacking are examined with SCAR markers, it seems proper to focus on several caveats.
First, a considerable portion of resistance manifested by the investigated hybrids was not associated with the markers used in this study, and we believe that such resistance depended on some new or insufficiently characterized Rpi genes, which are not recognized by the markers employed to screen the hybrids. To exemplify such possibility, S. chacoense germplasm is found in many hybrids examined in the present study (Table 2 and Table 4), and some of their LB resistance could be related to the Rpi-chc1 gene [7]. Indeed, screening such hybrids with the marker for this gene developed in our laboratory produced the positive signal in hybrids 2372-60, 2522-173 and 2584-7 but not in 2359-13. Among five S. okadae k-20921 × S. chacoense k-19759 hybrids, only 135-3-2005 was positive, other four segregants of this hybrid and the accession S. chacoense k-19759 itself responded negatively (M. Beketova, personal communication). Another possibility would link such resistance to other defense pathways, including non-specific tolerance.
Second, in such a complex assortment of genetic material, the gene stacks may comprise several alleles of one and the same gene introgressed from different Solanum species, e.g., S. chacoense, S. demissum, S. pinnatisectum, S. phureja, S. stoloniferum, etc. [7,20,47,51,52]. It is not always possible to distinguish such alleles. At least, in this study, by using the markers that reliably discriminate between demissum and stoloniferum alleles of Rpi-R1 [53], we demonstrated that nine hybrids combining demissum and stoloniferum germplasms comprised only the former allele of Rpi-R1 and were devoid of the latter.
Third, the SCAR markers employed in this study do not stretch over the full-size sequences of candidate genes, especially in the case of short markers Rpi-R3b-378 and Rpi-blb3-305. The changes in the candidate gene under study beyond the region covered by the particular marker would render this gene inactive. Perhaps, the presence of pseudogenes would explain the occurence of markers of Rpi genes in the standard cultivars believed to be devoid of such genes: Rpi-R1 in cv. Magellanes, Rpi-R2 in cv. Robijn, Rpi-R8 in cvs Alpha, Desiree, and Eersteling, Rpi-blb2 in cvs Magellanes and Early Rose, and Rpi-vnt1 in cvs Bintje and Early Rose (Table 4). Similarly, when the presence of markers in the hybrids is not supported by their pedigrees, such discrepancy can be explained by the presence of inactive homologues. In support of these suggestions, the BLAST search recognized the homologues of all these genes except Rpi-vnt1 in a true S. tuberosum cv. Solyntus [54] (the corresponding Genbank accessions CP055238, CP055237, CP055242, CP055241, and CP055239).
Fourth, even when the complete sequences of candidate genes are assessed (e.g., with the dRenSeq technology [25]), the proof for their functionality must be obtained by independent methods, such as effectoromics [40,47,55].
There are two ways to combine a sufficient number of Rpi genes of broad specificity towards diverse pathogen races and in this way to develop the basis of long-lasting and durable LB resistance: to stack several efficient genes in a single potato genotype or to produce a mosaic of Rpi genes in a potato stand combining several cultivars. When bred from the multiparental hybrids, the advanced lines with the stacks of broad-specificity Rpi genes will become prospective breeding donors immediately at hand when new pathogen strains arrive with Avr genes virulent to existing potato cultivars [1,13,14]. These breeding strategies usually aim at supporting and expanding the genetic diversity in potato stands. Developing such sources of resistance to combat future pathotypes is called pre-emptive, or anticipatory breeding [56,57]. In the case of P. infestans, with its extremely plastic genome [58] and rapid changes in the repertoire of Avr genes [1,59], the advanced lines bred from multiparental hybrids would help withstand LB outbreaks caused by rapid pathogen evolution and invasion of new pathotypes.
By their productivity (0.89–1.25 kg of tubers per plant), most tested hybrids were comparable to cv. Sarpo Mira, the international standard of LB resistance, and considerably overtook the susceptible standard cv. Bintje. However, within the selection of highly resistant genotypes with 4+ markers of Rpi genes per plant (Table 5), it is difficult to relate tuber yield immediately to plant resistance and the number of resistance genes.
In many aspects, the success of pyramiding Rpi genes depends on the breeder’s appraisal of the agricultural ecosystem as a whole [60] and the knowledge of potato Rpi genes and Avr genes of P. infestans in the particular potato stands. In the latter case, rapid and efficient assessment of Rpi and Avr gene profiles with dRenSeq and PenSeq technologies [25,59] seems most hopeful as regards the prediction of crop losses and evaluation of breeders’ efforts.

Author Contributions

E.E.K., M.A.K. and E.V.R. conceived and designed the research. E.V.R. bred most hybrids. M.A.K. and E.V.R. maintained hybrid collections and evaluated LB resistance. M.P.B., O.A.M. and E.E.K. ran the marker and bioinformatics analysis. E.E.K. and E.V.R. wrote and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the Russian Foundation for Basic Research (projects Nos. 16-04-00098, 18-16-00138 and KO 20-516-10001).

Acknowledgments

The authors thank the Center for Collective Use of Equipment “Biotechnology” at the Institute of Agricultural Biotechnology, Moscow, for sequencing Solanum genome fragments and the Center for Collective Use of the State Collection of Plant Pathogenic Microorganisms, Indicator Plants and Differential Cultivars at the Institute of Phytopathology for making available the equipment for phytopathological assessments.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cooke, D.E.L.; Cano, L.M.; Raffaele, S.; Bain, R.A.; Cooke, L.R.; Etherington, G.J.; Deahl, K.L.; Farrer, R.A.; Gilroy, E.M.; Goss, E.M.; et al. Genome analyses of an aggressive and invasive lineage of the irish potato famine pathogen. PLoS Pathog. 2012, 8, e1002940. [Google Scholar] [CrossRef]
  2. Fry, W.E. Phytophthora infestans: New tools (and old ones) lead to new understanding and precision management. Ann. Rev. Phytopathol. 2016, 54, 529–547. [Google Scholar] [CrossRef]
  3. Haverkort, A.J.; Boonekamp, P.M.; Hutten, R.; Jacobsen, E.; Lotz, L.A.P.; Kessel, G.J.T.; Vossen, J.H.; Visser, R.G.F. Durable late blight resistance in potato through dynamic varieties obtained by cisgenesis: Scientific and societal advances in the durph project. Potato Res. 2016, 59, 35–66. [Google Scholar] [CrossRef] [Green Version]
  4. Brown, J.K.M. Durable resistance of crops to disease: A darwinian perspective. Ann. Rev. Phytopathol. 2015, 53, 513–539. [Google Scholar] [CrossRef]
  5. Gebhardt, C.; Bellin, D.; Henselewski, H.; Lehmann, W.; Schwarzfischer, J.; Valkonen, J.P.T. Marker-assisted combination of major genes for pathogen resistance in potato. Theor. Appl. Genet. 2006, 112, 1458–1464. [Google Scholar] [CrossRef] [PubMed]
  6. Bradshaw, J.E. Review and analysis of limitations in ways to improve conventional potato breeding. Potato Res. 2017, 60, 171–193. [Google Scholar] [CrossRef]
  7. Vossen, J.H.; Jo, K.-R.; Vosman, B. Mining the genus Solanum for increasing disease resistance. In Genomics of Plant Genetic Resources; Tuberosa, R., Graner, A., Frison, E., Eds.; Springer: Dordrecht, The Netherlands, 2014; Volume 2, pp. 27–46. [Google Scholar]
  8. Haesaert, G.; Vossen, J.H.; Custers, R.; De Loose, M.; Haverkort, A.; Heremans, B.; Hutten, R.; Kessel, G.; Landschoot, S.; Van Droogenbroeck, B.; et al. Transformation of the potato variety Desiree with single or multiple resistance genes increases resistance to late blight under field conditions. Crop. Prot. 2015, 77, 163–175. [Google Scholar] [CrossRef]
  9. Hardigan, M.A.; Laimbeer, F.P.E.; Newton, L.; Crisovan, E.; Hamilton, J.P.; Vaillancourt, B.; Wiegert-Rininger, K.; Wood, J.C.; Douches, D.S.; Farré, E.M.; et al. Genome diversity of tuber-bearing Solanum uncovers complex evolutionary history and targets of domestication in the cultivated potato. Proc. Natl. Acad. Sci. USA 2017, 114, E9999–E10008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Bethke, P.C.; Halterman, D.; Jansky, S. Potato germplasm enhancement enters the genomics era. Agronomy 2019, 9, 575. [Google Scholar] [CrossRef] [Green Version]
  11. Gaiero, P.; Speranza, P.R.; De Jong, H. Introgressive hybridization in potato revealed by novel cytogenetic and genomic technologies. Am. J. Potato Res. 2018, 95, 607–621. [Google Scholar] [CrossRef] [Green Version]
  12. McDonald, B.A.; Linde, C. Pathogen population genetics, Evolutionary potential, and durable resistance. Ann. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Mundt, C.C. Durable resistance: A key to sustainable management of pathogens and pests. Infect. Genet. Evol. 2014, 27, 446–455. [Google Scholar] [CrossRef] [PubMed]
  14. Mundt, C.C. Pyramiding for resistance durability: theory and practice. Phytopathology 2018, 108, 792–802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Stam, R.; McDonald, B.A. When resistance gene pyramids are not durable-the role of pathogen diversity. Mol. Plant Pathol. 2018, 19, 521–524. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Van Wersch, S.; Li, X. Stronger when together: Clustering of plant nlr disease resistance genes. Trends Plant Sci. 2019, 24, 688–699. [Google Scholar] [CrossRef]
  17. Halterman, D.A.; Jansky, S.H.; Spooner, D.M. Discovery of new sources of disease resistance using wild potato germplasm. Am. J. Potato Res. 2017, 94, 211–250. [Google Scholar] [CrossRef]
  18. Rogozina, E.V.; Khavkin, E.E. Interspecific potato hybrids as donors of durable resistance to pathogens. Vavilov J. Genet. Breed. 2017, 21, 30–41. [Google Scholar] [CrossRef] [Green Version]
  19. Li, Y.; Colleoni, C.; Zhang, J.; Liang, Q.; Hu, Y.; Ruess, H.; Simon, R.; Liu, Y.; Liu, H.; Yu, G.; et al. Genomic analyses yield markers for identifying agronomically important genes in potato. Mol. Plant 2018, 11, 473–484. [Google Scholar] [CrossRef] [Green Version]
  20. Karki, H.S.; Jansky, S.H.; Halterman, D.A. Screening of wild potatoes identifies new sources of late blight resistance. Plant Dis. 2020. [Google Scholar] [CrossRef]
  21. Sokolova, E.; Pankin, A.; Beketova, M.; Kuznetsova, M.; Spiglazova, S.; Rogozina, E.V.; Yashina, I.; Khavkin, E. SCAR markers of the R-genes and germplasm of wild Solanum species for breeding late blight-resistant potato cultivars. Plant Genet. Res. 2011, 9, 309–312. [Google Scholar] [CrossRef]
  22. Tiwari, J.K.; Siddappa, S.; Singh, B.P.; Kaushik, S.K.; Chakrabarti, S.K.; Bhardwaj, V.; Chandel, P. Molecular markers for late blight resistance breeding of potato: An update. Plant Breed. 2013, 132, 237–245. [Google Scholar] [CrossRef]
  23. Ramakrishnan, A.P.; Ritland, C.E.; Sevillano, R.H.B.; Riseman, A. Review of potato molecular markers to enhance trait selection. Am. J. Potato Res. 2015, 92, 455–472. [Google Scholar] [CrossRef]
  24. Jupe, F.; Witek, K.; Verweij, W.; Śliwka, J.; Pritchard, L.; Etherington, G.J.; MacLean, D.; Cock, P.J.; Leggett, R.M.; Bryan, G.J.; et al. Resistance gene enrichment sequencing (RenSeq) enables reannotation of the NB-LRR gene family from sequenced plant genomes and rapid mapping of resistance loci in segregating populations. Plant J. 2013, 76, 530–544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Armstrong, M.R.; Vossen, J.; Lim, T.Y.; Hutten, R.C.B.; Xu, J.; Strachan, S.M.; Harrower, B.; Champouret, N.; Gilroy, E.M.; Hein, I. Tracking disease resistance deployment in potato breeding by enrichment sequencing. Plant Biotechnol. J. 2018, 17, 540–549. [Google Scholar] [CrossRef] [PubMed]
  26. Hawkes, J.G. The Potato: Evolution, Biodiversity and Genetic Resources; Belhaven Press: London, UK, 1990; p. 259. [Google Scholar]
  27. Khavkin, E.E.; Fadina, O.A.; Sokolova, E.A.; Beketova, M.P.; Drobyazina, P.E.; Rogozina, E.V.; Kuznetsova, M.A.; Yashina, I.M.; Jones, R.W.; Deahl, K.L. Pyramiding R Genes: Genomic and Genetic Profiles of Interspecific Potato Hybrids and Their Progenitors; PPO-Special Report; Schepers, H.T.A.M., Ed.; DLO Foundation: Wageningen, The Netherlands, 2014; pp. 215–220. [Google Scholar]
  28. Fadina, O.A.; Beketova, M.P.; Kuznetsova, M.A.; Rogozina, E.V.; Khavkin, E.E. Revisiting Late Blight Resistance Genes in Complex Interspecific Potato Hybrids; PAGV-Special Report; Schepers, H.T.A.M., Ed.; DLO Foundation: Wageningen, The Netherlands, 2017; pp. 245–256. [Google Scholar]
  29. Yashina, I.M.; Prohorova, O.A.; Kukushkina, L.N. Evaluation of hybrid population of potato for using in breeding on field resistance to late blight. Dostizh. Nauki Tekh. Agroprom. Kompleksa 2010, 12, 17–21. (In Russian) [Google Scholar]
  30. Rogozina, E.V.; Kolobaev, V.A.; Khavkin, E.E.; Kuznetsova, M.A.; Beketova, M.P.; Sokolova, E.A. Interspecific potato hybrids as a resource for late blight resistance genes. Russ. Agric. Sci. 2014, 40, 10–13. [Google Scholar] [CrossRef]
  31. Rogozina, E.; Chalaya, N.A.; Kuznetsova, M.A.; Demidova, V.N.; Rogozin, A.N.; Smetanina, T.I.; Beketova, M.P.; Fadina, O.A.; Khavkin, E.E. Late blight resistant potato hybrid clones in the VIR collection of plant genetic resources. Proc. Appl. Bot. Genet. Breed. 2018, 179, 278–292. [Google Scholar] [CrossRef]
  32. Malcolmson, J.F. Races of Phytophthora infestans occurring in Great Britain. Trans. Br. Mycol. Soc. 1969, 53, 417-IN2. [Google Scholar] [CrossRef]
  33. Bukasov, S.M. Systematics of the potato. Tr. Prikl. Bot. Genet. Sel. 1978, 62, 3–35. (In Russian) [Google Scholar]
  34. Spooner, D.M.; Ghislain, M.; Simon, R.; Jansky, S.; Gavrilenko, T.A. Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot. Rev. 2014, 80, 283–383. [Google Scholar] [CrossRef]
  35. Kuznetsova, M.A.; Yu Spiglazova, S.; Rogozhin, A.N.; Smetanina, T.I.; Filippov, A.V. New Approaches for Measuring Potato Susceptibility to Phytophthora Infestans; PPO-Special Report; Schepers, H.T.A.M., Ed.; DLO Foundation: Wageningen, The Netherlands, 2014; pp. 223–232. [Google Scholar]
  36. Lapwood, D.H. Laboratory assessments of the susceptibility of potato-tuber tissue to blight (Phytophthora infestans). Potato Res. 1965, 8, 215–229. [Google Scholar] [CrossRef]
  37. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Kim, H.-J.; Lee, H.-R.; Jo, K.-R.; Mortazavian, S.M.M.; Huigen, D.J.; Evenhuis, B.; Kessel, G.; Visser, R.G.F.; Jacobsen, E.; Vossen, J.H. Broad spectrum late blight resistance in potato differential set plants MaR8 and MaR9 is conferred by multiple stacked R genes. Theor. Appl. Genet. 2011, 124, 923–935. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Lenman, M.; Ali, A.; Mühlenbock, P.; Carlson-Nilsson, U.; Liljeroth, E.; Champouret, N.; Vleeshouwers, V.; Andreasson, E. Effector-driven marker development and cloning of resistance genes against Phytophthora infestans in potato breeding clone SW93-1015. Theor. Appl. Genet. 2015, 129, 105–115. [Google Scholar] [CrossRef] [PubMed]
  40. Rietman, H.; Bijsterbosch, G.; Cano, L.M.; Lee, H.-R.; Vossen, J.H.; Jacobsen, E.; Visser, R.G.F.; Kamoun, S.; Vleeshouwers, V.G.A.A. Qualitative and quantitative late blight resistance in the potato cultivar sarpo mira is determined by the perception of five distinct RXLR effectors. Mol. Plant-Microbe Interact. 2012, 25, 910–919. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Vossen, J.H.; Van Arkel, G.; Bergervoet, M.; Jo, K.-R.; Jacobsen, E.; Visser, R.G.F. The Solanum demissum R8 late blight resistance gene is an Sw-5 homologue that has been deployed worldwide in late blight resistant varieties. Theor. Appl. Genet. 2016, 129, 1785–1796. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Wang, M.; Allefs, S.; Berg, R.G.V.D.; Vleeshouwers, V.; Van Der Vossen, E.A.G.; Vosman, B. Allele mining in Solanum: Conserved homologues of Rpi-blb1 are identified in Solanum stoloniferum. Theor. Appl. Genet. 2008, 116, 933–943. [Google Scholar] [CrossRef]
  43. Colton, L.M.; Groza, H.I.; Wielgus, S.M.; Jiang, J. Marker-Assisted selection for the broad-spectrum potato late blight resistance conferred by gene rb derived from a wild potato species. Crop. Sci. 2006, 46, 589–594. [Google Scholar] [CrossRef] [Green Version]
  44. Vossen, E.A.G.V.D.; Gros, J.; Sikkema, A.; Muskens, M.; Wouters, D.; Wolters, P.; Pereira, A.; Allefs, S. The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog conferring broad-spectrum late blight resistance in potato. Plant J. 2005, 44, 208–222. [Google Scholar] [CrossRef]
  45. Pel, M.A. Mapping, Isolation and Characterization of Genes Responsible for Late Blight Resistance in Potato. Ph.D. Thesis, Wageningen University, Wageningen, The Netherlands, 2010; p. 209. [Google Scholar]
  46. Chávez, R.S.; Sosa, M.H. Use of dihaploids in the breeding of Solanum tuberosum L. (I. Cytological considerations). Hereditas 2009, 69, 83–99. [Google Scholar] [CrossRef]
  47. Aguilera-Galvez, C.; Champouret, N.; Rietman, H.; Lin, X.; Wouters, D.; Chu, Z.; Jones, J.; Vossen, J.; Visser, R.; Wolters, P.J.; et al. Two different R gene loci co-evolved with Avr2 of Phytophthora infestans and confer distinct resistance specificities in potato. Stud. Mycol. 2018, 89, 105–115. [Google Scholar] [CrossRef] [PubMed]
  48. Sokolova, E.A.; Fadina, O.A.; Khavkin, E.E.; Rogozina, E.V.; Kuznetsova, M.A.; Jones, R.W.; Deahl, K.L. Structural Homologues of CC-NBS-LRR Genes for Potato Late Blight Resistance in Wild Solanum Species; PPO-Special Report; Schepers, H.T.A.M., Ed.; DLO Foundation: Wageningen, The Netherlands, 2014; pp. 247–253. [Google Scholar]
  49. Fadina, O.A.; Beketova, M.P.; Kuznetsova, M.A.; Rogozina, E.V.; Khavkin, E.E. Polymorphisms and evolution of Solanum bulbocastanum genes for broad-spectrum resistance to Phytophthora infestans. Russ. J. Plant Physiol. 2019, 66, 950–957. [Google Scholar] [CrossRef]
  50. Fadina, O.A.M.; Beketova, M.P.; Kuznetsova, M.A.; Rogozina, E.V.; Khavkin, E.E. South American species Solanum alandiae Card. and S. okadae Hawkes et Hjerting as potential sources of genes for potato late blight resistance. Proc. Appl. Bot. Genet. Breed. 2020, 181, 73–83. [Google Scholar] [CrossRef] [Green Version]
  51. Yang, L.; Wang, D.; Xu, Y.; Zhao, H.; Wang, L.; Cao, X.; Chen, Y.; Chen, Q. A new resistance gene against potato late blight originating from Solanum pinnatisectum located on potato chromosome 7. Front. Plant Sci. 2017, 8. [Google Scholar] [CrossRef] [Green Version]
  52. Jiang, R.; Li, J.; Tian, Z.; Du, J.; Armstrong, M.; Baker, K.; Lim, T.Y.; Vossen, J.H.; He, H.; Portal, L.; et al. Potato late blight field resistance from QTL dPI09c is conferred by the NB-LRR gene R8. J. Exp. Bot. 2018, 69, 1545–1555. [Google Scholar] [CrossRef]
  53. Beketova, M.P.; Sokolova, E.A.; Rogozina, E.V.; Kuznetsova, M.A.; Khavkin, E.E. Two orthologs of late blight resistance gene R1 in wild and cultivated potato. Russ. J. Plant Physiol. 2017, 64, 718–727. [Google Scholar] [CrossRef]
  54. Van Lieshout, N.; Van Der Burgt, A.; De Vries, M.E.; Ter Maat, M.; Eickholt, D.; Esselink, D.; Van Kaauwen, M.P.W.; Kodde, L.P.; Visser, R.G.F.; Lindhout, P.; et al. Solyntus, the new highly contiguous reference genome for potato (Solanum tuberosum). G3 Genes Gen. Genet. 2020, 10, 3489–3495. [Google Scholar] [CrossRef]
  55. Vleeshouwers, V.; Raffaele, S.; Vossen, J.H.; Champouret, N.; Oliva, R.; Segretin, M.E.; Rietman, H.; Cano, L.M.; Lokossou, A.; Kessel, G.; et al. Understanding and exploiting late blight resistance in the age of effectors. Ann. Rev. Phytopathol. 2011, 49, 507–531. [Google Scholar] [CrossRef] [Green Version]
  56. McIntosh, R.A. Pre-emptive breeding to control wheat rusts. Euphytica 1992, 63, 103–113. [Google Scholar] [CrossRef]
  57. McIntosh, R.A.; Brown, G.N. Anticipatory breeding for resistance to rust diseases in wheat. Ann. Rev. Phytopathol. 1997, 35, 311–326. [Google Scholar] [CrossRef] [Green Version]
  58. Dong, S.; Raffaele, S.; Kamoun, S. The two-speed genomes of filamentous pathogens: Waltz with plants. Curr. Opin. Genet. Dev. 2015, 35, 57–65. [Google Scholar] [CrossRef] [PubMed]
  59. Thilliez, G.; Armstrong, M.R.; Lim, T.; Baker, K.; Jouet, A.; Ward, B.; Van Oosterhout, C.; Jones, J.D.G.; Huitema, E.; Birch, P.R.; et al. Pathogen enrichment sequencing (PenSeq) enables population genomic studies in oomycetes. N. Phytol. 2019, 221, 1634–1648. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  60. McDonald, B.A.; Stukenbrock, E.H. Rapid emergence of pathogens in agro-ecosystems: Global threats to agricultural sustainability and food security. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Agronomy 11 00115 g001 550
Figure 1. SCAR markers for the Rpi genes. The marker positions at the gene sequences are shown as regards the respective domains of CC-NBS-LRR kinases. For further details see Table 3.
Figure 1. SCAR markers for the Rpi genes. The marker positions at the gene sequences are shown as regards the respective domains of CC-NBS-LRR kinases. For further details see Table 3.
Agronomy 11 00115 g001
Agronomy 11 00115 g002 550
Figure 2. The hierarchical clustering dendrogram of potato genotypes. Potato genotypes: n = 55. C_1, Alpha; C_2, Bintje; C_3, Eersteling; C_4, Gloria; C_5, Robijn; C_7, Elizaveta; C_8, Priekul′skij rannij; C_9, Svitanok kievskij; C_10, Nayada; C_11, Zagadka Pitera; C_12, Escort; C_13, Sarpo Mira; C_14, Alouette; C_15, 14/8-09; C_16, 18/40-2000; C_17, 10/5-09; C_18, 11/6-09; C_19, 113 (50/1 KVA); C_20, 12/1-09; C_21, 13/11-09; C_22, 15/13-09; C_23, 111(38 KVA); C_24, 16/27-09; C_25, 134-3-2006; C_26, 25-1-2007; C_27, 25-2-2007; C_28, 134-6-2006; C_29, 34-5-2003; C_30, 97-153-2; C_31, 117-2; C_32, 128-05-03; C_33, 134-2-2006; C_34, 135-1-2006; C_35, 135-2-2006; C_37, 171-3; C_38, 194-4т; C_39, 39-1-2005; C_40, 93-5-30; C_41, 99-4-1; C_42, 118-5-2011; C_43, 118-6-2011; C_44, 128-6; C_45, 139(4-1-2012); C_46, 24-1; C_47, 24-2; C_48, 2585-70; C_49, 2522-173; C_50, 2584-7; C_51, 97.12-18; C_52, 97.13-9; C_53, 2585-67; C_54, 2585-80; C_55, 97.1.17; C_56, 2359-13; C_57, 2372-60.
Figure 2. The hierarchical clustering dendrogram of potato genotypes. Potato genotypes: n = 55. C_1, Alpha; C_2, Bintje; C_3, Eersteling; C_4, Gloria; C_5, Robijn; C_7, Elizaveta; C_8, Priekul′skij rannij; C_9, Svitanok kievskij; C_10, Nayada; C_11, Zagadka Pitera; C_12, Escort; C_13, Sarpo Mira; C_14, Alouette; C_15, 14/8-09; C_16, 18/40-2000; C_17, 10/5-09; C_18, 11/6-09; C_19, 113 (50/1 KVA); C_20, 12/1-09; C_21, 13/11-09; C_22, 15/13-09; C_23, 111(38 KVA); C_24, 16/27-09; C_25, 134-3-2006; C_26, 25-1-2007; C_27, 25-2-2007; C_28, 134-6-2006; C_29, 34-5-2003; C_30, 97-153-2; C_31, 117-2; C_32, 128-05-03; C_33, 134-2-2006; C_34, 135-1-2006; C_35, 135-2-2006; C_37, 171-3; C_38, 194-4т; C_39, 39-1-2005; C_40, 93-5-30; C_41, 99-4-1; C_42, 118-5-2011; C_43, 118-6-2011; C_44, 128-6; C_45, 139(4-1-2012); C_46, 24-1; C_47, 24-2; C_48, 2585-70; C_49, 2522-173; C_50, 2584-7; C_51, 97.12-18; C_52, 97.13-9; C_53, 2585-67; C_54, 2585-80; C_55, 97.1.17; C_56, 2359-13; C_57, 2372-60.
Agronomy 11 00115 g002
Agronomy 11 00115 g003 550
Figure 3. K-means clustering of potato genotypes.
Figure 3. K-means clustering of potato genotypes.
Agronomy 11 00115 g003
Table
Table 1. Wild Solanum species section Petota Dumort. listed in the pedigrees of interspecific hybrids explored in this study. Species are listed as treated by Bukasov, Hawkes and Spooner [26,32,33].
Table 1. Wild Solanum species section Petota Dumort. listed in the pedigrees of interspecific hybrids explored in this study. Species are listed as treated by Bukasov, Hawkes and Spooner [26,32,33].
Series in the Section PetotaSpeciesCountriesGermplasm Codes
Acaulia Juz.S. acaule Bitt.Argentina, Bolivia, Peruacl
Bulbocastana (Rydb.) HawkesS. bulbocastanum Dun.Guatemala, Mexicoblb
Commersoniana Buk.S. commersonii Dun.Argentina, Brazil, Paraguay, Uruguaycmm
Demissa Buk.S. demissum Lindl.Mexico, Guatemaladms
S. × edinense Berth.Mexicoedn
S. × semidemissum Juz.Mexicosem
Longipedicellata Buk.S. antipoviczii Buk. = S. stoloniferumMexicoant
S. polytrichon Rydb. =
S. stoloniferum		Mexicoplt
S. stoloniferum Schlechtd. & Bché.Mexicosto
S. ×vallis-mexici Juz.Mexicovll
Megistacroloba
Cárdenas & Hawkes		S. megistacrolobum Bitt.Peru, Bolivia, Argentinamga
Pinnatisecta (Rydb.) HawkesS. pinnatisectum Dun.Mexicopnt
Tuberosa (Rydb.) HawkesS. alandiae Cárd.Boliviaaln
S. andigenum Juz. & Buk. = S. tuberosum ssp. andigena HawkesArgentina, Bolivia, Guatemala, Colombia, Ecuador, Mexico, Peru, Venezuelaadg
S. berthaultii HawkesBoliviaber
S. brevicaule Bitt.Boliviabrc
S. chilotanum (Buk. & Lechn.) Hawkes (= S. tuberosum ssp. tuberosum L.).Chilechi
S. leptostigma Juz. (= S. tuberosum ssp. tuberosum L.).Chilelpt
S. microdontum Bitt.Argentina, Boliviamcd
S. okadae Hawkes & Hjert.Argentina, Boliviaoka
S. phureja Juz. & Buk.Ecuador, Colombia, Venezuela, Bolivia, Peruphu
S. rybinii Juz. & Buk. (=S. phureja Juz. & Buk.)Ecuador, Colombia, Venezuela, Bolivia, Peruryb
S. simplicifolium Bitt. =
S. microdontum		Argentina, Boliviasim
S. spegazzinii Bitt.Argentinaspg
S. vernei Bitt. & Wittm.Argentinavrn
S. verrucosum Schlechtd.Mexicover
Yungasensa Corr.S. chacoense Bitt.Argentina, Bolivia, Brazil, Paraguay, Uruguaychc
Table
Table 2. Multiparental interspecific hybrids and potato cultivars included in this study.
Table 2. Multiparental interspecific hybrids and potato cultivars included in this study.
Hybrid, Cultivar *Bred fromPedigree ****LB Resistance *****
♀ Female♂ MaleFieldLaboratory
Hybrids bred by I.M. Yashina
2585-67F1Nikulinskij {Mavka × [Apta (Interspecific hybrid × Hindenburg)] × Karpatskij}Peterburgskij [(Omega (adg, dms, chi) × E 109/11]×76
2585-70F1NikulinskijPeterburgskij54
2585-80F1NikulinskijPeterburgskij76
97.12-18F1Nikulinskij88.16/20 {[(S.chacoense × S. tuberosum) × Kameraz]} × Belorusskij 3}54
2359-13F1Nikulinskij88.16/20 {[(S.chacoense × S. tuberosum) × Kameraz]} × Belorusskij 3}65
2584-7F1NikulinskijAusonia (Wilja × Konst 63-655 adg)64
97.13-9F1Nikulinskij375.333.1 (cmm, dms, mga)53
97.1.17F1Lugovskoj (164-1С/72 × 60С/73)88.16/20 {[(S.chacoense × S. tuberosum) × Kameraz]} × Belorusskij 3}74
2372-60F11977-76Zarevo (7692 С 68 × Bekra)
adg, dms, plt		86
2522-173F1Utenok {Adretta × [(Saskia × Ora) × [(Apta × MPI 44335 1309 (adg,dms)) × Schwalbe] Lu.59.884/3 × Axilia] × 15-26 [Lyubimec × 172m-7 (S.chacoense×S. tuberosum)]}90/263
Hybrids bred by V.A. Kolobaev
10/5-09F1Zagadka Pitera (dms, phu, sto, tbr, vrn)mixture of pollen ***6–74
11/6-09F2Zagadka Pitera (dms, phu, sto, tbr, vrn)mixture of pollen6–74
12/1-09F4S. pinnatisectum k-17464Fausta (Sommerstarke (dms) × W8102/214)6–76
13/11-09F1F2 (S. pinnatisectum k-17464 × Gitte (adg))mixture of pollen75
14/8-09F5(S. polytrichon k-5345 × MPI 50-140\5 (ant = sto, dms))MPI 50-140\5 (ant = sto, dms)64
15/13-09F1(S. pinnatisectum k-17464 × Gitte (adg))F2 [(S. polytrichon k-5345 × MPI 50-140/5 (ant=sto)) × MPI 50-140/5] × |F3[(S. verrucosum × MPI 50-140/5) × Licaria] × F2 ⁅F2[(S. polytrichon k-5345 × MPI 50-140/5) × MPI 50-140/5] × {[(S. simplicifolium k-5400 × MPI 50-140/5) × Mariella (adg, dms)] × Desiree}⁆|66
16/27-09F1[(S. berthaultii k-8510 × Tajga (adg, dms)) × Оmega (adg, chi, dms)] × F2[(S. polytrichon k-5345 × MPI 50-140/5 (ant=sto) × MPI 50-140/5] × F2{[(S. simplicifolium k-5400 × MPI 50-140/5) × Gitte (adg)] × Hera}⁆|Nayada (adg, dms, phu, sto, tbr, vrn)76
18/40-2000F2[(S. polytrichon k-5345 × MPI 50-140/5 (ant=sto)) × Umbra] × Fausta (dms)[(S. simplicifolium k-5400 × MPI 50-140/5) × Gitte (adg)] × Hera65
111 (38 KVA)F1FermerF4⁅F2[(S. polytrichon k-5345 × MPI 50-140/5 (ant=sto)) × MPI 50-140/5] × F2{[(S. simplicifolium k-5400 × MPI 50-140/5) × Gitte (adg)] × Hera}⁆6.5–86
113 (50/1 KVA)F1Zagadka Pitera (dms, phu, sto, tbr, vrn) × mixture of pollenNayada (adg, dms, phu, sto, tbr, vrn) × mixture of pollen6–76
Hybrids bred by E.V. Rogozina
117-1F1Atzimba (adg, dms)S. alandiae k-21240
117-2F1AtzimbaS. alandiae k-212405–75
39-1-2005F1AtzimbaS. alandiae k-212406–76
24-1F1AtzimbaS. alandiae k-212406–87
24-2F1AtzimbaS. alandiae k-212406–87
25-1-2007F1Elizaveta24-1 (Atzimba × S. alandiae k-21240)55
25-2-2007F1Elizaveta24-1 (Atzimba × S. alandiae k-21240)4–54
134-2-2006F124-2 (Atzimba × S. alandiae k-21240)Svitanok kievskij6–76
134-3-2006F124-2 (Atzimba × S. alandiae k-21240)Svitanok kievskij2–33
134-6-2006F124-2 (Atzimba × S. alandiae k-21240)Svitanok kievskij5–65
135-1-2006F1Svitanok kievskij24-2 (Atzimba × S. alandiae k-21240)5–75
135-2-2006F1Svitanok kievskij24-2 (Atzimba × S. alandiae k-21240)4.5–74
139 (4-1-2012)F1Atzimba × S. alandiae k-21240F5 [(S. polytrichon k-5345 × MPI 50-140\5) × MPI 50-140\5]7–96
97-155-1F1Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)7–86
128-05-03F197-155-1 (adg, ryb, sto)Nayada (adg, dms, phu, sto, tbr, vrn)6–75
118 (118-5-2011)F2Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)5–86
120 (118-6-2011)F2Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)5–75
160-1F2Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)7–8nd
160-17F2Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)6–75
106 (171-3)F2Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)6–76
123 (128-6)F2Bobr (adg, dms, sto)91-21-4 (adg, dms, ryb)6–86
90-6-2F1194-4 (adg, phu, sto)CIP-1039 (adg)7nd
99-6-5F190-6-2 (adg, phu, sto)Hertha (adg, dms, ryb, tbr)3–4nd
99-6-6F190-6-2 (adg, phu, sto)Hertha (adg, dms, ryb, tbr)5nd
97-153-2F190-6-2 (adg, phu, sto)91-21-4 (adg, dms, ryb)65
2 (194-4т)F1Zagadka Pitera (dms, sto, vrn, phu, tbr)99-6-6 (adg, dms, phu, ryb, sto, tbr)6–75
99-4-1F1180-1 (sto)Hertha (adg, dms, ryb, tbr)5–75
7 (93-5-30)F141.85.6 (adg, phu, ryb)91-19-2 (acl, blb, sto)5–75
190-4F1Gibridnyj 14 (dms, vll)194-4 (adg, phu, sto)7–84
97-162-2F191-15-2 (adg, ryb, sto)90-21-1 (adg, mcd, ryb, spg, sto)3nd
34-6F197-162-2 (adg, mcd, ryb, spg, sto)190-4 (adg, dms, phu, sto, vll)5nd
53 (34-5-2003)F197-162-2(adg, mcd, ryb, spg, sto)190-4 (adg, dms, phu, sto, vll)65
135-3-2005F1S. okadae k-20921S. chacoense k-197595nd
135-5-2005F1S. okadae k-20921S. chacoense k-197595nd
8-1-2004F1S. okadae k-20921S. chacoense k-197595nd
8-3-2004F1S. okadae k-20921S. chacoense k-197593nd
8-5-2004F1S. okadae k-20921S. chacoense k-197595nd
Other hybrids and cultivars employed as standards
R5nd ** ndnd
R8nd ndnd
R9nd ndnd
Magellanesndindigenous cultivar of Chile S. tuberosum ssp. tuberosum L.-ndnd
AlouettendAR 02-139-1Laura8–97
AtzimbaF1US 133.352- AT-1 (adg)54
Sarpo Axonandndnd87
Sarpo Mira 76 PO 12 14 268D 18787
AlphaF1Paul KrugerPreferent43
BintjeF1MunstersenFransen33
DesireeF1UrgentaDepesche42
Early RosendGarnet Chili-4nd
EerstelingndDuke of York-43
EscortF1RentalCebeco 64 197 16 (dms)6–76
GloriandAlpha?Bato53–4
JubelF1Victoria Augusta78 927nd
RobijnndRode StarPreferent54
ElizavetaF1acl, adg, dms, phu, sto, tbr, vrnnd54
Nayadandadg, dms, phu, sto, tbr, vrnnd65
Negrndindigenous cultivar of Chile S. tuberosum ssp. tuberosum L.-43
Priekul’skij rannijndIrish CobblerJubel53
Svitanok kievskijndAdretta (adg, dms)3774c 7154
Zagadka Piteranddms, phu, sto, tbr, vrnnd65
* https://www.europotato.org/varieties/view; ** nd, no data; *** see Table 1 for germplasm codes; **** mixture of pollen from several interspecific hybrids of high LB resistance; ***** 1–9-point scores, from susceptible to resistant.
Table
Table 3. SCAR markers of Solanum Rpi genes (see also Figure 1).
Table 3. SCAR markers of Solanum Rpi genes (see also Figure 1).
GenePrototype Gene *Marker, Size, bp.Position on the Gene, bpPrimers SequencesAnneal. Temp., °CReferences
Rpi-R1AF447489Rpi-R1-12055126–6331F-cactcgtgacatatcctcacta
R-gtagtacctatcttatttctgcaagaat		61[21]
Rpi-R2/Rpi-blb3FJ536325Rpi-R2-6861370–2055F-gctcctgatacgatccatg
R-acggcttcttgaatgaa		54[38]
Rpi-R2-11371277–2413F-aagatcaagtggtaaaggctgatg
R-atctttctagcttccaaagatcacg		60[39]
FJ536346Rpi-blb3-3055551–5855F–agctttttgagtgtgtaattgg
R-gtaactacggactcgaggg		63.5[8]
Rpi-R3aAY849382Rpi-R3a-13801677–3056F-gtagtacctatcttatttctgcaagaat
R-agccacttcagcttcttacagtagg		64[21]
Rpi-R3bJF900492Rpi-R3b-37894818–95195F-gtcgatgaatgctatgtttctcgaga
R-accagtttcttgcaattccagattg’		64[40]
Rpi-R8KU530153Rpi-R8-127673694–74970F-aacaagagatgaattaagtcggtagc
R-gctgtaggtgcaatgttgaagga		62.5[41] modif.
Rpi-blb1 = Rpi-sto1AY336128Rpi-blb1-8212304–3124F-aacctgtatggcagtggcatg
R-gtcagaaaagggcactcgtg		62[42]
AY336128Rpi-blb1-2263143–3368F–cacgaggcccttttctgac
R-ttcaattgtgttgcgcactag		50[43]
EU884421Rpi-sto1-890241–1130F-accaaggccacaagattctc
R-cctgcggttcggttaataca		65[8]
Rpi-blb2DQ122125Rpi-blb2-9763226–4202F-ggactgggtaacgacaatcc
R-atttatggctgcagaggacc		55[44]
Rpi-vnt1FJ423046Rpi-vnt1.3-61289–701F-ccttcctcatcctcacatttag
R-gcatgccaactattgaaacaac		58[45]
* Accession numbers in the NCBI Genbank (https://www.ncbi.nlm.nih.gov/genbank/).
Table
Table 4. Markers of Rpi genes in multiparental interspecific hybrids and reference potato cultivars (1/0—presence/absence of markers).
Table 4. Markers of Rpi genes in multiparental interspecific hybrids and reference potato cultivars (1/0—presence/absence of markers).
Geno-TypesSolanum Species in Hybrid Pedigrees *GenesThe Number of Genes
R1R2 = Rpi-blb3R3aR3bR8Rpi-blb 1 = Rpi-sto1Rpi-blb2Rpi-vnt1-3
R1-1205R2-1137R2-686Rpi-blb3-305R3a-1380R3b-378R8-1276RB-226Rpi-blb1-821Rpi-sto1-890Rpi-blb2-976Rpi-vnt1.3-612
Hybrids bred by I.M. Yashina
2585-67adg, chi, dms, tbr0111110000003
2585-70adg, chi, dms, tbr0111110000003
2585-80adg, chi, dms, tbr0111000000001
2359-13chc, dms, tbr1111110000004
2584-7adg, chc, dms, edn, ryb, tbr0111010000002
97.12-18chc, dms, tbr0000111000003
97.13-9cmm, dms, mga, tbr0111111000105
2372-60adg, chc, dms, lpt, sto, tbr,1111110000004
2522-173adg, chc, dms, tbr0000111000003
97.1.17adg, chc, dms, sem, tbr0111000000001
10/5-09dms, phu, sto, tbr, vrn0111111000105
11/6-09dms, phu, sto, tbr, vrn0111111000105
12/1-09dms, pnt, tbr0111000111002
13/11-09adg, pnt, tbr0000011111014
14/8-09Ant = sto, dms, plt = sto, tbr0100111000015
15/13-09adg, ant = sto, dms, plt = sto, pnt, sim = mcd, tbr, ver0110011111105
16/27-09adg, ant = sto, ber, chi, dms, phu, plt = sto, sim = mcd, tbr, vrn1000001111104
18/40-2000adg, dms, mcd, plt = sto, sto, tbr,1000001000013
111 (38 KVA)adg, ant = sto, dms, plt = sto, sim = mcd, tbr0111110011105
113 (50/1 KVA)adg, dms, phu, sto, tbr, vrn1000001100104
Hybrids bred by E.V. Rogozina
117-1adg, aln = brc, dms, tbr0000010000102
117-2adg, aln = brc, dms, tbr0100011000115
39-1-2005adg, aln = brc, dms, tbr0000010111013
24-1adg, aln = brc, dms, tbr0000011000114
24-2adg, aln = brc, dms, tbr0111010000114
25-1-2007acl, adg, aln = brc, dms, phu, sto, tbr, vrn1000010000103
25-2-2007acl, adg, aln = brc, dms, phu, sto, tbr, vrn1000011000115
134-2-2006adg, aln = brc, dms, tbr1100001100015
134-3-2006adg, aln = brc, dms, tbr0000001000001
134-6-2006adg, aln = brc, dms, tbr0000111000014
135-1-2006adg, aln = brc, dms, tbr0111110000014
135-2-2006adg, aln = brc, dms, tbr1111110100005
139 (4-1-2012)adg, aln = brc, ant = sto, dms, plt = sto, tbr1000000011103
97-155-1adg, dms, ryb, sto, tbr0111111000015
128-05-03adg, dms, phu, ryb, sto, tbr, vrn0111111000004
118 (118-5-2011)adg, dms, ryb, sto, tbr0100110100004
120 (118-6-2011)adg, dms, ryb, sto, tbr0100111000004
160-1adg, dms, ryb, sto, tbr0000001000102
160-17adg, dms, ryb, sto, tbr0000001000102
106 (171-3)adg, dms, ryb, sto, tbr0000011000002
123 (128-6)adg, dms, ryb, sto, tbr1000111000105
90-6-2adg, phu, sto, tbr1100001100015
99-6-5adg, dms, phu, sto, tbr0100011100015
99-6-6adg, dms, phu, sto, tbr1100110100016
97-153-2adg, dms, phu, sto, tbr0000101000002
2 (194-4т)adg, dms, phu, ryb, sto, tbr, vrn0000011010003
99-4-1adg, dms, ryb, sto, tbr1000010000002
7 (93-5-30)acl, adg, blb, dms, phu, ryb, sto, tbr0000011000103
190-4adg, dms, phu, sto, tbr, vll1110001100015
97-162-2adg, mcd, ryb, spg=brc, sto, tbr0000001000102
34-6adg, mcd, ryb, spg=brc, sto, phu, tbr, vll1000001000103
53 (34-5-2003)adg, mcd, ryb, spg=brc, sto, phu, tbr, vll0000001000102
135-3-2005chc, oka0111001000103
135-5-2005chc, oka0000001000102
8-1-2004chc, oka0000000000101
8-3-2004chc, oka0000001000102
8-5-2004chc, oka0000001000102
Reference genotypes
R5dms, tbr1111011000105
R8dms, tbr0000111000104
R9dms, tbr1111110000105
Magel-lanesS. tuberosum ssp. tuberosum L.1000000000102
Alouettevnt0000110000013
Atzimbaadg, dms, tbr0000001100103
Sapro Axonadms, tbr0000011000002
Sapro Miradms, tbr0000111000003
Alphatbr0000001000001
Bintjetbr0000000000011
Desireetbr0000001000001
Early Rosetbr0000000000112
Eerstelingtbr0000001000001
Escortdms, tbr1110110000004
Gloriaadg, dms, tbr0100110000003
Jubeldms?, tbr1100001000115
Robijntbr0100000000001
Elizavetaacl, adg, dms, phu, sto, tbr, vrn1000110100004
Nayadaadg, dms, phu, sto, tbr, vrn1111001000104
NegrS. tuberosum ssp. tuberosum L.0100000000001
Priekul’skij rannijtbr0000001010002
Svitanok kievskijdms, tbr0111111010005
Zagadka Piteradms, phu, sto, tbr, vrn0000111000014
* For germplasm codes see Table 1.
Table
Table 5. Potato hybrids with 4+ Rpi genes.
Table 5. Potato hybrids with 4+ Rpi genes.
GenotypePedigreeRpi-R1Rpi-R2/Rpi-blb3Rpi-R3aRpi-R3bRpi-R8Rpi-blb1/Rpi-sto1Rpi-blb2Rpi-vnt1Total Gene NumberField Resistance
2359-13chc, dms, tbr1111000046
97.13-9cmm, dms, mga, tbr0111101055
2372-60adg, chc, dms, lpt, sto, tbr1111000048
10/5-09dms, phu, sto, tbr, vrn0111101057
11/6-09dms, phu, sto, tbr, vrn0111101057
13/11-09adg, pnt, tbr0001110147
14/8-09Ant = sto, dms, plt = sto, tbr0111100156
15/13-09adg, ant = sto, dms, plt = sto, pnt, sim = mcd, tbr, ver0101111056
16/27-09adg, ant = sto, ber, chi, dms, phu, plt = sto, sim = mcd, tbr, vrn1000111047
111 (38 KVA)adg, ant = sto, dms, plt = sto, sim = mcd, tbr0111011058
113 (50/1 KVA)adg, dms, phu, sto, tbr, vrn1000111047
117-2adg, aln = brc, dms, tbr0101001147
24-1adg, aln = brc, dms, tbr0001101148
24-2adg, aln = brc, dms, tbr0101001148
25-2-2007acl, adg, aln = brc, dms, phu, sto, tbr, vrn1001101155
134-2-2006adg, aln = brc, dms, tbr1100110157
134-6-2006adg, aln = brc, dms, tbr0011100146
135-1-2006adg, aln = brc, dms, tbr0111000147
135-2-2006adg, aln = brc, dms, tbr1111010047
97-155-1adg, dms, ryb, sto, tbr0111100158
128-05-03adg, dms, phu, ryb, sto, tbr, vrn0111100047
118 (118-5-2011)adg, dms, ryb, sto, tbr0111010048
120 (118-6-2011)adg, dms, ryb, sto, tbr0111100047
123 (128-6)adg, dms, ryb, sto, tbr1011101058
90-6-2adg, phu, sto, tbr1100110157
99-6-5adg, phu, sto, tbr0101111054
99-6-6adg, phu, sto, tbr1111010165
190-4adg, dms, phu, sto, tbr, vll1100110158
Escortdms, tbr1111000047
Jubeldms?, tbr1100101157
Elizavetaacl, adg, dms, phu, sto, tbr, vrn1011010045
Nayadaadg, dms, phu, sto, tbr, vrn1100101046
Svitanok kievskijdms, tbr0111110055
Zagadka Piteradms, phu, sto, tbr, vrn0011100146
Frequency 0.440.740.590.790.660.410.440.44
* For germplasm codes see Table 1.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Rogozina, E.V.; Beketova, M.P.; Muratova, O.A.; Kuznetsova, M.A.; Khavkin, E.E. Stacking Resistance Genes in Multiparental Interspecific Potato Hybrids to Anticipate Late Blight Outbreaks. Agronomy 2021, 11, 115. https://doi.org/10.3390/agronomy11010115

AMA Style

Rogozina EV, Beketova MP, Muratova OA, Kuznetsova MA, Khavkin EE. Stacking Resistance Genes in Multiparental Interspecific Potato Hybrids to Anticipate Late Blight Outbreaks. Agronomy. 2021; 11(1):115. https://doi.org/10.3390/agronomy11010115

Chicago/Turabian Style

Rogozina, Elena V., Mariya P. Beketova, Oksana A. Muratova, Mariya A. Kuznetsova, and Emil E. Khavkin. 2021. "Stacking Resistance Genes in Multiparental Interspecific Potato Hybrids to Anticipate Late Blight Outbreaks" Agronomy 11, no. 1: 115. https://doi.org/10.3390/agronomy11010115

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop