Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Phenotyping Coleoptile Length and Seedling Root Length
2.3. Phenotyping for Plant Height
2.4. DNA Extraction
2.5. Genotyping PCR Amplification of Kompetitive Allele Specific PCR
2.6. Cluster Analysis of Genotypic Data
2.7. Statistical Analysis and Data Visualization
3. Results
3.1. Allelic Frequency at the Rht-B1 and Rht-D1 Loci
3.2. Distinct Genetic Clusters Identified Based on Genotypic Data
3.3. Effect of Rht-B1 and Rht-D1 Loci on Seedling Vigor Traits
3.4. Effect of Breeding History on Coleoptile and Root Length
3.5. Identification of Likely Semi-Dwarf Accessions with Seedling Vigor Potential
3.6. Effect of GA3 Treatment by Genotype
3.7. Identification of Accessions with GA-Responsive Coleoptiles
4. Discussion
4.1. Allelic Variation at Rht Loci in the NWDP Population
4.2. Effects of Dwarfing Alleles at Rht Loci on Coleoptile and Seedling Root Length
4.3. Identification of Candidate NWDP Accessions Possessing Rht-B1b and Rht-D1b Alleles for Longer Coleoptile Length and Other Seedling Vigor Traits
4.4. The Need to Genotype Other GA-Responsive Rht Genes
5. Conclusions and Future Perspectives
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Amram, A.; Fadida-Myers, A.; Golan, G.; Nashef, K.; Ben-David, R.; Peleg, Z. Effect of GA-sensitivity on wheat early vigor and yield components under deep sowing. Front. Plant Sci. 2015, 6, 487. [Google Scholar] [CrossRef]
- Rebetzke, G.J.; Ellis, M.H.; Bonnett, D.G.; Richards, R.A. Molecular mapping of genes for Coleoptile growth in bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 2007, 114, 1173–1183. [Google Scholar] [CrossRef]
- Rebetzke, G.J.; Richards, R.A.; Fettell, N.A.; Long, M.; Condon, A.G.; Forrester, R.I.; Botwright, T.L. Genotypic increases in coleoptile length improves stand establishment, vigour and grain yield of deep-sown wheat. F. Crop. Res. 2007, 100, 10–23. [Google Scholar] [CrossRef]
- Li, G.; Bai, G.; Carver, B.F.; Elliott, N.C.; Bennett, R.S.; Wu, Y.; Hunger, R.; Bonman, J.M.; Xu, X. Genome-wide association study reveals genetic architecture of coleoptile length in wheat. Theor. Appl. Genet. 2017, 130, 391–401. [Google Scholar] [CrossRef]
- Bovill, W.D.; Hyles, J.; Zwart, A.B.; Ford, B.A.; Perera, G.; Phongkham, T.; Brooks, B.J.; Rebetzke, G.J.; Hayden, M.J.; Hunt, J.R.; et al. Increase in coleoptile length and establishment by Lcol-A1, a genetic locus with major effect in wheat. BMC Plant Biol. 2019, 19, 332. [Google Scholar] [CrossRef] [PubMed]
- Khadka, K.; Earl, H.J.; Raizada, M.N.; Navabi, A. A physio-morphological trait-based approach for breeding drought tolerant wheat. Front. Plant Sci. 2020, 11, 715. [Google Scholar] [CrossRef] [PubMed]
- Würschum, T.; Liu, G.; Boeven, P.H.G.; Longin, C.F.H.; Mirdita, V.; Kazman, E.; Zhao, Y.; Reif, J.C. Exploiting the Rht portfolio for hybrid wheat breeding. Theor. Appl. Genet. 2018, 131, 1433–1442. [Google Scholar] [CrossRef] [PubMed]
- Murphy, K.; Balow, K.; Lyon, S.R.; Jones, S.S. Response to selection, combining ability and heritability of coleoptile length in winter wheat. Euphytica 2008, 164, 709–718. [Google Scholar] [CrossRef]
- Farhad, M.; Hakim, M.A.; Alam, M.A.; Barma, N.C.D. Screening wheat genotypes for coleoptile length: A trait for drought tolerance. Am. J. Agric. For. 2014, 2, 237–245. [Google Scholar] [CrossRef][Green Version]
- Akram, M. Growth and yield components of wheat under water stress of different growth stages. Bangladesh J. Agric. Res. 2011, 36, 455–468. [Google Scholar] [CrossRef]
- Khadka, K.; Raizada, M.N.; Navabi, A. Recent progress in germplasm evaluation and gene mapping to enable breeding of drought-tolerant wheat. Front. Plant Sci. 2020, 11, 1149. [Google Scholar] [CrossRef]
- Lopes, M.S.; Reynolds, M.P. Partitioning of assimilates to deeper roots is associated with cooler canopies and increased yield under drought in wheat. Funct. Plant Biol. 2010, 37, 147–156. [Google Scholar] [CrossRef]
- Richard, C.A.; Hickey, L.T.; Fletcher, S.; Jennings, R.; Chenu, K.; Christopher, J.T. High-throughput phenotyping of seminal root traits in wheat. Plant Methods 2015, 11, 13. [Google Scholar] [CrossRef] [PubMed]
- Dhanda, S.S.; Sethi, G.S.; Behl, R.K. Indices of drought tolerance in wheat genotypes at early stages of plant growth. J. Agron. Crop Sci. 2004, 190, 6–12. [Google Scholar] [CrossRef]
- Wasaya, A.; Zhang, X.; Fang, Q.; Yan, Z. Root phenotyping for drought tolerance: A review. Agronomy 2018, 8, 241. [Google Scholar] [CrossRef]
- Schillinger, W.F.; Donaldson, E.; Allan, R.E.; Jones, S.S. Winter wheat seedling emergence from deep sowing depths. Agron. J. 1998, 90, 582–586. [Google Scholar] [CrossRef]
- Wilhelm, E.P.; Boulton, M.I.; Al-Kaff, N.; Balfourier, F.; Bordes, J.; Greenland, A.J.; Powell, W.; Mackay, I.J. Rht-1 and Ppd-D1 associations with height, GA sensitivity, and days to heading in a worldwide bread wheat collection. Theor. Appl. Genet. 2013, 126, 2233–2243. [Google Scholar] [CrossRef]
- Chen, L.; Phillips, A.L.; Condon, A.G.; Parry, M.A.J.; Hu, Y.G. GA-responsive dwarfing gene Rht12 effects the developmental and agronomic traits in common bread wheat. PLoS One 2013, 8, e62285. [Google Scholar]
- Ellis, M.H.; Rebetzke, G.J.; Azanza, F.; Richards, R.a.; Spielmeyer, W. Molecular mapping of gibberellin-responsive dwarfing genes in bread wheat. Theor. Appl. Genet. 2005, 111, 423–430. [Google Scholar] [CrossRef] [PubMed]
- Vikhe, P.; Venkatesan, S.; Chavan, A.; Tamhankar, S.; Patil, R. Mapping of dwarfing gene Rht14 in durum wheat and its effect on seedling vigor, internode length and plant height. Crop J. 2019, 7, 187–197. [Google Scholar] [CrossRef]
- Borojevic, K.; Borojevic, K. The transfer and history of ‘reduced height henes’’ (Rht) in wheat from Japan to Europe. J. Hered. 2005, 96, 455–459. [Google Scholar] [CrossRef] [PubMed]
- Nagel, M.; Behrens, A.K.; Börner, A. Effects of Rht dwarfing alleles on wheat seed vigour after controlled deterioration. Crop Pasture Sci. 2013, 64, 857–864. [Google Scholar] [CrossRef]
- Pavlista, A.D.; Santra, D.K.; Baltensperger, D.D. Bioassay of winter wheat for gibberellic acid sensitivity. Am. J. Plant Sci. 2013, 04, 2015–2022. [Google Scholar] [CrossRef]
- Chen, L.; Hao, L.; Condon, A.G.; Hu, Y.G. Exogenous GA3 application can compensate the morphogenetic effects of the GA-responsive dwarfing gene Rht12 in bread wheat. PLoS One 2014, 9, e86431. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Chen, J.; Wu, J.; Zhang, J.; Chu, D.; See, D.; Brown-Guedira, G.; Zementra, R.; Souza, E. Quantitative trait loci analysis for the effect of Rht-B1 dwarfing gene on coleoptile length and seedling root length and number of bread wheat. Crop Sci. 2011, 51, 2561–2568. [Google Scholar] [CrossRef]
- Wojciechowski, T.; Gooding, M.J.; Ramsay, L.; Gregory, P.J. The effects of dwarfing genes on seedling root growth of wheat. J. Exp. Bot. 2009, 60, 2565–2573. [Google Scholar] [CrossRef] [PubMed]
- Manske, G.G.B.; Ortiz-Monasterio, J.I.; Van Ginkel, R.M.; Rajaram, S.; Vlek, P.L.G. Phosphorus use efficiency in tall, semi-dwarf and dwarf near-isogenic lines of spring wheat. Euphytica 2002, 125, 113–119. [Google Scholar] [CrossRef]
- Chen, H.; Moakhar, N.P.; Iqbal, M.; Pozniak, C.; Hucl, P.; Spaner, D. Genetic variation for flowering time and height reducing genes and important traits in western Canadian spring wheat. Euphytica 2016, 208, 377–390. [Google Scholar] [CrossRef]
- Li, L.; Peng, Z.; Mao, X.; Wang, J.; Chang, X.; Reynolds, M.; Jing, R. Genome-wide association study reveals genomic regions controlling root and shoot traits at late growth stages in wheat. Ann. Bot. 2019, 124, 993–1006. [Google Scholar] [CrossRef] [PubMed]
- Jatayev, S.; Sukhikh, I.; Vavilova, V.; Smolenskaya, S.E.; Goncharov, N.P.; Kurishbayev, A.; Zotova, L.; Absattarova, A.; Serikbay, D.; Hu, Y.G.; et al. Green revolution ‘stumbles’ in a dry environment: Dwarf wheat with Rht genes fails to produce higher grain yield than taller plants under drought. Plant Cell Environ. 2020, 43, 2355–2364. [Google Scholar] [CrossRef]
- MoAD Nepal. Statistical information on Nepalese Agriculture; Government of Nepal, Ministry of Agricultural Development Agribusiness Promotion and Statistics Division, Agri Statistics section Singha Durbar: Kathmandu, Nepal, 2017. [Google Scholar]
- DHM-MoSTE Nepal. Agroclimatic atlas of Nepal; Government of Nepal, Department of Hydrology and Meteorology, Ministory of Science and Teconology, and Environment: Kathmandu, Nepal, 2013.
- Alam, M.; Kashif, M.; Easterly, A.C.; Wang, F.; Boehm, J.D.; Baenziger, P.S. Coleoptile length comparison of three winter small grain cereals adapted to the Great Plains. Cereal Res. Commun. 2021. [Google Scholar] [CrossRef]
- Khadka, K.; Torkamaneh, D.; Kaviani, M.; Belzile, F.; Raizada, M.N.; Navabi, A. Population structure of Nepali spring wheat (Triticum aestivum L.) germplasm. BMC Plant Biol. 2020, 20, 530. [Google Scholar] [CrossRef] [PubMed]
- Depauw, R.M.; Knox, R.E.; Mccaig, T.N.; Clarke, F.R.; Clarke, J.M. Carberry hard red spring wheat. Can. J. Plant Sci. 2011, 2, 529–534. [Google Scholar] [CrossRef]
- Bai, C.; Liang, Y.; Hawkesford, M.J. Identification of QTLs associated with seedling root traits and their correlation with plant height in wheat. J. Exp. Bot. 2013, 64, 1745–1753. [Google Scholar] [CrossRef] [PubMed]
- Placido, D.F.; Campbell, M.T.; Folsom, J.J.; Cui, X.; Kruger, G.R.; Baenziger, P.S.; Walia, H. Introgression of novel traits from a wild wheat relative improves drought adaptation in wheat. Plant Physiol. 2013, 161, 1806–1819. [Google Scholar] [CrossRef]
- Watt, M.; Moosavi, S.; Cunningham, S.C.; Kirkegaard, J.A.; Rebetzke, G.J.; Richards, R.A. A rapid, controlled-environment seedling root screen for wheat correlates well with rooting depths at vegetative, but not reproductive, stages at two field sites. Ann. Bot. 2013, 112, 447–455. [Google Scholar] [CrossRef] [PubMed]
- Würschum, T.; Langer, S.M.; Longin, C.F.H.; Tucker, M.R.; Leiser, W.L. A modern Green Revolution gene for reduced height in wheat. Plant J. 2017, 92, 892–903. [Google Scholar] [CrossRef]
- Patterson, H.D.; Williams, E.R. A new class of resolvable incomplete block designs. Biometrika 1976, 63, 83–92. [Google Scholar] [CrossRef]
- Ellis, M.H.; Spielmeyer, W.; Gale, K.R.; Rebetzke, G.J.; Richards, R.A. ‘Perfect’ markers for the Rht-B1b and Rht-D1b dwarfing genes in wheat. Theor. Appl. Genet. 2002, 105, 1038–1042. [Google Scholar] [CrossRef] [PubMed]
- Rasheed, A.; Wen, W.; Gao, F.; Zhai, S.; Jin, H.; Liu, J.; Guo, Q.; Zhang, Y.; Dreisigacker, S.; Xia, X.; et al. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor. Appl. Genet. 2016, 129, 1843–1860. [Google Scholar] [CrossRef] [PubMed]
- van Berloo, R. GGT 2.0: Versatile software for visualization and analysis of genetic data. J. Hered. 2008, 99, 232–236. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef] [PubMed]
- Core Team, R. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing. Available online: https://www.r-project.org/ (accessed on 1 March 2013).
- Kassambara, A.; Mundt, F. Factoextra: Extract and visualize the results of multivariate data analyses [Computer sofware, package]. R Packag. version 2017. [Google Scholar]
- Lê, S.; Josse, J.; Husson, F. FactoMineR: An R package for multivariate analysis. J. Stat. Softw. 2008, 25, 1–18. [Google Scholar] [CrossRef]
- Wickham, H. ggplot2. WIREs Comput. Stat. 2011, 3, 180–185. [Google Scholar] [CrossRef]
- Botwright, T.L.; Rebetzke, G.J.; Condon, A.G.; Richards, R.A. Influence of variety, seed position and seed source on screening for coleoptile length in bread wheat (Triticum aestivum L.). Euphytica 2001, 119, 349–356. [Google Scholar] [CrossRef]
- Dowla, M.A.N.N.U.; Edwards, I.; Hara, G.O.; Islam, S.; Ma, W. Developing wheat for improved yield and adaptation under a changing climate: Optimization of a few key genes. Engineering 2018, 4, 514–522. [Google Scholar] [CrossRef]
- Worland, A.J.; Sayers, E.J.; Korzun, V. Allelic variation at the dwarfing gene Rht8 locus and its significance in international breeding programmes. Euphytica 2001, 119, 155–159. [Google Scholar] [CrossRef]
- Worland, A.J.; Borner, A.; Korzun, V.; Li, W.M.; Petrovic, S.; Sayers, E.J. The influence of photoperiod genes on the adaptability of European winter wheats. Euphytica 1998, 100, 385–394. [Google Scholar] [CrossRef]
- Börner, A.; Röder, M.; Korzun, V. Comparative molecular mapping of GA insensitive Rht loci on chromosomes 4B and 4D of common wheat (Triticum aestivum L.). Theor. Appl. Genet. 1997, 95, 1133–1137. [Google Scholar] [CrossRef]
- Evans, L.T. Crop evolution, adaptation and yield; CUP: Cambridge, MA, USA, 1993. [Google Scholar]
- Morris, M.L.; Dubin, H.J.; Thaneshwar, P. Returns to wheat breeding research in Nepal. Agric. Econ. 1994, 10, 269–282. [Google Scholar] [CrossRef]
- Vijayaraghavan, K.; Majumder, R.; Naithani, M.; Kapur, R.; Kaur, P. Delivering genetic gain in wheat (DGGW): Status and opportunities for wheat seeds in India, Bangladesh, Nepal and Bhutan. McCandless, L., Ed.; Borlaug Global Rust Initiative: Ithaca, NY, USA, 2018. [Google Scholar]
- Joshi, B.K.; Mudwari, A.; Bhatta, M. Wheat genetic resources in Nepal. Nepal Agric. Res. J. 2006, 7, 1–9. [Google Scholar] [CrossRef]
- Timsina, K.P.; Gairhe, S.; Magar, D.B.T.; Ghimire, Y.N.; Gauchan, D.; Padhyoti, Y. On farm research is a viable means of technology verification, dissemination and adoption: A case of wheat research in Nepal. Agron. J. Nepal 2016, 4, 9–24. [Google Scholar] [CrossRef][Green Version]
- Paudel, M.N.; Joshi, B.K.; Ghimire, K.H. Management status of agricultural plant genetic resources in Nepal. Agron. J. Nepal 2016, 4, 75–91. [Google Scholar] [CrossRef]
- Rebetzke, G.J.; Appels, R.; Morrison, A.D.; Richards, R.A.; McDonald, G.; Ellis, M.H.; Spielmeyer, W.; Bonnett, D.G. Quantitative trait loci on chromosome 4B for coleoptile length and early vigour in wheat (Triticum aestivum L.). Aust. J. Agric. Res. 2001, 52, 1221–1234. [Google Scholar] [CrossRef]
- Rebetzke, G.J.; Verbyla, A.P.; Verbyla, K.L.; Morell, M.K.; Cavanagh, C.R. Use of a large multiparent wheat mapping population in genomic dissection of coleoptile and seedling growth. Plant Biotechnol. J. 2014, 12, 219–230. [Google Scholar] [CrossRef] [PubMed]
- Liatukas, Ž.; Ruzgas, V. Coleoptile length and plant height of modern tall and semi-dwarf European winter wheat varieties. Acta Soc. Bot. Pol. 2011, 80, 197–203. [Google Scholar] [CrossRef][Green Version]
- Keyes, G.J.; Paolillo, D.J.; Sorrells, M.E. The effects of dwarfing genes Rht1 and Rht2 on cellular dimensions and rate of leaf elongation in wheat. Ann. Bot. 1989, 64, 683–690. [Google Scholar] [CrossRef]
- Abdolshahi, R.; Foroodi-Safat, S.; Mokhtarifar, K.; Ataollahi, R.; Moud, A.M.; Kazemipour, A.; Pourseyedi, S.; Rahmani, A. Challenges of breeding for longer coleoptile in bread wheat (Triticum aestivum L.). Genet. Resour. Crop Evol. 2021, 68, 1517–1527. [Google Scholar] [CrossRef]
- Tang, T.; Botwright Acuña, T.; Spielmeyer, W.; Richards, R.A. Effect of gibberellin-sensitive Rht18 and gibberellin-insensitive Rht-D1b dwarfing genes on vegetative and reproductive growth in bread wheat. J. Exp. Bot. 2021, 72, 445–458. [Google Scholar] [CrossRef] [PubMed]
- Bostrack, J.M.; Struckmeyer, B.E. Effect of gibberellic acid on the growth and anatomy of Coleus blumei, Antirrhinum majus and Salvia splendens. New Phytol. 1967, 66, 539–544. [Google Scholar] [CrossRef]
- Bachelard, E.P. Effects of seed treatments with gibberellic acid on subsequent growth of some eucalypt seedlings. New Phytol. 1968, 67, 595–604. [Google Scholar] [CrossRef]
- Zhao, J.; Wang, Z.; Liu, H.; Zhao, J.; Li, T.; Hou, J.; Zhang, X.; Hao, C. Global status of 47 major wheat loci controlling yield, quality, adaptation and stress resistance selected over the last century. BMC Plant Biol. 2019, 19, 5. [Google Scholar] [CrossRef] [PubMed]
- Casebow, R.; Hadley, C.; Uppal, R.; Addisu, M.; Loddo, S.; Kowalski, A.; Griffiths, S.; Gooding, M. Reduced height (Rht) alleles affect wheat grain quality. PLoS One 2016, 11, e0156056. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, S.; Mohan, A.; Gill, K.S.; Vara Prasad, P.V. Variability of root traits in spring wheat germplasm. PLoS One 2014, 9, e100317. [Google Scholar] [CrossRef] [PubMed]
- Rebetzke, G.J.; Richards, R.A.; Fischer, V.M.; Mickelson, B.J. Breeding long coleoptile, reduced height wheats. Euphytica 1999, 106, 159–168. [Google Scholar] [CrossRef]
- Tian, X.; Wen, W.; Xie, L.; Fu, L.; Xu, D.; Fu, C.; Wang, D.; Chen, X.; Xia, X.; Chen, Q.; et al. Molecular mapping of reduced plant height gene Rht24 in bread wheat. Front. Plant Sci. 2017, 8, 1379. [Google Scholar] [CrossRef]
- Grant, N.; Mohan, A.; Sandhu, D.; Gill, K. Inheritance and genetic mapping of the reduced height (Rht18) gene in wheat. Plants 2018, 7, 58. [Google Scholar] [CrossRef] [PubMed]
- Rebetzke, G.J.; Bruce, S.E.; Kirkegaard, J.A. Longer coleoptiles improve emergence through crop residues to increase seedling number and biomass in wheat (Triticum aestivum L.). Plant Soil 2005, 272, 87–100. [Google Scholar] [CrossRef]
- Landjeva, S.; Karceva, T.; Korzun, V.; Ganeva, G. Seedling growth under osmotic stress and agronomic traits in Bulgarian semi-dwarf wheat: Comparison of genotypes with Rht8 and/or Rht-B1 genes. Crop Pasture Sci. 2011, 62, 1017–1025. [Google Scholar] [CrossRef]
- Asplund, L.; Leino, M.W.; Hagenblad, J. Allelic variation at the Rht8 locus in a 19th century wheat collection. Sci. World J. 2012, 2012, 385610. [Google Scholar] [CrossRef] [PubMed]
- Grover, G.; Sharma, A.; Gill, H.S.; Srivastava, P.; Bains, N.S. Rht8 gene as an alternate dwarfing gene in elite Indian spring wheat cultivars. PLoS One 2018, 13, e0199330. [Google Scholar] [CrossRef] [PubMed]
- Bazhenov, M.S.; Divashuk, M.G.; Amagai, Y.; Watanabe, N.; Karlov, G.I. Isolation of the dwarfing Rht-B1p (Rht17) gene from wheat and the development of an allele-specific PCR marker. Mol. Breed. 2015, 35, 213. [Google Scholar] [CrossRef]
Marker Type | Genes | Primer | Primer Sequence (5′-3′) | Alleles | References |
---|---|---|---|---|---|
KASP | Rht-B1 | FAM | CCCATGGCCATCTCCAGCTG | FAM (wt) | [41] [42] |
HEX | CCCATGGCCATCTCCAGCTA | HEX (dwarf) | |||
Common reverse | TCGGGTACAAGGTGCGGGCG | ||||
Rht-D1 | FAM | CATGGCCATCTCGAGCTGCTC | FAM (wt) | [41] [42] | |
HEX | CATGGCCATCTCGAGCTGCTA | HEX (dwarf) | |||
Common reverse | CGGGTACAAGGTGCGCGCC |
Locus § | ||||
---|---|---|---|---|
Population/Group | Rht-B1 | Rht-D1 | ||
Wild Type (Allele a) | Dwarf (Allele b) | Wild Type (Allele a) | Dwarf (Allele b) | |
Whole panel | 173 (54.40%) | 145 (45.60%) | 283 (88.99%) | 35 (11.01%) |
Landraces | 148 (89.2%) | 18 (10.8%) | 151 (91%) | 15 (9%) |
CIMMYT lines | 4 (3.5%) | 111 (96.5%) | 108 (93.9%) | 7 (6.1%) |
Released varieties | 19 (55.9%) | 15 (44.1%) | 21 (61.8%) | 13 (38.2%) |
Genes | § Alleles | Traits | |||
---|---|---|---|---|---|
Coleoptile Length (mm) | Seedling Root Length (mm) | ||||
Mean * | SD | Mean * | SD | ||
Rht-B1 | a | 52.85 a | ±6.98 | 102.23 b | ±20.60 |
b | ±4.36 | 107.59 a | ±17.82 | ||
Rht-D1 | a | 47.34 a | ±9.22 | 104.02 a | ±19.73 |
b | 43.59 b | ±4.11 | 109.62 a | ±17.59 | |
Gene Interactions | |||||
Rht-B1/Rht-D1 | aa | 54.52 a | ±6.23 | 100.49 a | ±20.75 |
ab | 44.13 a | ±3.10 | 111.45 a | ±17.41 | |
ba | 39.59 b | ±4.23 | 107.89 a | ±17.85 | |
bb | 40.73 b | ±7.56 | 99.79 a | ±16.89 |
Seed Source Groups | Coleoptile Length (Control) (mm) § | Root Length (Control) (mm) § | Root to Shoot Biomass Ratio ^ |
---|---|---|---|
Landraces (166) | 52.7 a | 100.2 a | 0.59 a |
CIMMYT lines (115) | 39.7 b | 107.9 b | 0.72 b |
Released varieties (34) | 43.5 c | 115.5 b | 0.74 b |
Rht Loci § | Ratio | ||||||
---|---|---|---|---|---|---|---|
Accession ID | Accession Group | Rht-B1 | Rht-D1 | CL/PH | RL/PH | RootB/PH | Root/Shoot Biomass |
NGRC02450 | Landrace | Rht-B1a | Rht-D1b | 0.054 | 0.142 | 0.000101 | 0.743 |
NGRC04400 | Landrace | Rht-B1b | Rht-D1a | 0.051 | 0.159 | 0.000095 | 0.820 |
Vaskar | Released variety | Rht-B1b | Rht-D1a | 0.053 | 0.155 | 0.000098 | 0.832 |
Annapurna1 | Released variety | Rht-B1b | Rht-D1a | 0.052 | 0.156 | 0.000120 | 0.754 |
BL1022 | Released variety | Rht-B1b | Rht-D1a | 0.068 | 0.180 | 0.000097 | 0.739 |
BL1473 | Released variety | Rht-B1a | Rht-D1b | 0.055 | 0.204 | 0.000118 | 0.859 |
WK1204 | Released variety | Rht-B1a | Rht-D1b | 0.054 | 0.153 | 0.000129 | 1.029 |
Tilottama | Released variety | Rht-B1b | Rht-D1a | 0.058 | 0.158 | 0.000108 | 0.727 |
BW43354 | CIMMYT line | Rht-B1b | Rht-D1a | 0.059 | 0.193 | 0.000093 | 0.723 |
BW45593 | CIMMYT line | Rht-B1b | Rht-D1a | 0.054 | 0.155 | 0.000110 | 0.835 |
BW45587 | CIMMYT line | Rht-B1b | Rht-D1a | 0.059 | 0.152 | 0.000106 | 0.869 |
BW48133 | CIMMYT line | Rht-B1b | Rht-D1a | 0.055 | 0.161 | 0.000095 | 0.727 |
BW48139 | CIMMYT line | Rht-B1a | Rht-D1b | 0.061 | 0.159 | 0.000112 | 0.793 |
BW48162 | CIMMYT line | Rht-B1b | Rht-D1a | 0.058 | 0.188 | 0.000106 | 0.929 |
BW49235 | CIMMYT line | Rht-B1b | Rht-D1a | 0.060 | 0.161 | 0.000122 | 0.763 |
BW49079 | CIMMYT line | Rht-B1b | Rht-D1a | 0.053 | 0.177 | 0.000093 | 0.721 |
BW49089 | CIMMYT line | Rht-B1b | Rht-D1a | 0.057 | 0.143 | 0.000112 | 0.766 |
BW49112 | CIMMYT line | Rht-B1b | Rht-D1a | 0.052 | 0.168 | 0.000099 | 0.742 |
BW49927 | CIMMYT line | Rht-B1b | Rht-D1a | 0.051 | 0.151 | 0.000121 | 0.805 |
BW49931 | CIMMYT line | Rht-B1b | Rht-D1a | 0.058 | 0.162 | 0.000121 | 0.933 |
BW49936 | CIMMYT line | Rht-B1b | Rht-D1a | 0.061 | 0.207 | 0.000112 | 0.802 |
BW49943 | CIMMYT line | Rht-B1b | Rht-D1a | 0.056 | 0.155 | 0.000134 | 0.976 |
BW49949 | CIMMYT line | Rht-B1b | Rht-D1a | 0.058 | 0.172 | 0.000112 | 0.940 |
BW49954 | CIMMYT line | Rht-B1b | Rht-D1a | 0.051 | 0.146 | 0.000112 | 0.926 |
BW49957 | CIMMYT line | Rht-B1b | Rht-D1a | 0.054 | 0.153 | 0.000114 | 0.860 |
BW49958 | CIMMYT line | Rht-B1b | Rht-D1a | 0.055 | 0.174 | 0.000102 | 0.818 |
BW49325 | CIMMYT line | Rht-B1b | Rht-D1a | 0.058 | 0.179 | 0.000097 | 0.802 |
BW49392 | CIMMYT line | Rht-B1b | Rht-D1a | 0.056 | 0.173 | 0.000101 | 0.723 |
BW49394 | CIMMYT line | Rht-B1b | Rht-D1a | 0.053 | 0.150 | 0.000102 | 0.736 |
Treatment | Coleoptile Length (mm) § | Root Length (mm) § |
---|---|---|
Control | 47.0 a | 104.8 a |
GA3 | 48.7 b | 98.2 b |
Effect of GA3 (% Change) | ||
---|---|---|
Seed Source Groups | ∆ Coleoptile Length § | −∆ Root Length § |
Landraces (166) | 5.25 a | 5.10 a |
CIMMYT lines (115) | 0.32 b | 8.35 b |
Released varieties (34) | 1.21 b | 5.77 ab |
Accession ID | Accession Group | Rht-B1 Locus | Rht-D1 Locus | % Change in Coleoptile Length:Plant Height Ratio with GA3 Treatment | % Change in COLEOPTILE Length with GA3 Treatment | Coleoptile Length (Control) (mm) | Plant Height (cm) |
---|---|---|---|---|---|---|---|
NGRC04427 | Landrace | Rht-B1a | Rht-D1b | 11.7 | 10.1 | 49.3 | 86.1 |
NGRC04443 | Landrace | Rht-B1b | Rht-D1b | 12.5 | 12.0 | 53.9 | 96.1 |
NGRC04466 | Landrace | Rht-B1a | Rht-D1b | 12.1 | 11.2 | 63.7 | 92.9 |
Nepal297 | Released variety | Rht-B1b | Rht-D1a | 15.1 | 11.0 | 38.9 | 72.6 |
BW48136 | CIMMYT line | Rht-B1b | Rht-D1a | 30.6 | 24.3 | 29.8 | 79.3 |
BW48139 | CIMMYT line | Rht-B1a | Rht-D1b | 17.1 | 12.8 | 45.7 | 74.7 |
BW48155 | CIMMYT line | Rht-B1b | Rht-D1a | 12.8 | 10.8 | 34.3 | 84.7 |
BW48158 | CIMMYT line | Rht-B1b | Rht-D1a | 12.3 | 10.0 | 39.4 | 80.8 |
BW48166 | CIMMYT line | Rht-B1b | Rht-D1a | 12.9 | 10.0 | 36.6 | 77.6 |
BW49093 | CIMMYT line | Rht-B1b | Rht-D1a | 13.4 | 11.2 | 36.2 | 83.8 |
BW48314 | CIMMYT line | Rht-B1b | Rht-D1a | 13.6 | 10.3 | 34.6 | 75.8 |
BW49333 | CIMMYT line | Rht-B1b | Rht-D1a | 20.3 | 14.7 | 34.0 | 72.5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khadka, K.; Kaviani, M.; Raizada, M.N.; Navabi, A. Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection. Agronomy 2021, 11, 2412. https://doi.org/10.3390/agronomy11122412
Khadka K, Kaviani M, Raizada MN, Navabi A. Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection. Agronomy. 2021; 11(12):2412. https://doi.org/10.3390/agronomy11122412
Chicago/Turabian StyleKhadka, Kamal, Mina Kaviani, Manish N. Raizada, and Alireza Navabi. 2021. "Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection" Agronomy 11, no. 12: 2412. https://doi.org/10.3390/agronomy11122412
APA StyleKhadka, K., Kaviani, M., Raizada, M. N., & Navabi, A. (2021). Phenotyping and Identification of Reduced Height (Rht) Alleles (Rht-B1b and Rht-D1b) in a Nepali Spring Wheat (Triticum aestivum L.) Diversity Panel to Enable Seedling Vigor Selection. Agronomy, 11(12), 2412. https://doi.org/10.3390/agronomy11122412