Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. PCN Inoculation and Resistance Evaluation
2.2.1. Pathotypes of G. rostochiensis and G. pallida
2.2.2. Evaluation for PCN-Resistance in Bio-Tests
2.3. Marker Assisted Selection
2.3.1. DNA Isolation and PCR Amplification
2.3.2. Restriction
2.3.3. Electrophoresis
2.3.4. Diagnostic Bands of Molecular Markers
2.4. Statistical Analysis
3. Results
3.1. Bio-Test for Resistance to Pathotype Ro5 of G. rostochiensis and Screening of Potato Cultivars with Molecular Markers of the Grp1_QTL Involved in Control of Resistance to Pathotype Ro5 of Golden Nematode
3.2. Bio-Test for Resistance to Pathotype Pa3 of Pale Nematode (G. pallida)
3.3. MAS with DNA Markers of Genes (QTLs) Conferring Resistance to Pathotype Pa3 of Pale Nematode (G. pallida)
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- FAO. Available online: http://www.fao.org/faostat/en/#data/QCL (accessed on 30 September 2021).
- Moens, M.; Perry, R.N.; Jones, J.T. Cyst nematodes—Life cycle and economic importance. In Cyst Nematodes; Moens, M., Perry, R.N., Jones, T.J., Eds.; CABI: Wallingford, UK, 2018; pp. 1–26. [Google Scholar] [CrossRef]
- EPPO. Globodera Rostochiensis. Distribution; EPPO Global Database. Available online: https://gd.eppo.int/taxon/HETDRO/distribution (accessed on 30 September 2021).
- EPPO. Globodera Pallida. Distribution; EPPO Global Database. Available online: https://gd.eppo.int/taxon/HETDPA/distribution (accessed on 30 September 2021).
- EPPO. EPPO Global Database. Available online: https://gd.eppo.int (accessed on 30 September 2021).
- Turner, S.J.; Evans, K. The origins, global distribution and biology of potato cyst nematodes (Globodera rostochiensis Woll. and Globodera pallida Stone). In Potato Cyst Nematodes, Biology, Distribution and Control, 2nd ed.; Marks, R.J., Brodie, B.B., Eds.; CABI: Wallingford, UK, 1998; pp. 7–26. [Google Scholar]
- Turner, S.J.; Subbotin, S.A. Cyst nematodes. In Plant Nematology; Perry, R.N., Moens, M., Eds.; CABI: Wallingford, UK, 2013; pp. 109–143. [Google Scholar] [CrossRef]
- Evans, K.; Stone, A.R. A Review of the Distribution and Biology of the Potato Cyst-Nematodes Globodera rostochiensis and G. pallida. Pans 1977, 23, 178–189. [Google Scholar] [CrossRef]
- Noling, J.W. Movement and Toxicity of Nematicides in the Plant Root Zone; University of Florida: Gainesville, FL, USA, 2019; Available online: https://edis.ifas.ufl.edu/publication/NG002 (accessed on 30 September 2021).
- Jones, R.K. Nematode control and nematicides: Developments since 1982 and future trends. In Nematology in South Africa: A View From the 21st Century; Fourie, H., Spaull, V.W., Jones, R.K., Daneel, M.S., Waele, D.D., Eds.; Springer: New York, NY, USA, 2017; pp. 129–150. [Google Scholar]
- CABI. Globodera Pallida (White Potato Cyst Nematode). Invasive Species Compendium. Available online: https://www.cabi.org/isc/datasheet/27033 (accessed on 30 September 2021).
- CABI. Globodera rostochiensis (Yellow Potato Cyst Nematode). Invasive Species Compendium. Available online: https://www.cabi.org/isc/datasheet/27034 (accessed on 30 September 2021).
- Kort, J.; Ross, H.; Rumpenhorst, H.J.; Stone, A.R. An International Scheme for Identifying and Classifying Pathotypes of Potato Cyst-Nematodes Globodera Rostochiensis and G. Pallida. Nematologica 1977, 23, 333–339. [Google Scholar] [CrossRef] [Green Version]
- Nijboer, H.; Parlevliet, J.E. Pathotype-specificity in potato cyst nematodes, a reconsideration. Euphytica 1990, 49, 39–47. [Google Scholar] [CrossRef]
- Gartner, U.; Hein, I.; Brown, L.H.; Chen, X.; Mantelin, S.; Sharma, S.K.; Dandurand, L.-M.; Kuhl, J.C.; Jones, J.T.; Bryan, G.J.; et al. Resisting Potato Cyst Nematodes With Resistance. Front. Plant Sci. 2021, 12, 661194. [Google Scholar] [CrossRef] [PubMed]
- Afonin, A.N.; Greene, S.L.; Dzyubenko, N.I.; Frolov, A.N. Interactive Agricultural Ecological Atlas of Russia and Neighboring Countries. Economic Plants and their Diseases, Pests and Weeds. 2008. Available online: http://www.agroatlas.ru (accessed on 30 September 2021).
- Limantseva, L.; Mironenko, N.; Shuvalov, O.; Antonova, O.; Khiutti, A.; Novikova, L.; Afanasenko, O.; Spooner, D.; Gavrilenko, T. Characterization of resistance to Globodera rostochiensis pathotype Ro1 in cultivated and wild potato species accessions from the Vavilov Institute of Plant Industry. Plant Breed. 2014, 133, 660–665. [Google Scholar] [CrossRef]
- Khiutti, A.V.; Antonova, O.Y.; Mironenko, N.V.; Gavrilenko, T.A.; Afanasenko, O.S. Potato Resistance to Quarantine Diseases. Russ. J. Genet. 2017, 7, 833–844. [Google Scholar] [CrossRef]
- Federal Service for Veterinary and Phytosanitary Surveillance of Russian Ministry of Agriculture. National Report on the Quarantine Status on the Territory of the Russian Federation in 2018; Ministry of Agriculture: Moscow, Russia, 2019. Available online: https://fsvps.gov.ru/fsvps-docs/ru/usefulinf/files/nd2019.pdf (accessed on 30 September 2021). (In Russian)
- Federal Service for Veterinary and Phytosanitary Surveillance of Russian Ministry of Agriculture. National Report on the Quarantine Status on the Territory of the Russian Federation in 2019; Ministry of Agriculture: Moscow, Russia, 2020. Available online: https://fsvps.gov.ru/fsvps-docs/ru/usefulinf/files/nd2020.pdf (accessed on 30 September 2021). (In Russian)
- Federal Service for Veterinary and Phytosanitary Surveillance of Russian Ministry of Agriculture. National Report on the Quarantine Status on the Territory of the Russian Federation in 2020; Ministry of Agriculture: Moscow, Russia, 2021. Available online: https://fsvps.gov.ru/fsvps-docs/ru/usefulinf/files/nd2021.pdf (accessed on 30 September 2021). (In Russian)
- Gossortommission. State Register for Selection Achievements Admitted for Usage. The Federal State Budgetery Institution “State Commission of the Russian Federation for Selection Achievements Test and Protection”. Available online: https://reestr.gossortrf.ru/ (accessed on 30 September 2021).
- Heikkilä, J.; Tiilikkala, K. Globodera rostochiensis (Woll.) Behrens (Tylenchida, Heteroderidae), the only potato cyst nematode species found in Finland. Agric. Food Sci. 1992, 1, 519–525. [Google Scholar] [CrossRef]
- Magnusson, C.; Hammeraas, B. Potetcystenematodenes (PCN) biologi, smitteveier og bekjempelse. FAGINFO/NLH-Fagtjeneste 1994, 4, 112–127. [Google Scholar]
- Przetakiewicz, A. Distribution of PCN pathotypes in Poland. Plant Breed. Seed Sci. 2019, 79, 3–8. [Google Scholar] [CrossRef]
- EPPO. Situation of Globodera Pallida in Finland in 2011; EPPO Reporting Service, John Wiley & Sons, Inc.: New York, NY, USA; Available online: https://gd.eppo.int/reporting/article-1900 (accessed on 30 September 2021).
- EPPO. First Report of Globodera Pallida in Estonia; EPPO Reporting Service, John Wiley & Sons, Inc.: New York, NY, USA. Available online: https://gd.eppo.int/reporting/article-6467 (accessed on 30 September 2021).
- Holgado, R.; Magnusson, C. Nematodes as a Limiting Factor in Potato Production in Scandinavia. Potato Res. 2012, 55, 269–278. [Google Scholar] [CrossRef] [Green Version]
- Pylypenko, L.A.; Uehara, T.; Phillips, M.S.; Sigareva, D.D.; Blok, V.C. Identification of Globodera rostochiensis and G. pallida in the Ukraine by PCR. Eur. J. Plant Pathol. 2005, 111, 39–46. [Google Scholar] [CrossRef]
- Karnkowski, W.; Kcazmarek, A.; Dobosz, R.; Wieczorek, P.; Obrepalska-Steplowska, A. Occurrence of the white potato nematode Globodera pallida (Stone, 1973) Behrens, 1975 (Nematoda: Heteroderidae) on the territory of Poland. Prog. Plant Prot. 2012, 51, 1087–1092. [Google Scholar]
- Price, J.A.; Coyne, D.; Blok, V.C.; Jones, J.T. Potato cyst nematodes Globodera rostochiensis and G. pallida. Mol. Plant Pathol. 2021, 22, 495–507. [Google Scholar] [CrossRef] [PubMed]
- van der Voort, R.J.; Lindeman, W.; Folkertsma, R.; Hutten, R.; Overmars, H.; van der Vossen, E.; Jacobsen, E.; Bakker, J. A QTL for broad-spectrum resistance to cyst nematode species (Globodera spp.) maps to a resistance gene cluster in potato. Theor. Appl. Genet. 1998, 96, 654–661. [Google Scholar] [CrossRef]
- Finkers-Tomczak, A.; Danan, S.; van Dijk, T.; Beyene, A.; Bouwman, L.; Overmars, H.; van Eck, H.; Goverse, A.; Bakker, J.; Bakker, E. A high-resolution map of the Grp1 locus on chromosome V of potato harbouring broadspectrum resistance to the cyst nematode species Globodera pallida and Globodera rostochiensis. Theor. Appl. Genet. 2009, 119, 165–173. [Google Scholar] [CrossRef] [Green Version]
- Sattarzadeh, A.; Achenbach, U.; Lübeck, J.; Strahwald, J.; Tacke, E.; Hofferbert, H.-R.; Rothsteyn, T.; Gebhardt, C. Single nucleotide polymorphism (SNP) genotyping as basis for developing a PCR based marker highly diagnostic for potato varieties with high resistance to Globodera pallida pathotype Pa2/3. Mol. Breed. 2006, 18, 301–312. [Google Scholar] [CrossRef] [Green Version]
- Moloney, C.; Griffin, D.; Jones, P.W.; Bryan, G.J.; McLean, K.; Bradshaw, J.E.; Milbourne, D. Development of diagnostic markers for use in breeding potatoes resistant to Globodera pallida pathotype Pa2/3 using germplasm derived from Solanum tuberosum ssp. andigena CPC 2802. Theor. Appl. Genet. 2010, 120, 679–689. [Google Scholar] [CrossRef]
- Galek, R.; Rurek, M.; De Jong, W.S.; Pietkiewicz, G.; Augustyniak, H.; Sawicka-Sienkiewicz, E. Application of DNA markers linked to the potato H1 gene conferring resistance to pathotype Ro1 of Globodera rostochiensis. J. Appl. Genet. 2011, 52, 407–411. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Milczarek, D.; Flis, B.; Przetakiewicz, A. Suitability of molecular markers for selection of potatoes resistant to Globodera spp. Am. J. Pot. Res. 2011, 88, 245–255. [Google Scholar] [CrossRef]
- Milczarek, D.; Przetakiewicz, A.; Kamiński, P.; Flis, B. Early selection of potato clones with the H1 resistance gene—the relation of nematode resistance to quality characteristics. Czech J. Genet. Plant Breed. 2014, 50, 278–284. [Google Scholar] [CrossRef] [Green Version]
- Asano, K.; Kobayashi, A.; Tsuda, S.; Nishinaka, M.; Tamiya, S. DNA marker-assisted evaluation of potato genotypes for potential resistance to potato cyst nematode pathotypes not yet invading into Japan. Breed. Sci. 2012, 62, 142–150. [Google Scholar] [CrossRef] [Green Version]
- Schultz, L.; Cogan, N.O.I.; McLean, K.; Dale, M.F.B.; Bryan, G.J.; Forster, J.W.; Salter, A.T. Evaluation and implementation of a potential diagnostic molecular marker for H1-conferred potato cyst nematode resistance in potato (Solanum tuberosum L.). Plant Breed. 2012, 131, 315–321. [Google Scholar] [CrossRef]
- Sharma, R.; Bhardwaj, V.; Dalamu, D.; Kaushik, S.K.; Singh, B.P.; Sharma, S.; Umamaheshwari, R.; Baswaraj, R.; Kumar, V.; Gebhardte, C. Identification of elite potato genotypes possessing multiple disease resistance genes through molecular approaches. Sci. Hortic. 2014, 179, 204–211. [Google Scholar] [CrossRef]
- Antonova, O.Y.; Shvachko, N.A.; Novikova, L.Y.; Shuvalov, O.Y.; Kostina, L.I.; Klimenko, N.S.; Shuvalova, A.R.; Gavrilenko, T.A. Genetic diversity of potato varieties bred in Russia and near-abroad countries based on polymorphism of SSR-loci and markers associated with resistance R-genes. Vavilov J. Genet. Breed. 2016, 20, 596–606, (In Russian, with English abstract). [Google Scholar] [CrossRef]
- Sudha, R.; Mhatre, P.H.; Lekshmanan, D.K.; Venkatasalam, E.P.; Bairwa, A.; Bhardwaj, V.; Dalamu; Sharma, R. Phenotypic and molecular characterization of potato germplasm for potato cyst nematode resistance. Indian J. Genet. Plant Breed. 2019, 79, 394–403. [Google Scholar] [CrossRef]
- Bhardwaj, V.; Soos, S.; Kumar, A.; Vanishree, G.; Sharma, S.; Sundaresha, S.; Raigond, B.; Kumar, R.; Bairwa, A.; Lal, M.; et al. Efficiency and reliability of marker assisted selection for resistance to major biotic stresses in potato. Potato J. 2019, 46, 56–66. [Google Scholar]
- Asano, K.; Shimosaka, E.; Yamashita, Y.; Narabu, T.; Aiba, S.; Sakata, I.; Akai, K.; Okamoto, S.; Tamiya, S. Improvement of diagnostic markers for resistance to Globodera pallida and application for selection of resistant germplasms in potato breeding. Breed. Sci. 2021, 71, 354–364. [Google Scholar] [CrossRef] [PubMed]
- Bryan, G.J.; McLean, K.; Bradshaw, J.E.; De Jong, W.S.; Phillips, M.; Castelli, L.; Waugh, R. Mapping QTLs for resistance to the cyst nematode Globodera pallida derived from the wild potato species Solanum vernei. Theor. Appl. Genet. 2002, 105, 68–77. [Google Scholar] [CrossRef]
- Nunziata, A.; Ruggieri, V.; Greco, N.; Frusciante, L.; Barone, A. Genetic Diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers. Am. J. Plant Sci. 2010, 1, 95–103. [Google Scholar] [CrossRef] [Green Version]
- Whitworth, J.L.; Novy, R.G.; Zasada, I.A.; Wang, X.; Dandurand, L.-M.; Kuhl, J.C. Resistance of Potato Breeding Clones and Cultivars to Three Species of Potato Cyst Nematode. Plant Dis. 2018, 102, 2120–2128. [Google Scholar] [CrossRef] [Green Version]
- Hospital, F. Challenges for effective marker-assisted selection in plants. Genetica 2009, 136, 303–310. [Google Scholar] [CrossRef]
- Gebhardt, C. Bridging the gap between genome analysis and precision breeding in potato. Trends Genet. 2013, 29, 248–256. [Google Scholar] [CrossRef] [PubMed]
- Platten, J.D.; Cobb, J.N.; Zantua, R.E. Criteria for evaluating molecular markers: Comprehensive quality metrics to improve marker assisted selection. PLoS ONE 2019, 14, e0210529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalamu, V.B.; Umamaheshwari, R.; Sharma, R.; Kaushik, S.; Joseph, T.; Singh, B.; Gebhardt, C. Potato cyst nematode (PCN) resistance: Genes, genotypes and markers—An update. SABRAO J. Breed. Genet. 2012, 44, 202–228. [Google Scholar]
- Mori, K.; Mukojima, N.; Nakao, T.; Tamiya, S.; Sakamoto, Y.; Sohbaru, N.; Hayashi, K.; Watanuki, H.; Nara, K.; Yamazaki, K.; et al. Germplasm Release: Saikai 35, a Male and Female Fertile Breeding Line Carrying Solanum Phureja-Derived Cytoplasm and Potato Cyst Nematode Resistance (H1) and Potato Virus Y Resistance (Ry chc) Genes. Am. J. Potato Res. 2012, 89, 63–72. [Google Scholar] [CrossRef]
- Sudha, R.; Venkatasalam, E.P.; Bairwa, A.; Bhardwaj, V.; Dalamu; Sharma, R. Identification of potato cyst nematode resistant genotypes using molecular markers. Sci. Hortic. 2016, 198, 21–26. [Google Scholar] [CrossRef]
- Biryukova, V.A.; Zhuravlev, A.A.; Abrosimova, S.B.; Kostina, L.I.; Khromova, L.M.; Shmyglya, I.V.; Morozova, N.N.; Kirsanova, S.N. Use of molecular markers of potato golden nematode resistance genes H1 and GRO1. Russ. Agric. Sci. 2008, 34, 365–368. [Google Scholar] [CrossRef]
- Klimenko, N.S.; Antonova, O.Y.; Kostina, L.I.; Mamadbokirova, F.T.; Gavrilenko, T.A. Marker-associated selection of Russian potato varieties with using markers of resistance genes to the golden potato cyst nematode (pathotype Ro1). Proc. Appl. Bot. Genet. Breed. 2017, 178, 66–75. (In Russian) [Google Scholar] [CrossRef] [Green Version]
- Klimenko, N.S.; Gavrilenko, T.A.; Chukhina, I.G.; Gadzhiev, N.M.; Evdokimova, Z.Z.; Lebedeva, V.A. Nomenclatural standards and genetic passports of potato cultivars bred at the Leningrad Research Institute for Agriculture “Belogorka”. Plant Biotech. Breed. 2020, 3, 18–54. (In Russian) [Google Scholar] [CrossRef]
- Rybakov, D.A.; Antonova, O.Y.; Chukhina, I.G.; Fomina, N.A.; Klimenko, N.S.; Zheltova, V.V.; Meleshin, A.A.; Kochieva, E.Z.; Oves, E.V.; Apshev, K.K.; et al. Nomenclatural standards and genetic passports of potato cultivars bred in the A.G. Lorkh All-Russian Potato Research Institute of Potato Farming. Plant Biotech. Breed. 2020, 3, 5–52. (In Russian) [Google Scholar] [CrossRef]
- Fomina, N.A.; Antonova, O.Y.; Chukhina, I.G.; Rybakov, D.A.; Safonova, A.D.; Meleshin, A.A.; Gavrilenko, T.A. Nomenclatural standards, voucher specimens and genetic passports of potato cultivars created in the Siberian and Ural breeding centers. Plant Biotech. Breed. 2020, 3, 53–76. (In Russian) [Google Scholar] [CrossRef]
- Caromel, B.; Mugniéry, D.; Kerlan, M.-C.; Andrzejewski, S.; Palloix, A.; Ellisseche, D.; Rousselle-Bourgeois, F.; Lefebvre, V. Resistance quantitative trait loci originating from Solanum sparsipilum act independently on the sex ratio of Globodera pallida and together for developing a necrotic reaction. Mol. Plant-Microbe Interact. 2005, 18, 1186–1194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klimenko, N.S.; Gavrilenko, T.A.; Kostina, L.I.; Mamadbokirova, F.T.; Antonova, O.Y. Search for resistance sources to Globodera pallida and potato virus X in the collection of potato varieties using molecular markers. Plant Biotech. Breed. 2019, 2, 42–48. (In Russian) [Google Scholar] [CrossRef]
- Brickell, C.D.; Alexander, C.; Cubey, J.J.; David, J.C.; Hoffman, M.H.A.; Leslie, A.C.; Malécot, V.; Jin, X. International Code of Nomenclature for Cultivated Plants, 9th ed.; Scripta Horticulturae: Leuven, Belgium, 2016. [Google Scholar]
- European and Mediterranean Plant Protection Organization/Organisation Européenne et Méditerranéenne pour la Protection des Plantes/(OEPP/EPPO). Testing of Potato Varieties to Assess Resistance to Globodera rostochiensis and G. pallida; OEPP/EPPO Bulletin; John Wiley & Sons, Inc.: New York, NY, USA, 2006; Volume 36, pp. 419–420. [Google Scholar]
- Julius Kühn-Institut Bundesforschungsinstitut für Kulturpflanzen. Bekanntmachung von Kartoffelsorten mit Resistenz gegen Kartoffelkrebs (Synchytrium endobioticum) und Kartoffelzystennematoden (Globodera rostochiensis und Globodera pallida). Bundesministerium der Justiz und für verbraucherschutz. 2014. Available online: https://www.julius-kuehn.de/media/Veroeffentlichungen/Bekanntmachungen/014_BAnz_AT_18.06.2014_B6_Kartoffelkrebs.pdf (accessed on 30 September 2021).
- Potato Variety Database. Available online: https://varieties.ahdb.org.uk/ (accessed on 30 September 2021).
- SOLANA GmbH. Available online: www.solana.de (accessed on 30 September 2021).
- Gavrilenko, T.; Antonova, O.; Shuvalova, A.; Krylova, E.; Alpatyeva, N.; Spooner, D.M.; Novikova, L. Genetic diversity and origin of cultivated potatoes based on plastid microsatellite polymorphism. Genet. Resour. Crop Evol. 2013, 60, 1997–2015. [Google Scholar] [CrossRef]
- van der Voort, R.J.; Wolters, P.; Folkertsma, R.; Hutten, R.; van Zandvoort, P.; Vinke, H.; Kanyuka, K.; Bendahmane, A.; Jacobsen, E.; Janssen, R.; et al. Mapping of the cyst nematode resistance locus Gpa2 in potato using a strategy based on comigrating AFLP markers. Theor. Appl. Genet. 1997, 95, 874–880. [Google Scholar] [CrossRef]
- Bendahmane, A.; Kanyuka, K.; Baulcombe, D. High-resolution genetical and physical mapping of the Rx gene for extreme resistance to potato virus X in tetraploid potato. Theor. Appl. Genet. 1997, 95, 153–162. [Google Scholar] [CrossRef]
- van der Voort, R.J.; Kanyuka, K.; van der Vossen, E.; Bendahmane, A.; Mooijman, P.; Klein-Lankhorst, R.; Stiekema, W.; Baulcombe, D.; Bakker, J. Tight Physical Linkage of the Nematode Resistance Gene Gpa2 and the Virus Resistance Gene Rx on a Single Segment Introgressed from the Wild Species Solanum tuberosum subsp. Andigena CPC 1673 into Cultivated Potato. Mol. Plant Microbe Interact. 1999, 12, 197–206. [Google Scholar] [CrossRef] [Green Version]
- Meksem, K.; Leister, D.; Peleman, J.; Zabeau, M.; Salamini, F.; Gebhardt, C. A high-resolution map of the vicinity of the R1 locus on chromosome V of potato based on RFLP and AFLP markers. Mol. Gen. Genet. 1995, 249, 74–81. [Google Scholar] [CrossRef]
- van der Voort, R.J.; van der Vossen, E.; Bakker, E.; Overmars, H.; van Zandvoort, P.; Hutten, R.; Klein Lankhorst, R.; Bakker, J. Two additive QTLs conferring broad-spectrum resistance in potato to Globodera pallida are localized on resistance gene clusters. Theor. App. Genet. 2000, 101, 1122–1130. [Google Scholar] [CrossRef]
- Dialat Ltd. Available online: http://dialat.ru (accessed on 30 September 2021).
- Evrogen. Available online: https://evrogen.ru/ (accessed on 30 September 2021).
- SibEnzyme. Available online: www.russia.sibenzyme.com (accessed on 30 September 2021).
- Ellenby, C. Resistance to the Potato Root Eelworm, Heterodera rostochiensis Wollenweber. Nature 1952, 170, 1016. [Google Scholar] [CrossRef]
- Minnis, S.T.; Haydock, P.P.J.; Ibrahim, S.K.; Grove, I.G.; Evans, K.; Russell, M.D. Potato cyst nematodes in England and Wales—occurrence and distribution. Ann. Appl. Biol. 2002, 140, 187–195. [Google Scholar] [CrossRef]
- Camacho, M.J.; de Andrade, E.; Mota, M.; Nobrega, F.; Vicente, C.; Rusinque, L.; Inácio, M.L. Potato Cyst Nematodes: Geographical Distribution, Phylogenetic Relationships and Integrated Pest Management Outcomes in Portugal. Front. Plant Sci. 2020, 11, 606178. [Google Scholar] [CrossRef]
- Brodie, B.B. The occurrence of a second pathotype of potato cyst nematodes in New York. J. Nematol. 1995, 27, 493–494. [Google Scholar]
- Brodie, B.B. The identification and distribution of a second pathotype of potato cyst nematodes in the United States. Nematropica 1996, 26, 246. [Google Scholar]
- Lopez-Pardo, R.; Barandalla, L.; Ritter, E.; de Galarreta, R.J.I. Validation of molecular markers for pathogen resistance in potato. Plant Breed. 2013, 132, 246–251. [Google Scholar] [CrossRef]
- Dalton, E.; Griffin, D.; Gallagher, T.F.; de Vetten, N.; Milbourne, D. The effect of pyramiding two potato cyst nematode resistance loci to Globodera pallida Pa2/3 in potato. Mol. Breed. 2013, 31, 921–930. [Google Scholar] [CrossRef]
- Rigney, B.; Blok, V.C.; Griffin, D.; Dalton, E.; Milbourne, D. Consistent action of two partially effective loci conferring resistance to Globodera pallida Pa2/3 across multiple nematode field populations. Plant Pathol. 2017, 66, 1031–1040. [Google Scholar] [CrossRef]
- Barone, A.; Ritter, E.; Schachtschabel, U.; Debener, T.; Salamini, F.; Gebhardt, C. Localization by restriction fragment length polymorphism mapping in potato of a major dominant gene conferring resistance to the potato cyst nematode Globodera rostochiensis. Mol. Gen. Genet. 1990, 224, 177–182. [Google Scholar] [CrossRef]
- Turner, S.J.; Fleming, C.C. Multiple Selection of Potato Cyst Nematode Globodera pallida Virulence on a Range of Potato Species. I. Serial Selection on Solanum-hybrids. Eur. J. Plant Pathol. 2002, 108, 461–467. [Google Scholar] [CrossRef]
Relative Susceptibility (% of Eggs and Larvae to Susceptible Control) | Score | Resistance |
---|---|---|
<1 | 9 | Very high |
1.1–3 | 8 | High/very high |
3.1–5 | 7 | High |
5.1–10 | 6 | Moderate/high |
10.1–15 | 5 | Moderate |
15.1–25 | 4 | Moderate/low |
25.1–50 | 3 | Low |
50.1–100 | 2 | Low/very low |
>100 | 1 | Very low |
Cultivar | Ro5 | Pa3 | Ro1 |
---|---|---|---|
Alouette | – | S | R |
Damaris | R | – | R |
Estrella | R | – | R |
Labella | S | S | R |
Queen Anne | S | S | R |
Red Lady | S | S | R |
Red Scarlett | – | – | R |
Gene/QTL | Chromosome | Source of Introgressed Gene (QTL) 1 | Pathotype | Marker | Primer Sequence | Annealing Temperature | References for Primer- and Marker-Developers |
---|---|---|---|---|---|---|---|
Gpa2 | XII | adg | Pa2,3 | Gpa2-1 | F: TTTAGCACGGAATGTGGGGA | 60 | [39] |
R: GTTTCCCCATCAAAACTCAC | |||||||
GP34/TaqI | F: CGTTGCTAGGTAAGCATGAAGAAG | 62 | [68,69] | ||||
R: GTTATCGTTGATTTCTCGTTCCG | |||||||
77R/HaeIII | F: CTCGAGGGATTGAATCCAAATTAT | 57 | [70] | ||||
R: GGAAGCAGAATACTCCTGACTACT | |||||||
GpaVsspl_ QTL | V | spl | Pa2,3 | TG432/DraI | F: GGACAGTCATCAGATTGTGG | 66 | [60] |
R: GTACTCCTGCTTGAGCCATT | |||||||
GP179/EcoRV | F: GGTTTTAGTGATTGTGCTGC | 55 | [60,71] | ||||
R: AATTTCAGACGAGTAGGCACT | |||||||
Grp1_QTL | V | vrn, opl, adg, tub | Ro5; Pa2,3 | TG432/RsaI | F: GGACAGTCATCAGATTGTGG | 66 | [33] |
R: GTACTCCTGCTTGAGCCATT | |||||||
Grp1_QTL | V | vrn, opl, adg, tbr | Ro5; Pa2,3 | GP21/DraI | F: GGTTGGTGGCCTATTAGCCA | 55 | [32,71] |
Gpa5_QTL | V | vrn | Pa2,3 | R: GCTCCAACACGGAAGGTTTTC | |||
Grp1_QTL | V | vrn, opl, adg, tub | Ro5; Pa2,3 | GP179/RsaI | F: GGTTTTAGTGATTGTGCTGC | 55 | [32,71,72] |
Gpa5_QTL | V | vrn | Pa2,3 | R: AATTTCAGACGAGTAGGCACT | |||
Gpa5_QTL | V | vrn | Pa2,3 | SPUD1636 | F: GTGCGCACAGGGTAAAACC | 65 → 60 | [46] |
R: ACCTTAGCGGATGAAAGCC | |||||||
GpaVvrn_QTL | V | vrn | Pa2,3 | HC | F: ACACCACCTGTTTGATAAAAAACT | 65 → 60 | [34] |
R: GCCTTACTTCCCTGCTGAAG |
№ | Cultivar | Average Number of Cysts in 500 cm3 of Soil | Average Number of Eggs and Larvae per 500 cm3 of Soil | Relative Susceptibility | Cultivar Response (1–9 EPPO Scale) | Resistance Group for Pathotype Ro5 of Golden Nematode | Results of Molecular Screening with Markers | Declared Resistance Group for Pathotype Ro1 of Golden Nematode | Presence of the Gro1-4 Marker ** | ||
---|---|---|---|---|---|---|---|---|---|---|---|
TG432/ RsaI | GP179/ RsaI | GP21/ DraI | |||||||||
Domestic cultivars | |||||||||||
1 | Alyj parus | 0.0 | 0.0 | 0.0 | 9 | R | + | + | − | − * | − |
2 | Antonina | 9.0 | 7683.4 | 7.7 | 6 | MR | − | + | + | − | |
3 | Čaroit | 16.6 | 15,530.1 | 15.7 | 4 | S | − | − | − | S | − |
4 | Danaâ | 0.0 | 0.0 | 0.0 | 9 | R | + | − | + | S | − |
5 | Evraziâ | 0.0 | 0.0 | 0.0 | 9 | R | − | + | + | R | − |
6 | Grand | 7.8 | 10,536.0 | 10.6 | 5 | MR | − | + | + | R | + |
7 | Gusar | 0.0 | 0.0 | 0.0 | 9 | R | − | + | + | R | − |
8 | Holmogorskij | 0.5 | 0.0 | 0.0 | 9 | R | + | + | + | R | − |
9 | Il’inskij | 2.1 | 1060.6 | 1.0 | 9 | R | + | + | + | S | − |
10 | Kolobok | 13.6 | 11,772.8 | 11.9 | 5 | MR | − | + | + | S | − |
11 | Krasavčik | 58.5 | 69,024.0 | 69.8 | 2 | S | + | + | + | S | − |
12 | Krepyš | 0.0 | 0.0 | 0.0 | 9 | R | + | + | + | R | − |
13 | Liga | 0.0 | 0.0 | 0.0 | 9 | R | + | + | + | R | − |
14 | Lomonosovskij | 32.8 | 23,557.8 | 23.8 | 4 | S | + | + | + | S | − |
15 | Lûbava | 98.9 | 59,435.5 | 60.1 | 2 | S | + | + | + | S | − |
16 | Meteor | 0.0 | 0.0 | 0.0 | 9 | R | + | + | + | R | − |
17 | Naâda | 0.0 | 0.0 | 0.0 | 9 | R | − | + | + | R | − |
18 | Nakra | 10.0 | 5294.5 | 5.3 | 6 | MR | + | + | + | S | − |
19 | Nevskij | 80.8 | 98,775.1 | 100.0 | 1 | S | + | − | − | S | − |
20 | Plamâ | 50.6 | 64,727.8 | 65.5 | 2 | S | + | + | + | R | + |
21 | Samba | 9.0 | 10,544.5 | 10.6 | 5 | MR | + | + | + | S | + |
22 | Sirenevyj tuman | 4.0 | 540.2 | 0.5 | 9 | R | + | + | − | S | − |
23 | Tango | 22.8 | 28,137.7 | 28.4 | 3 | S | − | + | + | − * | − |
24 | Utro | 6.5 | 789.4 | 0.7 | 9 | R | + | − | + | S | − |
25 | Varâg | 19.9 | 19,098.3 | 19.3 | 4 | S | + | + | + | S | − |
26 | Vympel | 1.5 | 259.8 | 0.2 | 9 | R | + | + | + | R | − |
Foreign cultivars | |||||||||||
27 | Alouette | 20.4 | 24,383.2 | 24.6 | 5 | MR | + | + | − | R | − |
28 | Red Scarlett | 0.0 | 0.0 | 0.0 | 9 | R | + | + | − | R | − |
Controls | |||||||||||
29 | Damaris | 0.0 | 0.0 | 0.0 | 9 | R | + | + | − | R | + |
30 | Estrella | 0.0 | 0.0 | 0.0 | 9 | R | + | − | − | R | + |
31 | Labella | 19.0 | 23,524.6 | 23.8 | 4 | S | + | − | − | R | − |
32 | Queen Anne | 59.0 | 77,158.5 | 78.1 | 2 | S | + | − | − | R | − |
33 | Red Lady | 41.1 | 45,225.0 | 45.7 | 3 | S | + | + | + | R | − |
Totally estimated cultivars (N) including: N = 33: 16 R (score 9), 6 MR (score 5–6), 11 S (score 1–4) | |||||||||||
No. (%) of highly resistant (score 9) cultivars with the marker | 13 of 16 (81.3%) | 13 of 16 (81.3%) | 11 of 16 (68.8%) | ||||||||
No. (%) of highly resistant (score 9) cultivars without the marker | 3 of 16 (18.7%) | 3 of 16 (18.7%) | 5 of 16 (31.2%) | ||||||||
No. (%) of susceptible (score 1–4) cultivars with marker | 9 of 11 (81.8%) | 7 of 11 (63.6%) | 7 of 11 (63.6%) | ||||||||
No. (%) of susceptible (score 1–4) cultivars without the marker | 2 of 11 (18.2%) | 4 of 11 (36.4%) | 4 of 11 (36.4%) | ||||||||
No. of moderately resistant (score 5–6) cultivars with marker | 3 of 6 | 6 of 6 | 5 of 6 | ||||||||
No. of moderately resistant (score 5–6) cultivars without marker | 3 of 6 | 0 of 6 | 1 of 6 |
№ | Cultivars | Average Number of Cysts in 500 cm3 of Soil | Average Number of Eggs and Larvae per 500 cm3 of Soil | Relative Susceptibility | Cultivar Response (1–9 Scale) |
---|---|---|---|---|---|
Domestic cultivars | |||||
1 | Alyj parus | 15.5 | 21,142.6 | 66.0 | 2 |
2 | Antonina | 23.5 | 24,157.1 | 75.4 | 2 |
3 | Čaroit | 14.7 | 20,856.0 | 65.1 | 2 |
4 | Danaâ | 0.0 | 0.0 | 0.0 | 9 |
5 | Grand | 7.5 | 5060.4 | 15.8 | 4 |
6 | Gusar | 81.4 | 117,851.5 | 367.9 | 1 |
7 | Krasavčik | 7.5 | 6370.8 | 19.8 | 4 |
8 | Krepyš | 52.1 | 66,204.5 | 206.7 | 1 |
9 | Lomonosovskij | 123.0 | 129,119.7 | 403.1 | 1 |
10 | Naâda | 74.2 | 59,727.8 | 186.5 | 1 |
11 | Nevskij | 27.7 | 32,025.0 | 100.0 | 1 |
12 | Plamâ | 44.6 | 56,282.6 | 175.7 | 1 |
13 | Samba | 7.2 | 2705.8 | 8.4 | 6 |
14 | Tango | 131.0 | 32,517.1 | 101.5 | 1 |
15 | Utro | 24.1 | 18,682.5 | 58.3 | 2 |
16 | Vympel | 0.0 | 0.0 | 0.0 | 9 |
Foreign cultivar | |||||
17 | Red Scarlett | 19.0 | 16,810.3 | 52.4 | 2 |
Controls | |||||
18 | Alouette | 33.6 | 38,369.6 | 119.8 | 1 |
19 | Red Lady | 32.3 | 40,028.1 | 124.9 | 1 |
№ | Cultivar | Cultivar Response (1–9 Scale) for Pa3 | Resistance Group | QTLs/Markers | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Gpa2 | Grp1_QTL | GpaVSspl_QTL | GpaVvrn_QTL | |||||||||
Gpa2-1 | 77R/ HaeIII | GP34/ TaqI-520 bp | GP34/ TaqI-550 bp | TG432/ RsaI | GP21/ DraI | GP179/RsaI | GP179/EcoRV | HC | ||||
1 | Alyj parus | 2 | S | + | + | + | + | + | − | + | + | − |
2 | Antonina | 2 | S | − | − | + | + | − | + | + | + | * |
3 | Čaroit | 2 | S | + | + | − | − | − | − | − | − | − |
4 | Danaâ | 9 | R | + | + | + | − | + | + | − | − | + |
5 | Grand | 4 | S | − | − | + | + | − | + | + | + | − |
6 | Gusar | 1 | S | − | − | − | + | − | + | + | + | − |
7 | Krasavčik | 4 | S | − | − | − | + | + | + | + | + | * |
8 | Krepyš | 1 | S | − | − | + | + | + | + | + | + | − |
9 | Lomonosovskij | 1 | S | − | − | + | + | + | + | + | + | + |
10 | Naâda | 1 | S | − | − | + | − | − | + | + | + | * |
11 | Nevskij | 1 | S | − | − | + | − | + | − | − | − | − |
12 | Plamâ | 1 | S | − | − | + | + | + | + | + | + | − |
13 | Samba | 6 | MR | − | − | + | − | + | + | + | + | − |
14 | Tango | 1 | S | − | − | − | − | − | + | + | + | + |
15 | Utro | 2 | S | + | + | − | − | + | + | − | − | − |
16 | Vympel | 9 | R | + | + | + | + | + | + | + | + | * |
Controls | ||||||||||||
17 | Alouette | 1 | S | − | − | + | − | + | − | + | + | − |
18 | Red Lady | 1 | S | − | − | − | − | + | + | + | + | + |
19 | Red Scarlett | 2 | S | − | − | + | + | + | − | + | + | + |
Totally estimated cultivars (N) including: N = 19: 2 R (score 9), 1 MR (score 6), 16 S (score 1–4) | ||||||||||||
No. of resistant (score 9) cultivars with the marker | 2 of 2 | 2 of 2 | 2 of 2 | 1 of 2 | 2 of 2 | 2 of 2 | 1 of 2 | 1 of 2 | ||||
No. of resistant (score 9) cultivars without the marker | 0 | 0 | 0 | 1 of 2 | 0 | 0 | 1 of 2 | 1 of 2 | ||||
No. of susceptible (score 1–4) cultivars with marker | 3 of 16 | 3 of 16 | 10 of 16 | 9 of 16 | 10 of 16 | 11 of 16 | 13 of 16 | 13 of 16 | ||||
No. (%) of susceptible (score 1–4) cultivars without the marker | 13 of 16 (81.3%) | 13 of 16 (81.3%) | 6 of 16 (37.5%) | 7 of 16 (43.8%) | 6 of 16 (37.5%) | 5 of 16 (31.3%) | 3 of 16 (18.8%) | 3 of 16 (18.8%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gavrilenko, T.A.; Khiutti, A.V.; Klimenko, N.S.; Antonova, O.Y.; Fomina, N.A.; Afanasenko, O.S. Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes. Agronomy 2021, 11, 2400. https://doi.org/10.3390/agronomy11122400
Gavrilenko TA, Khiutti AV, Klimenko NS, Antonova OY, Fomina NA, Afanasenko OS. Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes. Agronomy. 2021; 11(12):2400. https://doi.org/10.3390/agronomy11122400
Chicago/Turabian StyleGavrilenko, Tatjana A., Aleksander V. Khiutti, Natalia S. Klimenko, Olga Y. Antonova, Natalia A. Fomina, and Olga S. Afanasenko. 2021. "Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes" Agronomy 11, no. 12: 2400. https://doi.org/10.3390/agronomy11122400