Next Article in Journal
Comparative Metabolomic Analysis of Multi-Ovary Wheat under Heterogeneous Cytoplasm Suppression
Next Article in Special Issue
Comparative Analyses Reveal Peroxidases Play Important Roles in Soybean Tolerance to Aluminum Toxicity
Previous Article in Journal
High-Resolution Drone-Acquired RGB Imagery to Estimate Spatial Grape Quality Variability
Previous Article in Special Issue
The Evaluation of Agronomic Traits of Wild Soybean Accessions (Glycine soja Sieb. and Zucc.) in Heilongjiang Province, China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

RNAseq Reveals Differential Gene Expression Contributing to Phytophthora nicotianae Adaptation to Partial Resistance in Tobacco

1
Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27695, USA
2
Department of Crop and Soil Science, North Carolina State University, Raleigh, NC 27695, USA
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(4), 656; https://doi.org/10.3390/agronomy11040656
Submission received: 28 February 2021 / Revised: 20 March 2021 / Accepted: 26 March 2021 / Published: 30 March 2021

Abstract

Phytophthora nicotianae is a devastating oomycete plant pathogen with a wide host range. On tobacco, it causes black shank, a disease that can result in severe economic losses. Deployment of host resistance is one of the most effective means of controlling tobacco black shank, but adaptation to complete and partial resistance by P. nicotianae can limit the long-term effectiveness of the resistance. The molecular basis of adaptation to partial resistance is largely unknown. RNAseq was performed on two isolates of P. nicotianae (adapted to either the susceptible tobacco genotype Hicks or the partially resistant genotype K 326 Wz/Wz) to identify differentially expressed genes (DEGs) during their pathogenic interactions with K 326 Wz/Wz and Hicks. Approximately 69% of the up-regulated DEGs were associated with pathogenicity in the K 326 Wz/Wz-adapted isolate when sampled following infection of its adapted host K 326 Wz/Wz. Thirty-one percent of the up-regulated DEGs were associated with pathogenicity in the Hicks-adapted isolate on K 326 Wz/Wz. A broad spectrum of over-represented gene ontology (GO) terms were assigned to down-regulated genes in the Hicks-adapted isolate. In the host, a series of GO terms involved in nuclear biosynthesis processes were assigned to the down-regulated genes in K 326 Wz/Wz inoculated with K 326 Wz/Wz-adapted isolate. This study enhances our understanding of the molecular mechanisms of P. nicotianae adaptation to partial resistance in tobacco by elucidating how the pathogen recruits pathogenicity-associated genes that impact host biological activities.

1. Introduction

Plant diseases are estimated to cause crop losses of 13% annually, imposing a major constraint on global crop production [1]. Deployment of complete and partial resistance in host plants is one of the most effective means of managing plant diseases and is an integral part of sustainable disease management that reduces the use of fungicides and other management inputs [2]. However, wide distribution of cultivars with complete resistance places strong selection pressure on pathogen populations to overcome that resistance [3]. Partial resistance selects for isolates that are more aggressive than isolates produced on susceptible cultivars, which can erode the effectiveness of partial resistance over time [4,5,6].
Various mechanisms utilized by plant pathogens to overcome complete resistance have been recognized, including loss of avirulence (Avr) gene products that trigger plant immunity, transposon insertions or mutations to the Avr gene sequence, acquisition of additional epistatic effectors that suppress the plant immune system without disrupting the original Avr gene [7], and endogenous small RNAs silencing Avr genes [8]. Despite our rapid improvement in understanding the molecular basis underlying complete resistance and how pathogens overcome it, mechanisms of plant pathogen adaptation to partial resistance remains largely unknown.
Phytophthora nicotianae is a widely prevalent plant pathogen with hosts in 255 genera from 90 plant families [9]. When infecting tobacco (Nicotiana tabacum L.), the pathogen causes black shank, a potentially devastating disease with losses reaching 100% in some fields [10]. The use of host resistance provides an effective system for reducing yield losses due to black shank, but isolates of P. nicotianae can rapidly adapt to genetic resistance in tobacco. Populations of P. nicotianae rapidly shifted from race 0 (wild type) to race 1 after deployment of tobacco varieties with the Php gene [11]. Deployment of partial resistance is generally thought to be a sustainable approach to managing plant diseases. However, adaptation to partial resistance in P. nicotianae has also been observed. A significant increase in pathogen aggressiveness was documented in isolates of P. nicotianae exposed to a tobacco variety with a high level of partial resistance [12,13,14]. A greenhouse study demonstrated that isolates of P. nicotianae were able to overcome partial resistance QTLs derived from cigar cultivar Florida 301 and the Wz genomic region from Nicotiana rustica after exposure for only a few host generations [14,15]. Phenotypically, isolates of P. nicotianae adapted to sources of partial resistance exhibited increased infection efficiency and produced more sporangia on infected root tips, larger lesions on tobacco stems, and more aggressive asexual progeny than isolates not adapted on the resistant hosts [16].
The goal of the present study was to explore the molecular mechanisms underlying P. nicotianae adaptation to Wz-mediated partial resistance in tobacco genotype K 326 Wz/Wz, which was developed using an elite flue-cured tobacco cultivar K 326 as the recipient of Wz with the backcross breeding method. RNA samples of two P. nicotianae isolates adapted on either partially resistant inbred tobacco parental line K 326 Wz/Wz or the very susceptible cultivar Hicks were collected following infection of their adapted and their non-adapted host genotypes and subjected to RNA sequencing (RNAseq). The changes in gene expression in the two isolates were investigated by comparing the DEGs identified in each of the two isolates when infecting K 326 Wz/Wz compared to infecting Hicks. In addition, DEGs were identified in infected root samples of K 326 Wz/Wz by comparing to gene expression in inoculated root samples of Hicks. The results from this study enhance our understanding of how pathogens adapt to partial resistance in host plants, which will help in the development of sound deployment strategies for partial resistance and help increase the durability of partial resistance in host plants in the future.

2. Materials and Methods

2.1. RNAseq Preparation

2.1.1. Collection of Pathogen Isolates

Two isolates of P. nicotianae were collected from a previous greenhouse study where a race 0 isolate of P. nicotianae adapted on tobacco genotype K 326 Wz/—(a genotype heterozygous for Wz) was continually exposed to either K 326 Wz/Wz or the susceptible host Hicks. Isolates of P. nicotianae presented a significantly lower aggressiveness on K 326 Wz/Wz after exposure to Hicks compared to the isolates maintained on a host with Wz resistance. The two isolates selected for current study represented a broad spectrum of aggressiveness on K 326 Wz/Wz in the greenhouse aggressiveness evaluation. One isolate (Wz-Wz) was from K 326 Wz/Wz and had an aggressiveness index of 9.25 out of a possible 10. The second isolate (Wz-H) was from Hicks and had an aggressiveness index of 1.25. The aggressiveness index was converted from disease severity value caused by a given isolate. A disease severity value of 0 was given to plants that did not have above ground symptoms 28 days after inoculation. The severity values were: 1–6 days = 0, 7–10 days = 8, 11–16 days = 6, 17–22 days = 4, 23–28 days = 2, and no symptoms at day 28 = 0 [17].

2.1.2. Pathogen Culture and Tobacco Infection

The two isolates were maintained on 5% V8 agar at 28 °C in the dark in an incubator. Mycelial plugs from the edge of the cultures grown on V8 were transferred to the center of Petri dishes containing oatmeal agar (Difco, Detroit, MI, USA). Petri dishes were incubated in the dark at 28 °C for approximately 2 weeks until dense hyphal mats formed. Hyphal mats were peeled from the oatmeal agar surface and placed into Petri dishes containing 20 mL of sterile 5% sandy-loam soil extract. Five percent soil extract was prepared by mixing 50 g of soil with 1 L of deionized water and letting it sit at room temperature for 48 h. The suspension was filtered through Fisher Brand Qualitative P8 filter paper and Celite 545 (Fisher Scientific, Fair Lawn, NJ, USA), and sterilized by autoclaving for two consecutive days at 121 °C for 60 min. Petri dishes were placed under constant light at room temperature in laboratory for about 5 days at which time numerous sporangia had produced. Sterile 5% soil extract was replaced daily during incubation. Zoospores were released by incubating hyphal mats at 4 °C for 1 h, followed by incubation at 28 °C for 30 min. The concentration of zoospore suspension was determined and adjusted to a concentration of 1 × 105 zoospores/mL using a hemocytometer.
Tobacco seeds of K 326 Wz/Wz and Hicks were seeded in potting mix (Fafard 2 Mix; Conrad Fafard, Inc., Agawam, MA, USA) in plastic pots in a greenhouse with a 35 °C/26 °C day/night temperature regime and a 14 h photoperiod supplemented with high intensity lights. After two weeks, germinated seedlings were transplanted to cell trays (cell size 3.8 cm × 3.8 cm × 5.7 cm) containing calcined clay (TURFACE® All Sport™, PROFILE Products LLC, Buffalo Grove, IL, USA) and grown for about two weeks. Six seedlings of each genotype were removed from calcined clay, washed gently with sterile deionized water, and inoculated by immersing the roots for 3 h in 60 mL of zoospore suspension of one of the two isolates in a Petri dish (25 × 100 mm). After inoculation, seedlings were moved to a new Petri dish (25 × 100 mm) containing 60 mL of 5% soil extract and incubated under constant light at room temperature. Forty-eight hours post inoculation (hpi), roots of individual seedlings were flash frozen in liquid nitrogen in separate 1.7 mL centrifuge tubes and subjected to RNA extraction.

2.1.3. RNA Isolation and Transcriptome Sequencing

A total of 24 infected root samples (2 isolates × 2 tobacco genotypes × 6 biological replicates) were subjected to RNA isolation. Total RNA of infected roots of each seedling was extracted using Qiagen Plant RNeasy Kits (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Genomic DNA was removed by on-column digestion with DNase I (Zymo Research Corporation, Irvine, CA, USA). The concentration and quality of total RNA were determined by BioAnalyzer RNA analysis. Three of the six biological replicates of each treatment with the highest RNA quality were selected for RNA sequencing.
RNA library preparation and sequencing were conducted at the Genomic Science Library at North Carolina State University (Raleigh, NC, USA). Briefly, the RNAseq library was constructed using a NEBNext® Ultra™ Directional RNA library Prep Kit for Illumina (New England BioLabs, Ipswish, MA, USA) using 1 μg of each of the RNA samples followed by a 350–500 bp final library size selection. Libraries of the three biological replicates for each of the four treatments (2 isolates × 2 tobacco genotypes) were multiplexed and sequenced in a single Illumina NextSeq 500 lane, generating 75 bp paired-end reads.

2.2. Analyses of RNAseq Data from P. nicotianae

2.2.1. Detection of Differentially Expressed Genes (DEGs) in P. nicotianae

Sequence quality was assessed using FastQC v0.11.8 [18]. No trimming was performed since the Phred quality score of each sequenced base was above 30 for all samples. Reads of all samples were aligned to the P. nicotianae genome (phytophthora_parasitica_inra_310.3.scaffolds.fasta) using Hisat2 v2.1.0 [19] with default parameters and maximum intron length of 5000 bp.
Reads mapped to coding sequences (CDS) of annotated genes were counted using featureCounts [20] with default settings. DEGs in a given isolate were identified by comparing infected K 326 Wz/Wz samples to infected Hicks samples using edgeR [21] with TMM normalization, a generalized linear model, and false discovery rate (FDR) calculations based on the Benjamini–Hochberg method. Genes with a false FDR < 0.05 were considered to be DEGs. DEGs were divided into up- and down-regulated groups for further analyses.

2.2.2. Gene Ontology Analysis, KEGG Pathway Enrichment Analysis and PHIB-Blast

Gene Ontology (GO) ID and protein sequences were linked to individual DEGs using the UniProt website (https://www.uniprot.org/. Accessed on 21 May 2019) [22]. GO term enrichment analysis was performed using the BiNGO plugin [23] in Cytoscape v3.7.1 [24]. Over-represented GO terms were evaluated against the P. nicotianae genome in the categories “biological process”, “molecular function”, and “cellular component”. The DEGs were subjected to the Kyoto Encyclopedia of Genes and Genomes (KEGG) [25] pathway enrichment analysis to understand their roles in biological pathways using KOBAS [26] with background species set to Phytophthora infestans, statistical method set to Hypergeometric test/Fisher’s exact test, and FDR correction method set to Benjamini and Hochberg. Protein sequences of the DEGs were subjected to a blast search in PHIB-Pathogen Host Interactions base [27] to identify DEGs associated with pathogenicity. A DEG was considered pathogenicity-associated if it or its ortholog was verified in association with “loss of pathogenicity”, “reduced virulence”, “lethal”, or “effector” in pathogens with an Evalue cutoff of 1.0 × 10−5.

2.2.3. Detection of Differential Transcript Usage

To detect differential transcript usage, transcripts in each sample were assembled and quantified using StringTie [28] by comparing the BAM file (aligned using Hisat2) to the annotated reference genome (phytophthora_parasitica_inra_310.3.genes.gtf). Analysis of alternative splicing and isoform switches was conducted using IsoformSwitchAnalyzeR [29] package in R. Isoforms in each isolate of P. nicotianae found by comparing infected samples of K 326 Wz/Wz to infected samples of Hicks were considered differentially switched if difference in isoform fraction (dIF) > 0.1 and FDR corrected q-value < 0.05. Genes with differential transcript usage were subject to GO, KEGG, and PHIB blast analyses as well.

2.2.4. Identification of Single-Nucleotide Polymorphisms (SNPs)

To identify SNPs in the two isolates of P. nicotianae, sorted bam files of individual samples were subjected to variant calling using samtools mpileup and filtered using bcftools [30]. SNPs identified between the two isolates were located in genes. Gene sequences and corresponding protein sequences were blasted in NCBI to further identify their potential roles in aggressiveness in each of the two isolates of P. nicotianae.

2.3. Analyses of RNAseq Data from N. tabacum

2.3.1. Detection of Differentially Expressed Genes (DEGs) in N. tabacum

Reads of all samples were aligned to the Nicotiana tabacum genome [31] using Hisat2 v2.1.0 [19]. Reads mapped to coding sequences (CDS) of annotated genes were counted using featureCounts [20] with default settings. DEGs in K 326 Wz/Wz inoculated with a given isolate were identified by comparing it to Hicks inoculated with the same isolate by edgeR [21] using TMM normalization, a generalized linear model, and false discovery rate (FDR) calculations based on the Benjamini–Hochberg method. Genes with a false FDR < 0.05 were considered DEGs. DEGs were divided into up- and down-regulated datasets for further analysis.

2.3.2. Gene Ontology and KEGG Enrichment Analyses

DEGs were subjected to GO enrichment analysis using AgriGO v2 [32] against Nitab4.5 ID (solgenomics) as background with default settings. Corresponding protein sequences of DEGs were extracted and subjected to KEGG enrichment analysis using KOBAS [26] with background species set to Nicotiana tabacum, statistical method set to Hypergeometric test/Fisher’s exact test, and FDR correction method set to Benjamini and Hochberg.

2.4. Quantitative Real-Time PCR (qRT-PCR) Validations

Two up-regulated and two down-regulated DEGs detected in both of the two P. nicotianae isolates with largest fold changes (Table 1) were chosen for qRT-PCR quantification to validate the DEGs called in RNAseq analysis. RNA samples extracted from two biological samples of each treatment were used as templates in qRT-PCR validations. First strand cDNA synthesis was initiated using ProtoScript® II reverse transcriptase (New England Biolabs, Beverly, MA, USA) following first strand cDNA synthesis standard protocol NEB#M0277. The ubiquitin-conjugating enzyme (Ubc) and the 40S ribosomal protein S3A (WS21), constitutively expressed throughout P. nicotianae development stages, were used as internal control genes [33] (Table 1).
A total of 20 μL of reaction solution, including 1 μL of cDNA, 10 μL of iTaq Universal SYBR Green SuperMix (BioRad, Hercules, CA, USA), 0.6 μL of forward and 0.6 μL of reverse primers (10 μM), and 7.8 μL of molecular grade water was used for qRT-PCR. qRT-PCR was performed on 96-well plates using the Applied Biosystems QuantStudioTM 6 Flex Real-Time PCR system with the following settings: one cycle of 95 °C for 20 s (hold stage), followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s (PCR stage), with a final melt curve stage: 95 °C for 15 s, 60 °C for 1 min and 95 °C for 15 s. Three technical replicates were performed for each sample and primer set combination.

3. Results

3.1. RNAseq Overview

3.1.1. Infected Tobacco Root Samples for RNAseq

Root tissue colonized by P. nicotianae was obtained for RNAseq by inoculating and harvesting the roots of seedlings 48 h post inoculation (hpi). At 48 hpi, slight browning of the roots was present and abundant sporangia were present around roots.

3.1.2. RNA Sequencing and Sequence Mapping to the Reference Genome

Approximately 33 million reads were obtained per sample. An average of 27% of the reads were mapped to the P. nicotianae genome and an average of 6% of the reads were mapped to the N. tabacum genome (Table 2).

3.2. Overview of DEGs in P. nicotianae

3.2.1. DEGs Identified in P. nicotianae

For each of the two isolates, DEGs were identified by comparing infected K 326 Wz/Wz samples to infected Hicks samples. The DEGs identified in the two isolates were compared to view the dynamics in gene expression in the two isolates after infecting their adapted and their non-adapted tobacco host genotypes.
Forty-six genes in Wz-Wz and 50 genes in Wz-H isolates were differentially expressed. Specifically, 16 up-regulated and 30 down-regulated genes were identified in the Wz-Wz isolate (Table 3), and 29 up-regulated and 21 down-regulated genes were detected in the Wz-H isolate (Table 4). qRT-PCR of the four selected DEGs indicated expression pattern consistent with those captured in RNAseq where PPTG_08585 and PPTG_20266 had a lower expression, and PPTG_10666 and PPTG_19949 had a higher expression in the two isolates when infecting K 326 Wz/Wz comparing to when they were infecting Hicks (Figure 1).
Both isolates up-regulated genes PPTG_19949, PPTG_06767, PPTG_10666, PPTG_05470 that encode uncharacterized proteins in P. nicotianae, and down-regulated 8 genes including genes that encode 60S ribosomal protein L38, phosphoadenosine phosphosulfate reductase, and NAD(P)H:quinone oxidoreductase.
Thirty-four DEGs were detected exclusively in the Wz-Wz isolate. Most of these genes encoded for uncharacterized proteins in P. nicotianae. Up-regulated genes with known function included PPTG_02121, PPTG_08145, and PPTG_12158 that encode Hsp70-like protein, 4-aminobutyrate transaminase, and ULK/ULK protein kinase. Similarly, the majority of the 38 DEGs identified only in the Wz-H isolate encoded for uncharacterized proteins. Genes with known function included an up-regulated gene, PPTG_17442, that encodes protein-S-isoprenylcysteine O-methyltransferase and down-regulated genes, PPTG_17561, PPTG_00501, PPTG_21942, and PPTG_15084 predicted to encode for a glycine cleavage system H protein, homoserine O-acetyltransferase, phosphate acetyltransferase, and TKL/DRK protein kinase.

3.2.2. Over-Represented Gene Ontology Analysis

To obtain insight into the types of differentially expressed genes in the two isolates, GO enrichment analysis was performed using BiNGO to test over-representation for the DEGs against the annotated genes in P. nicotianae. Down-regulated genes in the Wz-Wz isolate were significantly enriched into three GO terms for the functional classes “sulfate reduction” (GO: 0019419), “sulfate assimilation, phosphoadenylyl sulfate reduction by phosphoadenylyl-sulfate reductase (thioredoxin)” (GO: 0019379) and “sulfate assimilation” (GO: 0000103). Up-regulated genes in the Wz-Wz isolate were enriched in “monooxygenase activity” (GO: 0004497) (Figure 2). In the Wz-H isolate, down-regulated genes were enriched into a broader spectrum of GO terms. In addition to the ones found in the Wz-Wz isolate, down-regulated genes in the Wz-H isolate were also enriched in “glycine cleavage complex” (GO: 0019419), “NAD(P)H dehydrogenase (quinone) activity” (GO: 0004604), “FMN binding” (GO: 0050662), and “oxidoreductase activity” (GO: 0016651, GO: 0000103, GO: 0009071; GO: 0016671). No GO terms were particularly enriched for up-regulated genes in the Wz-H isolate (Figure 3).

3.2.3. KEGG Analysis of DEGs

A KEGG pathway enrichment analysis was conducted on DEGs identified in the two isolates to help understand the interaction between isolates and their adapted and non-adapted tobacco host genotypes.
For up-regulated DEGs, “spliceosome” was enriched in the Wz-Wz isolate. No enriched pathway was identified for up-regulated DEGs in the Wz-H isolate. For down-regulated DEGs, “ubiquinone and other terpenoid-quinone biosynthesis” and “biosynthesis of secondary metabolites” were enriched in the Wz-Wz isolate. In addition to the two pathways enriched, another eight enriched pathways were identified in the Wz-H isolate including “biosynthesis of antibiotics”, “carbon metabolism”, and “sulfur metabolism” (Table 5).

3.2.4. PHIB-Database Blast

The pathogen-host interactions database (PHI-base) stores curated molecular and biological information on genes experimentally proven to alter the outcome of pathogen-host interactions. Given that a majority of the DEGs were identified to encode uncharacterized proteins in the annotated Phytophthora nicotianae genome, the protein sequences of the identified DEGs were subjected to a blast search in the PHI-base to determine their role or the role of their orthologs to have a better knowledge of how they could potentially contribute to aggressiveness in individual isolates.
Among the up-regulated genes in the Wz-Wz isolate, 68.75% (11/16) were associated with pathogenicity. In contrast, 31.03% (9/29) of the up-regulated genes in the Wz-H isolate were found to have a role in pathogenicity. The two isolates showed a similar percentage of down-regulated genes involved in pathogenicity, with 46.67% (14/30) in the Wz-Wz isolate and 47.62% (10/21) in the Wz-H isolate (Table S1).
Specifically, the Wz-Wz isolate up regulated pathogenicity-associated genes including, but not limited to, PPTG_10595 encoding a protein belonging to ABC transporter superfamily, PPTG_12158 encoding ULK/ULK protein kinase, PPTG_02121 encoding a heat shock protein 70, and PPTG_06886 encoding a protein within solute carrier family. Down-regulated pathogenicity-associated genes included PPTG_19261 and PPTG_00236 encoding WRKY transcription factor, PPTG_02595 encoding aldehyde dehydrogenase, and PPTG_02595 encoding a sugar transport protein (Table S1).
The Wz-H isolate up regulated pathogenicity-associated genes including PPTG_22560 which matched to a gene encoding an effector protein in P. infestans and PPTG_15982 matched to a gene encoding a glycoside hydrolase in P. palmivora. The down regulated genes in association with pathogenicity in the Wz-H isolate included PPTG_15084 encoding a TKL/DRK protein kinase and PPTG_13205 matched to a gene encoding an elicitin-like protein in P. infestans (Table S1).

3.2.5. Genes with Differential Transcript Usage in P. nicotianae

Differential transcript usage allows a single gene to produce multiple transcript isoforms. To explore possible molecular mechanisms other than selectively expressing genes in a specific pathogen isolate—host genotype interaction, genes with differential transcript usage were identified and analyzed in P. nicotianae. Sixty-six and 128 annotated genes in the Wz-Wz and Wz-H isolates, respectively, were differentially transcribed when the given isolate was infecting K 326 Wz/Wz compared to its infecting Hicks. Intron-retention (IR), alternative transcription start sites (ATSS), and alternative transcription termination sites (ATTS) were the three most common alternative splicing types in the two isolates.
Twenty-seven and 60 differentially transcribed genes were predicted to have functional consequences in the Wz-Wz and Wz-H isolates, respectively (Table S2). These genes were subjected to GO and PHIB blast analyses. No GO terms were enriched for either of the two sets of genes identified in the two isolates. The PHIB blast results showed that 9 out of 27 (33.3%) genes with differential transcript usage in the Wz-Wz isolate were involved in pathogenicity, while 13 (21.7%) pathogenicity-associated genes were identified from the 60 genes in the Wz-H isolate (Table S3). For example, the Wz-Wz isolate alternatively spliced genes PPTG_10075 encoding a serine/threonine protein kinase and PPTG_00215 encoding eukaryotic translation initiation factor. The Wz-H isolate differentially transcribed genes such as PPTG_06129 encoding pre-mRNA 3′ end processing protein and PPTG_03522 encoding ankyrin repeat protein.

3.2.6. SNPs Identified in the Wz-Wz and Wz-H Isolates of P. nicotianae

A total of 8 SNPs were identified between the two isolates of P. nicotianae (Table 6). Three SNPs (CHROM: 7000000185249344 POS: 2066387; CHROM: 7000000185249344 POS: 2066377; CHROM: 7000000185249344 POS: 2066882) were located in gene PPTG_03590 encoding a conserved hypothetical protein in Phytophthora species with unknown function. A SNP (CHROM: 7000000185249172 POS: 182510) was located in PPTG_17734 which encodes an effector protein in the Crinkler family. Another SNP (CHROM: 7000000185249382 POS: 599392) was found in PPTG_05817 encoding transcription factor S.

3.3. Overview of DEGs in N. tabacum

3.3.1. DEGs Identified in N. tabacum

DEGs were identified in K 326 Wz/Wz by comparing it to Hicks inoculated with a given P. nicotianae isolate. When inoculated with the Wz-Wz isolate, K 326 Wz/Wz had 305 up-regulated and 303 down-regulated genes compared to 174 up-regulated and 393 down-regulated genes when inoculated with the Wz-H isolate. The DEGs identified in K 326 Wz/Wz inoculated with the two isolates were further analyzed for commonalities and differences. There were 94 up-regulated and 163 down-regulated genes in common from samples of K 326 Wz/Wz inoculated with the two isolates (Table 7; Table S4).
Among the commonly up-regulated genes were Nitab4.5_0007488g0040.1 and Nitab4.5_0001477g0080.1 that encode pathogenesis-related (PR) protein 1a. In addition, five genes, Nitab4.5_0003154g0030.1, Nitab4.5_0000754g0140.1, Nitab4.5_0003324g0100.1, Nitab4.5_0014015g0010.1, Nitab4.5_0013087g0020.1, were predicted to encode proteinase inhibitors. Of the 163 commonly down-regulated genes, 13 genes were found to encode Glutathione S-transferase or Glutathione S-transferase-like protein.

3.3.2. GO Analysis of DEGs in Tobacco

Up-regulated genes identified exclusively in K 326 Wz/Wz inoculated with the Wz-Wz isolate were enriched in 33 GO terms, while down-regulated genes were enriched in 63 GO terms. The GO terms enriched for down-regulated DEGs are involved in various aspects of nuclear biosynthesis including “nucleosome organization” (GO: 0034728), “nucleosome assembly” (GO: 0006334), “chromosome organization” (GO: 0051276), “chromatin assembly or disassembly” (GO: 0006333), “DNA packaging complex” (GO: 0044815), “DNA conformation change” (GO: 0071103), “DNA-templated transcription, initiation” (GO: 0006352), “RNA biosynthetic process” (GO: 0032774), “protein complex biogenesis” (GO: 0070271), “protein complex assembly” (GO: 0006461) (Table 8).
No significant GO terms were enriched for exclusively up-regulated genes in K 326 Wz/Wz inoculated with the Wz-H isolate, and 8 GO terms were enriched for down-regulated genes after inoculation with the Wz-H isolate (Table 9).
To investigate the potential resistance mechanism in K 326 Wz/Wz, commonly up-regulated and down-regulated DEGs found across samples of K 326 Wz/Wz inoculated with each of the two isolates were analyzed for enriched GO terms. In particular, GO terms in the functional categories “serine-type endopeptidase inhibitor activity” (GO: 0004867), “peptidase inhibitor activity” (GO: 0030414), “peptidase regulator activity” (GO: 0061134), “endopeptidase inhibitor activity” (GO: 0004866), “endopeptidase regulator activity” (GO: 0061135) were enriched for the up-regulated genes (Table 10). GO terms enriched for the down-regulated genes in the functional categories included “transferase activity, transferring hexosyl groups” (GO: 0016758), “transferase activity, transferring glycosyl groups” (GO: 0016757), “ATPase activity, coupled to transmembrane movement of substances” (GO: 0042626), “ATPase activity, coupled to movement of substances” (GO: 0043492), “ATPase activity” (GO: 0016887), “ATPase activity, coupled” (GO: 0042623) (Table 10).

3.3.3. KEGG Pathway Enrichment Analysis of DEGs

DEGs were subjected to KEGG pathway enrichment analysis to identify their biological roles in K 326 Wz/Wz in response to the two P. nicotianae isolates. Up-regulated DEGs in the Wz-Wz- and Wz-H-inoculated samples were enriched in 35 and 18 KEGG pathways, respectively (Figure 4 and Figure 5). Sixteen KEGG pathways were commonly enriched for up-regulated DEGs identified in K 326 Wz/Wz inoculated with each of the two isolates, with the most significantly enriched pathway being “valine, leucine and isoleucine degradation” in both Wz-Wz- and Wz-H-inoculated samples. Down-regulated DEGs in the Wz-Wz- and Wz-H-inoculated samples were enriched in 9 and 12 KEGG pathways, respectively (Figure 6 and Figure 7). KEGG pathways that included “sulfur metabolism”, “metabolic pathways”, “glutathione metabolism”, “ascorbate and aldarate metabolism”, and “ABC transporters” were commonly enriched for down-regulated DEGs in K 326 Wz/Wz inoculated with each of the two isolates.

4. Discussion

Black shank is one of the most devastating tobacco diseases globally. The use of host resistance is the most important and effective way to manage the disease worldwide, but with reduced value of complete resistance, an integrated approach using partial resistance is needed to effectively manage the disease [10]. Partial resistance is vital to the management of black shank, like many other root diseases, due to the absence of complete resistance genes or the loss of complete resistance due to pathogen new race development. Pathogen adaptation to partial resistance has been observed in various pathosystems, including P. nicotianae and tobacco, resulting in a pathogen population that is more aggressive than wild type populations [12,13,14]. It is urgent to better understand how pathogens overcome partial resistance in host plants so that resistance deployment strategies can be optimized to preserve the durability of the resistance.
The major goal of this study was to explore the molecular mechanisms underlying adaptation by P. nicotianae to partial resistance in tobacco [14,15]. Adaptation to partial resistance involves many genes and is generally considered to be more complex than overcoming complete resistance, which can result from a single nucleotide mutation in an Avr gene [34]. To obtain a holistic view of genetic differences that occur during adaptation to partial resistance and between pathogen isolates with distinctly different aggressiveness levels on a single source of partial resistance, we kept DEGs with a false FDR < 0.05 without a specified fold change of gene expression. Aggressiveness and partial resistance are two quantitative traits involving various biological activities supported by a broad spectrum of genes in the pathogen and host plant. The cumulative effect of slight changes in multiple genes could potentially influence the outcome of the interaction between a specific pathogen isolate and host genotype.
The DEGs detected involve a broad spectrum of biological activities related to pathogenicity factors in P. nicotianae. The PHIB blast showed a much higher percentage (68.75%) of up-regulated DEGs involved in pathogenicity of the Wz-Wz isolate compared to the Wz-H isolate (31.03%), indicating that the Wz-Wz isolate more efficiently recruited pathogenicity-associated genes when infecting partially resistant K 326 Wz/Wz. Particularly, some genes with essential roles in pathogenicity were only found up-regulated in the Wz-Wz isolate. These genes included PPTG_10595 that encodes a protein belonging to the ABC transporter superfamily, and PPTG_12158 that encodes ULK/ULK, a protein kinase, which has an important role in autophagy.
ABC transporters, also known as ATP Binding Cassette transporters, are of significant importance in regulating ion transport, chromosome condensation and DNA repair, mRNA processing in eukaryotes [35]. Studies have demonstrated ABC transporters are also involved in virulence [36] and toxicant efflux [37,38] in plant pathogenic fungi. It was speculated that ABC transporters export toxic phytoalexins in pathogens, therefore, contributing to pathogenicity. Comparing to P. infestans, ABC transporter gene family in P. nicotianae was significantly expanded, which suggested their crucial roles in evolutionary host adaptation [39]. The specific function of PPTG_10595 remains unclear, and given its versatility in biological processes, it is likely a higher expression of this gene could contribute to a higher aggressiveness in P. nicotianae.
ULK/ULK protein kinase (autophagy related protein 1, Atg1) is localized at the autophagy initiation site and initiates autophagy, which is critical in cell differentiation, secondary metabolism, and programmed cell death in eukaryotes [40]. In plant pathogens, autophagy has a vital role in pathogenicity. Silencing of Atg1 highly reduced conidiation and led to a reduction or loss of pathogenicity in Magnaporthe oryzae [41], Botrytis cinerea [42], Fusarium graminearum [43]. In P. sojae, expression of multiple autophagy related protein genes was increased during infection, and autophagy was highly induced during sporangium formation and cyst germination. Silencing autophagy related genes in P. sojae significantly reduced sporulation and pathogenicity, and in some cases led to defective haustorium formation, suggesting a central role of autophagy in both the development and pathogenicity in P. sojae [44]. Little is known of Atg1 in P. nicotianae, but it is possible that the up-regulated Atg1 expression in the Wz-Wz isolate could be a major contributor to aggressiveness on the resistant host K 326 Wz/Wz.
Three significantly enriched GO terms were assigned to down-regulated genes and one to up-regulated genes in the Wz-Wz isolate. Sixteen enriched GO terms were attributed to down-regulated genes in Wz-H isolate, however, no enriched GO terms were linked to up-regulated genes. These observations indicate that a broader spectrum of biological functions were affected because of the down-regulation of the genes in the Wz-H isolate.
The three enriched GO terms, “sulfate reduction” (GO: 0019419), “sulfate assimilation, phosphoadenylyl sulfate reduction by phosphoadenylyl-sulfate reductase (thioredoxin)” (GO: 0019379), and “sulfate assimilation” (GO: 0000103) that were assigned to down-regulated genes in the Wz-Wz isolate, were also enriched for the down-regulated genes in Wz-H isolate. Sulfate reduction and sulfate assimilation are two important biological processes changing sulfate into sulfide, which is then used for the synthesis of methionine, cysteine, and other metabolites [45]. The biological significance of methionine is predominantly because the methionine codon AUG is the most common start codon that initiates protein synthesis [46]. Cysteine is a strong antioxidant with the potential to trap reactive oxygen species (ROS), stabilizes the high-order structures of proteins, and serves as an active center for the bioactivity of proteins [47]. When genes involved in sulfate assimilation and sulfate reduction processes are down-regulated, their effects on the synthesis and bioactivity of proteins can be profound. The fact that these 3 GO terms were enriched for the down-regulated genes in both Wz-Wz and Wz-H isolates seems to suggest that Wz resistance in tobacco was disrupting the protein synthesis in P. nicotianae as a defense mechanism.
In addition to the GO terms mentioned above, another 13 enriched GO terms were assigned to the down-regulated genes in Wz-H isolate, including “oxidoreductase activity” (GO: 0016651, GO: 0000103, GO: 0009071; GO: 0016671). The “oxidation reduction process” catalyzed by oxidoreductases was found to be one of the two enriched GO terms distinguished the fungal pathogen Colletotrichum kahawae on coffee compared to its non-pathogenic sibling species [48], suggesting a substantial contribution of oxidoreductases in general pathogenicity in plant pathogens. Prospectively, a vital role of oxidoreductases in P. nicotianae aggressiveness is speculated. Down-regulation of genes annotated as oxidoreductases in the Wz-H isolate could potentially hamper its performance on K 326 Wz/Wz compared to Wz-Wz isolate.
Genes with differential transcript usage (DTU) also was investigated in the two isolates of P. nicotianae. Differential transcript usage is primarily the result of alternative splicing events that regulate translational processes. This allows for the formation of protein variants (isoforms) with different cellular functions or properties originating from a single gene, tremendously diversifying proteins encoded by genomes. Detection of genes with DTU has been widely used in RNAseq data analysis in human research [49]. The importance of DTU in genes in plant pathogens is largely unexplored, but a study with Pseudoperonospora cubensis showed that a functional effector protein PscRXLR1 was generated from the alternative splicing of the Psc_781.4 gene that encodes a putative multi-drug transporter [50]. This finding prompted our interest in genes with DTU in P. nicotianae. A total of 27 genes in Wz-Wz and 60 genes in Wz-H with DTU were identified with predicted functional consequences. Among those genes, 33.3% in Wz-Wz and 23.3% in Wz-H were pathogenicity-associated genes found in PHIB. How DTU in the genes could alter the aggressiveness in P. nicotianae needs to be further researched, but DTU in genes such as PPTG_00215 encoding eukaryotic translation initiation factor 1A, PPTG_06129 encoding pre-mRNA 3′ end processing protein WDR33, and PPTG_17135 encoding CCR4-NOT transcription complex subunit 1 signifies its role in translational biological processes in response to Wz resistance. Evidence of the importance of transcription factors in pathogen aggressiveness was confirmed in the genome-wide-association study (GWAS) in C. kahawae [48]. A slight change in pathogen genes or transcription factors associated in gene regulatory networks has been recognized to have a profound evolutionary impact [51].
Eight SNPs were identified between Wz-Wz and Wz-H. One SNP was located in the genetic region encoding a crinkler effector. Crinklers and RXLRs are two major classes of effectors secreted by oomycetes to facilitate pathogen infection [52]. The Crinkler protein family was first identified to cause leaf crinkling and necrosis when expressed in plants [53]. However, several Crinklers in P. infestans and P. capsici target the host nucleus during infection [54,55]. Effector proteins are coded by fast-evolving genes to overcome the immune system of the plants [56]. The SNP identified in the Crinkler effector coding region in our study may have critical roles in the interaction between Wz-Wz isolate and tobacco genotype K 326 Wz/Wz. Three SNPs occurred in gene PPTG_03590, with two of them occurring within 10 nucleobases in the gene. PPTG_03590 encodes a hypothetical protein concerved in Phytophthora species with unknown function. The high frequencey of SNPs occurring in this gene highlighted the importance of its encoding protein and the need for functional identification of the protein.
To have a comprehensive understanding of the P. nicotianae—tobacco interaction, the transcriptomic changes in tobacco were investigated. Given the different genetic backgrounds of K 326 Wz/Wz and Hicks, the DEGs detected when comparing K 326 Wz/Wz to Hicks inoculated with a given isolate of P. nicotianae could have resulted from the constitutive differences in gene expression in the two genotypes. To compensate for this, the 94 up-regulated and 163 down-regulated genes commonly found in K 326 Wz/Wz compared to Hicks regardless of the isolate used for inoculation were considered as the background difference for the two tobacco genotypes. Among the 94 up-regulated genes in K 326 Wz/Wz, a number of defense related genes were detected, including Nitab4.5_0007488g0040.1 and Nitab4.5_0001477g0080.1 that encodes pathogenesis-related (PR) protein 1a and five genes (Nitab4.5_0003154g0030.1, Nitab4.5_0000754g0140.1, Nitab4.5_0003324g0100.1, Nitab4.5_0014015g0010.1, Nitab4.5_0013087g0020.1) that encode proteinase inhibitors important in inhibiting pathogen proteases. The PR-protein 1a is required to initiate systemic acquired resistance (SAR), a defense response effective against a broad spectrum of plant pathogens [57]. Proteinase inhibitors play a fundamental role in plant basal defense by inhibiting pathogen proteases or by regulating endogenous plant proteases [58]. The functions of these genes were confirmed by GO enrichment analysis. GOs were enriched for up-regulated genes in the functional categories “serine-type endopeptidase inhibitor activity” (GO: 0004867), “peptidase inhibitor activity” (GO: 0030414), “peptidase regulator activity” (GO: 0061134), “endopeptidase inhibitor activity” (GO: 0004866), “endopeptidase regulator activity” (GO: 0061135). The elevated expression of these genes gives K 326 Wz/Wz an advantage in response to pathogen attack. Interestingly, compared to Hicks, a number of genes encoding glutathione S-transferase or glutathione S-transferase like protein were down regulated in K 326 Wz/Wz. Glutathione S-transferase are multifunctional enzymes ubiquitous in plants. They are highly inducible by a wide range of stresses including pathogen infection [59]. In a previous study on black shank resistance in tobacco, plants that had silenced glutathione S-transferase had increased resistance to P. nicotianae infection, suggesting that glutathione S-transferase was able to act as a negative regulator of defense responses in tobacco [60]. The connection between the down-regulated expression of glutathione S-transferase genes and up-regulated defense-associated genes in K 326 Wz/Wz remains to be explored.
For the down-regulated genes identified exclusively in K 326 Wz/Wz inoculated with the Wz-Wz isolate, enriched GO terms included “nucleosome organization” (GO: 0034728), “nucleosome assembly” (GO: 0006334), “chromosome organization” (GO: 0051276), “chromatin assembly or disassembly” (GO: 0006333), “DNA packaging complex” (GO: 0044815), “protein complex assembly” (GO: 0006461), suggesting the nuclear biosynthesis processes were impeded in K 326 Wz/Wz compared to Hicks when inoculated with the Wz-Wz isolate. This phenomenon was not observed when K 326 Wz/Wz was inoculated with the Wz-H isolate. Along with previous studies where Phytophthora targeted host nuclei to suppress defense [54,61], our observations suggested that isolates of P. nicotianae adapted to partial resistance in tobacco were able to interrupt biological processes in host nuclei to facilitate infection.

5. Conclusions

Few molecular studies have been completed to identify factors that might determine the overall aggressiveness of plant pathogens. Quantitative traits such as aggressiveness are challenging to dissect. A GWAS study on aggressiveness in C. kahawae strongly suggested that aggressiveness is associated with some small effect SNPs and is not regulated by causal mutations, which would indicate that aggressiveness might be a variable and very complex trait regulated by differential gene expression and corresponding regulatory mechanisms [48]. Our study was designed to enhance our understanding of the genetic mechanisms underlying P. nicotianae adaptation to partial resistance in tobacco using dual RNAseq. Overall, results from this study suggest that isolates of P. nicotianae adapted to partial resistance are able to recruit a high percentage of pathogenicity-associated genes when infecting a partially resistant genotype, and are more tolerant to the defenses expressed by Wz resistance. Finally, isolates adapted to the source of partial resistance used were able to severely hinder nuclear synthesis processes in K 326 Wz/Wz.
Wz resistance in K 326 Wz/Wz potentially disrupts protein synthesis in P. nicotianae as a defense mechanism. A broad spectrum and a high level of expression of defense related genes were recruited by K 326 Wz/Wz to inhibit non-adapted isolates of P. nicotianae compared to the adapted isolate. This was confirmed by the observation of a wide range of biological activities were affected by the down-regulated DEGs in the non-adapted isolate on K 326 Wz/Wz.
It would be beneficial if additional studies involving more isolates with distinct aggressiveness levels could be used to confirm our findings. Notwithstanding, sets of differentially expressed genes and genes with differential transcript usage were generated and can be researched via additional functional analyses to substantiate their roles in P. nicotianae aggressiveness. These findings provide a foundation for further investigation of the molecular mechanisms underlying pathogen adaptation to partial resistance in host plants.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy11040656/s1, Table S1: PHIB blast results for DEGs identified in the Wz-Wz and Wz-H isolates of Phytophthora nicotianae, Table S2: DEGs identified in the Wz-Wz and Wz-H isolates of Phytophthora nicotianae with differential transcript usage (DTU), Table S3: PHIB blast results for DEGs identified in Wz-Wz and Wz-H isolates of Phytophthora nicotianae with differential transcript usage (DTU), Table S4: DEGs identified in K326 Wz/Wz inoculated with either Wz-Wz or Wz-H isolate of Phytophthora nicotianae.

Author Contributions

J.J. and H.D.S. conceived and designed the experiments; J.J. performed the experiments; J.J. and R.S. analyzed the data; R.S.L. contributed experimental materials; J.J., H.D.S., and R.S.L. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated during the current study are available in the GEO repository with GEO accession GSE168516.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Oerke, E.C. Crop losses to pests. J. Agric. Sci. 2006, 144, 31–43. [Google Scholar] [CrossRef]
  2. Mundt, C.C. Durable resistance: A key to sustainable management of pathogens and pests. Infect. Genet. Evol. 2014, 27, 446–455. [Google Scholar] [CrossRef]
  3. McDonald, B.; Linde, C. The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 2002, 124, 163–180. [Google Scholar] [CrossRef]
  4. Cowger, C.; Mundt, C.C. Aggressiveness of Mycosphaerella graminicola isolates from susceptible and partially resistant wheat cultivars. Phytopathology 2002, 92, 624–630. [Google Scholar] [CrossRef]
  5. Montarry, J.; Glais, I.; Corbiere, R.; Andrivon, D. Adaptation to the most abundant host genotype in an agricultural plant–pathogen system–potato late blight. J. Evol. Biol. 2008, 21, 1397–1407. [Google Scholar] [CrossRef] [PubMed]
  6. Delmotte, F.; Mestre, P.; Schneider, C.; Kassemeyer, H.H.; Kozma, P.; Richart-Cervera, S.; Rouxel, M.; Delière, L. Rapid and multiregional adaptation to host partial resistance in a plant pathogenic oomycete: Evidence from European populations of Plasmopara viticola, the causal agent of grapevine downy mildew. Infect. Genet. Evol. 2014, 27, 500–508. [Google Scholar] [CrossRef]
  7. Na, R.; Gijzen, M. Escaping host immunity: New tricks for plant pathogens. PLoS Pathog. 2016, 12, e1005631. [Google Scholar] [CrossRef] [PubMed]
  8. Wang, Q.; Li, T.; Zhong, C.; Luo, S.; Xu, K.; Gu, B.; Meng, Y.; Tyler, B.M.; Shan, W. Small RNAs generated by bidirectional transcription mediate silencing of RXLR effector genes in the oomycete Phytophthora sojae. Phytopathol. Res. 2019, 1, 18. [Google Scholar] [CrossRef]
  9. Cline, E.T.; Farr, D.F.; Rossman, A.Y. A synopsis of Phytophthora with accurate scientific names, host range, and geographic distribution. Plant Health Prog. 2008, 9, 32. [Google Scholar] [CrossRef]
  10. Gallup, C.A.; Sullivan, M.J.; Shew, H.D. Black Shank of Tobacco. In The Plant Health Instructor; The American Phytopathological Society: St. Paul, MN, USA, 2006. [Google Scholar]
  11. Sullivan, M.J.; Parks, E.J.; Cubeta, M.A.; Gallup, C.A.; Melton, T.A.; Moyer, J.W.; Shew, H.D. An assessment of the genetic diversity in a field population of Phytophthora nicotianae with a changing race structure. Plant Dis. 2010, 94, 455–460. [Google Scholar] [CrossRef]
  12. Dukes, P.D.; Apple, J.L. Influence of host passage on virulence of Phytophthora parasitica var. nicotianae. Plant Dis. Rep. 1961, 45, 362. [Google Scholar]
  13. Sullivan, M.J.; Melton, T.A.; Shew, H.D. Managing the race structure of Phytophthora parasitica var. nicotianae with cultivar rotation. Plant Dis. 2005, 89, 1285–1294. [Google Scholar] [CrossRef]
  14. McCorkle, K.L.; Drake-Stowe, K.; Lewis, R.S.; Shew, H.D. Characterization of Phytophthora nicotianae resistance conferred by the introgressed Nicotiana rustica region, Wz, in flue-cured tobacco. Plant Dis. 2018, 102, 309–317. [Google Scholar] [CrossRef]
  15. McCorkle, K.L. Characterization of the Tobacco Pathogen Phytophthora nicotianae and Its Ability to Adapt Tohost Resistance Genes. Ph.D. Thesis, North Carolina State University, Raleigh, NC, USA, 2016. [Google Scholar]
  16. Jin, J.; Shew, H.D. Components of aggressiveness in Phytophthora nicotianae during adaptation to multiple sources of partial resistance in tobacco. Plant Dis. 2020. [Google Scholar] [CrossRef] [PubMed]
  17. Jin, J. Characterization of Phytophthora nicotianae Following Adaptation to Partial Resistance in Tobacco. Ph.D. Thesis, North Carolina State University, Raleigh, NC, USA, 2020. [Google Scholar]
  18. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data; Babraham Inst.: Cambridge, UK, 2010. [Google Scholar]
  19. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef]
  20. Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2013, 30, 923–930. [Google Scholar] [CrossRef] [PubMed]
  21. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
  22. Apweiler, R.; Bairoch, A.; Wu, C.H.; Barker, W.C.; Boeckmann, B.; Ferro, S.; Gasteiger, E.; Huang, H.; Lopez, R.; Magrane, M.; et al. UniProt: The universal protein knowledgebase. Nucleic Acids Res. 2004, 32, D115–D119. [Google Scholar] [CrossRef]
  23. Maere, S.; Heymans, K.; Kuiper, M. BiNGO: A Cytoscape plugin to assess overrepresentation of gene ontology categories in biological networks. Bioinformatics 2005, 21, 3448–3449. [Google Scholar] [CrossRef]
  24. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
  25. Ogata, H.; Goto, S.; Sato, K.; Fujibuchi, W.; Bono, H.; Kanehisa, M. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 1999, 27, 29–34. [Google Scholar] [CrossRef] [PubMed]
  26. Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef]
  27. Urban, M.; Cuzick, A.; Rutherford, K.; Irvine, A.; Pedro, H.; Pant, R.; Sadanadan, V.; Khamari, L.; Billal, S.; Mohanty, S.; et al. PHI-base: A new interface and further additions for the multi-species pathogen–host interactions database. Nucleic Acids Res. 2017, 45, D604–D610. [Google Scholar] [CrossRef] [PubMed]
  28. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
  29. Vitting-Seerup, K.; Sandelin, A. IsoformSwitchAnalyzeR: Analysis of changes in genome-wide patterns of alternative splicing and its functional consequences. Bioinformatics 2019, 35, 4469–4471. [Google Scholar] [CrossRef]
  30. Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
  31. Edwards, K.D.; Fernandez-Pozo, N.; Drake-Stowe, K.; Humphry, M.; Evans, A.D.; Bombarely, A.; Allen, F.; Hurst, R.; White, B.; Kernodle, S.P.; et al. A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genom. 2017, 18, 448. [Google Scholar] [CrossRef] [PubMed]
  32. Du, Z.; Zhou, X.; Ling, Y.; Zhang, Z.; Su, Z. agriGO: A GO analysis toolkit for the agricultural community. Nucleic Acids Res. 2010, 38, W64–W70. [Google Scholar] [CrossRef] [PubMed]
  33. Yan, H.Z.; Liou, R.F. Selection of internal control genes for real-time quantitative RT-PCR assays in the oomycete plant pathogen Phytophthora parasitica. Fungal Genet. Biol. 2006, 43, 430–438. [Google Scholar] [CrossRef]
  34. Iida, Y.; van‘t Hof, P.; Beenen, H.; Mesarich, C.; Kubota, M.; Stergiopoulos, I.; Mehrabi, R.; Notsu, A.; Fujiwara, K.; Bahkali, A.; et al. Novel mutations detected in avirulence genes overcoming tomato Cf resistance genes in isolates of a Japanese population of Cladosporium fulvum. PLoS ONE 2015, 10, e0123271. [Google Scholar] [CrossRef]
  35. Morris, P.F.; Phuntumart, V. Inventory and comparative evolution of the ABC superfamily in the genomes of Phytophthora ramorum and Phytophthora sojae. J. Mol. Evol. 2009, 68, 563–575. [Google Scholar] [CrossRef]
  36. Urban, M.; Bhargava, T.; Hamer, J.E. An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease. EMBO J. 1999, 18, 512–521. [Google Scholar] [CrossRef] [PubMed]
  37. Hayashi, K.; Schoonbeek, H.J.; Sugiura, H.; De Waard, M.A. Multidrug resistance in Botrytis cinerea associated with decreased accumulation of the azole fungicide oxpoconazole and increased transcription of the ABC transporter gene BcatrD. Pestic. Biochem. Physiol. 2001, 70, 168–179. [Google Scholar] [CrossRef]
  38. Lee, Y.J.; Yamamoto, K.; Hamamoto, H.; Nakaune, R.; Hibi, T. A novel ABC transporter gene ABC2 involved in multidrug susceptibility but not pathogenicity in rice blast fungus, Magnaporthe grisea. Pestic. Biochem. Physiol. 2005, 81, 13–23. [Google Scholar] [CrossRef]
  39. Liu, H.; Ma, X.; Yu, H.; Fang, D.; Li, Y.; Wang, X.; Wang, W.; Dong, Y.; Xiao, B. Genomes and virulence difference between two physiological races of Phytophthora nicotianae. Gigascience 2016, 5, 3. [Google Scholar] [CrossRef]
  40. Levine, B.; Klionsky, D.J. Development by self-digestion: Molecular mechanisms and biological functions of autophagy. Dev. Cell 2004, 6, 463–477. [Google Scholar] [CrossRef]
  41. Liu, X.H.; Lu, J.P.; Lin, F.C. Autophagy during conidiation, conidial germination and turgor generation in Magnaporthe grisea. Autophagy 2007, 3, 472–473. [Google Scholar] [CrossRef] [PubMed]
  42. Ren, W.; Zhang, Z.; Shao, W.; Yang, Y.; Zhou, M.; Chen, C. The autophagy-related gene BcATG1 is involved in fungal development and pathogenesis in Botrytis cinerea. Mol. Plant Pathol. 2017, 18, 238–248. [Google Scholar] [CrossRef] [PubMed]
  43. Lv, W.; Wang, C.; Yang, N.; Que, Y.; Talbot, N.J.; Wang, Z. Genome-wide functional analysis reveals that autophagy is necessary for growth, sporulation, deoxynivalenol production and virulence in Fusarium graminearum. Sci. Rep. 2017, 7, 11062. [Google Scholar] [CrossRef]
  44. Chen, L.; Zhang, X.; Wang, W.; Geng, X.; Shi, Y.; Na, R.; Dou, D.; Li, H. Network and role analysis of autophagy in Phytophthora sojae. Sci. Rep. 2017, 7, 1879. [Google Scholar] [CrossRef]
  45. Patron, N.J.; Durnford, D.G.; Kopriva, S. Sulfate assimilation in eukaryotes: Fusions, relocations and lateral transfers. BMC Evol. Biol. 2008, 8, 39. [Google Scholar] [CrossRef] [PubMed]
  46. Demongeot, J.; Seligmann, H. Why is AUG the start codon? Theoretical minimal RNA rings: Maximizing coded information biases 1st codon for the universal initiation codon AUG. BioEssays 2020, 42, 1900201. [Google Scholar] [CrossRef]
  47. Netto, L.E.S.; de Oliveira, M.A.; Monteiro, G.; Demasi, A.P.D.; Cussiol, J.R.R.; Discola, K.F.; Demasi, M.; Silva, G.M.; Alves, S.V.; Faria, V.G.; et al. Reactive cysteine in proteins: Protein folding, antioxidant defense, redox signaling and more. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2007, 146, 180–193. [Google Scholar] [CrossRef] [PubMed]
  48. Vieira, A.; Silva, D.N.; Várzea, V.; Paulo, O.S.; Batista, D. Genome-wide signatures of selection in Colletotrichum kahawae reveal candidate genes potentially involved in pathogenicity and aggressiveness. Front. Microbiol. 2019, 10, 1374. [Google Scholar] [CrossRef]
  49. Liu, Y.; Gonzàlez-Porta, M.; Santos, S.; Brazma, A.; Marioni, J.C.; Aebersold, R.; Venkitaraman, A.R.; Wickramasinghe, V.O. Impact of alternative splicing on the human proteome. Cell Rep. 2017, 20, 1229–1241. [Google Scholar] [CrossRef]
  50. Savory, E.A.; Zou, C.; Adhikari, B.N.; Hamilton, J.P.; Buell, C.R.; Shiu, S.H.; Day, B. Alternative splicing of a multi-drug transporter from Pseudoperonospora cubensis generates an RXLR effector protein that elicits a rapid cell death. PLoS ONE 2012, 7, e34701. [Google Scholar] [CrossRef]
  51. De Fine Licht, H.H. Does pathogen plasticity facilitate host shifts? PLoS Pathog. 2018, 14, e1006961. [Google Scholar] [CrossRef]
  52. Stassen, J.H.; Van den Ackerveken, G. How do oomycete effectors interfere with plant life? Curr. Opin. Plant Biol. 2011, 14, 407–414. [Google Scholar] [CrossRef]
  53. Torto, T.A.; Li, S.; Styer, A.; Huitema, E.; Testa, A.; Gow, N.A.; Van West, P.; Kamoun, S. EST mining and functional expression assays identify extracellular effector proteins from the plant pathogen Phytophthora. Genome Res. 2003, 13, 1675–1685. [Google Scholar] [CrossRef] [PubMed]
  54. Schornack, S.; van Damme, M.; Bozkurt, T.O.; Cano, L.M.; Smoker, M.; Thines, M.; Gaulin, E.; Kamoun, S.; Huitema, E. Ancient class of translocated oomycete effectors targets the host nucleus. Proc. Natl. Acad. Sci. USA 2010, 107, 17421–17426. [Google Scholar] [CrossRef]
  55. Stam, R.; Jupe, J.; Howden, A.J.; Morris, J.A.; Boevink, P.C.; Hedley, P.E.; Huitema, E. Identification and characterisation CRN effectors in Phytophthora capsici shows modularity and functional diversity. PLoS ONE 2013, 8, e59517. [Google Scholar] [CrossRef]
  56. Frantzeskakis, L.; Kusch, S.; Panstruga, R. The need for speed: Compartmentalized genome evolution in filamentous phytopathogens. Mol. Plant Pathol. 2019, 20, 3–7. [Google Scholar] [CrossRef] [PubMed]
  57. Alexander, D.; Goodman, R.M.; Gut-Rella, M.; Glascock, C.; Weymann, K.; Friedrich, L.; Maddox, D.; Ahl-Goy, P.; Luntz, T.; Ward, E.S. Increased tolerance to two oomycete pathogens in transgenic tobacco expressing pathogenesis-related protein 1a. Proc. Natl. Acad. Sci. USA 1993, 90, 7327–7331. [Google Scholar] [CrossRef] [PubMed]
  58. Jashni, M.K.; Mehrabi, R.; Collemare, J.; Mesarich, C.H.; de Wit, P.J. The battle in the apoplast: Further insights into the roles of proteases and their inhibitors in plant–pathogen interactions. Front. Plant Sci. 2015, 6, 584. [Google Scholar] [CrossRef] [PubMed]
  59. Gullner, G.; Komives, T.; Király, L.; Schröder, P. Glutathione S-transferase enzymes in plant-pathogen interactions. Front. Plant Sci. 2018, 9, 1836. [Google Scholar] [CrossRef] [PubMed]
  60. Hernández, I.; Chacón, O.; Rodriguez, R.; Portieles, R.; López, Y.; Pujol, M.; Borrás-Hidalgo, O. Black shank resistant tobacco by silencing of glutathione S-transferase. Biochem. Biophys. Res. Commun. 2009, 387, 300–304. [Google Scholar] [CrossRef]
  61. Stam, R.; Howden, A.J.M.; Delgado Cerezo, M.; Amaro, T.M.; Motion, G.B.; Pham, J.; Huitema, E. Characterization of cell death inducing Phytophthora capsici CRN effectors suggests diverse activities in the host nucleus. Front. Plant Sci. 2013, 4, 387. [Google Scholar] [CrossRef] [PubMed]
Figure 1. qRT-PCR validation of the DEGs identified in P. nicotianae by RNAseq analysis. Difference in relative gene expression between groups was determined using t-test in Prism 8. Significance is indicated using * for p value < 0.05, **** for p value < 0.0001. Genes PPTG_08585 and PPTG_20266 showed a lower relative expression in P. nicotianae when infecting K 326 Wz/Wz compared to infecting Hicks. Genes PPTG_10666 and PPTG_19949 showed a higher relative expression in P. nicotianae when infecting K 326 Wz/Wz compared to infecting Hicks. The expression of the genes was normalized to Ubc and WS21 as two internal controls.
Figure 1. qRT-PCR validation of the DEGs identified in P. nicotianae by RNAseq analysis. Difference in relative gene expression between groups was determined using t-test in Prism 8. Significance is indicated using * for p value < 0.05, **** for p value < 0.0001. Genes PPTG_08585 and PPTG_20266 showed a lower relative expression in P. nicotianae when infecting K 326 Wz/Wz compared to infecting Hicks. Genes PPTG_10666 and PPTG_19949 showed a higher relative expression in P. nicotianae when infecting K 326 Wz/Wz compared to infecting Hicks. The expression of the genes was normalized to Ubc and WS21 as two internal controls.
Agronomy 11 00656 g001
Figure 2. Enriched GO terms (colored in yellow, adjusted p value < 0.05) for (A) up-regulated and (B) down-regulated DEGs identified in the Wz-Wz isolate using BiNGO.
Figure 2. Enriched GO terms (colored in yellow, adjusted p value < 0.05) for (A) up-regulated and (B) down-regulated DEGs identified in the Wz-Wz isolate using BiNGO.
Agronomy 11 00656 g002
Figure 3. Enriched GO terms (colored in yellow, adjusted p value < 0.05) for down-regulated DEGs identified in the Wz-H isolate using BiNGO.
Figure 3. Enriched GO terms (colored in yellow, adjusted p value < 0.05) for down-regulated DEGs identified in the Wz-H isolate using BiNGO.
Agronomy 11 00656 g003aAgronomy 11 00656 g003b
Figure 4. KEGG pathways enriched for up-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-Wz isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Figure 4. KEGG pathways enriched for up-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-Wz isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Agronomy 11 00656 g004
Figure 5. KEGG pathways enriched for up-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-H isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Figure 5. KEGG pathways enriched for up-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-H isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Agronomy 11 00656 g005
Figure 6. KEGG pathways enriched for down-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-Wz isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Figure 6. KEGG pathways enriched for down-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-Wz isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Agronomy 11 00656 g006
Figure 7. KEGG pathways enriched for down-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-H isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Figure 7. KEGG pathways enriched for down-regulated DEGs in K 326 Wz/Wz inoculated with the Wz-H isolate of P. nicotianae compared to inoculated Hicks. The y-axis indicates the name of the KEGG pathway. The dot size means the gene number. The dot color indicates the q-value.
Agronomy 11 00656 g007
Table 1. Genes and corresponding primers used for qRT-PCR validation.
Table 1. Genes and corresponding primers used for qRT-PCR validation.
GeneRegulationForward PrimerReverse Primer
PPTG_10666UpCGTTCTCTTTTGCTCACGGACAGCTCCGACAAGTACACTG
PPTG_19949UpCAACACTGTCACTGCTGGATGATCCAGTTGCTAGCGAGAG
PPTG_20266DownCTCTCCGAAACAGAACCAACTGTAGATCTCGGCAGTAACGC
PPTG_08585DownAACACCACTACTCCAGCACTACAACTTCACCACATCCGTC
Ubc (ubiquitin-conjugating enzyme) CCACTTAGAGCACGCTAGGATACCGACTGTCCTTCGTTCA
WS21 (40S ribosomal protein S3A) TACGCCAAGACGGCTCAGATTCCATCAGACGCACCAGG
Table 2. Summary of RNAseq data and mapping results.
Table 2. Summary of RNAseq data and mapping results.
Host
Genotype
Isolate for InoculationReplicationTotal ReadsP. nicotianaeN. tabacum
No. and Rate of Reads Mapped Overall Alignment RateNo. and Rate of Reads Mapped Overall Alignment Rate
HicksWz-H132,616,24511,799,948 (36.18%)38.50%1,170,706 (3.59%)4.77%
HicksWz-H237,590,7538,954,805 (23.82%)25.42%691,568 (1.84%)2.55%
HicksWz-H332,142,2838,581,032 (26.70%)28.55%1,526,273 (4.75%)6.21%
K 326 Wz/WzWz-H130,738,9116,756,839 (21.98%)23.62%1,234,275 (4.02%)5.84%
K 326 Wz/WzWz-H232,228,6247,512,158 (23.31%)24.89%2,571,539 (7.98%)10.15%
K 326 Wz/WzWz-H341,304,1378,159,363 (19.75%)21.14%1,146,835 (2.78%)3.63%
HicksWz-Wz132,441,5208,583,661 (26.46%)28.35%1,003,943 (3.09%)4.19%
HicksWz-Wz233,639,7496,441,805 (19.15%)20.54%561,746 (1.67%)2.95%
HicksWz-Wz330,538,46810,333,429 (33.84%)36.10%557,494 (1.83%)2.91%
K 326 Wz/WzWz-Wz132,424,6849,437,437 (29.11%)31.12%5,499,898 (16.96%)20.63%
K 326 Wz/WzWz-Wz234,550,2327,129,753 (20.64%)22.21%412,999 (1.20%)1.98%
K 326 Wz/WzWz-Wz330,323,2917,477,321 (24.66%)26.38%852,994 (2.81%)4.20%
Average33,378,241 27.23% 5.83%
Table 3. DEGs identified in the Wz-Wz isolate of P. nicotianae by comparing transcriptomes in inoculated K 326 Wz/Wz to inoculated Hicks.
Table 3. DEGs identified in the Wz-Wz isolate of P. nicotianae by comparing transcriptomes in inoculated K 326 Wz/Wz to inoculated Hicks.
Up-Regulated GenelogFCFDRAnnotation in NCBI
PPTG_021212.727299920.04116515Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily
PPTG_106661.401707450.00461859NADB_Rossmann
PPTG_123001.389344980.0113136Elicitin protein RAL13D [Phytophthora nicotianae]
PPTG_067671.297858290.00975047Cytochrome P450
PPTG_007311.142443710.02689335Mitochondrial succinate-semialdehyde dehydrogenase and ALDH family members 5A1 and 5F1-like
PPTG_081451.061660010.036554364-aminobutyrate aminotransferase or related aminotransferase
PPTG_013161.011597680.0113136Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes
PPTG_068860.97701230.04116515Mitochondrial carrier protein
PPTG_004330.956875420.04116515Amino acid permease
PPTG_054700.944392870.00975047SPRY domain in Ran binding proteins, SSH4, HECT E3 and SPRYD3
PPTG_199490.906214780.01386612Peptidase domain in the S8 and S53 families
PPTG_087780.897828490.0287979NA
PPTG_111820.894671370.04116515GAF domain
PPTG_105950.880998980.02633833Second domain of the pleiotropic drug resistance-like (PDR) subfamily G of ATP-binding cassette transporters
PPTG_058340.807836380.01128107Putative lectin [Phytophthora palmivora var. palmivora]
PPTG_121580.634683180.02633833Serine/Threonine protein kinases, catalytic domain
Down-Regulated GenelogFCFDRAnnotation in NCBI
PPTG_12754−0.63082130.0411651560S ribosomal protein L38
PPTG_19261−0.65136290.01740912WRKY transcription factor 19 [Phytophthora nicotianae]
PPTG_15145−0.78442010.04116515Scavenger mRNA decapping enzyme C-term binding
PPTG_00424−0.83201010.04116515Amino acid permease
PPTG_19041−0.91012040.02968312acetate kinase A/propionate kinase 2
PPTG_00957−0.92686080.04550147NA
PPTG_00099−0.92763550.03028585NA
PPTG_11197−1.017350.039709743′-phosphoadenosine 5′-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase or related enzyme
PPTG_09433−1.24312760.02997457Major Facilitator Superfamily (MFS) proteins
PPTG_17813−1.24343950.04550147Ankyrin repeats
PPTG_04568−1.35413290.0459794PQ-loop
PPTG_02974−1.40047050.03655436Major Facilitator Superfamily (MFS) proteins
PPTG_02595−1.499230.03655436NAD(P)+-dependent aldehyde dehydrogenase superfamily
PPTG_11386−1.50476740.02633833NA
PPTG_07126−1.52482130.04304619Short chain dehydrogenase
PPTG_12006−1.59574630.01170615Glycosyl hydrolase family 1
PPTG_08585−1.61802570.00106403Old yellow enzyme (OYE)-like FMN binding domain
PPTG_18570−1.6339930.01009357Zinc finger, C2H2 type
PPTG_23779−1.63475970.00427631NAD(P)H:FMN oxidoreductases, oxygen-insensitive nitroreductase, flavin reductase P, dihydropteridine reductase, NADH oxidase or NADH dehydrogenase
PPTG_05530−1.69293250.01258482NADPH oxidase (NOX)
PPTG_02448−1.74629090.00975047Major Facilitator Superfamily (MFS) proteins
PPTG_18743−1.78556090.03655436NA
PPTG_13181−2.09414620.01009357Major Facilitator Superfamily (MFS) proteins
PPTG_08485−2.11921350.02633833Major Facilitator Superfamily (MFS) proteins
PPTG_09275−2.17700960.0000271NADPH-dependent FMN reductase
PPTG_00236−2.20193160.02968312TonB receptor activity [Phytophthora megakarya]
PPTG_13068−2.36678250.03655436Membrane-associating domain
PPTG_20266-2.46974110.00888653NADPH-dependent FMN reductase
PPTG_04065−3.37562580.03655436ZIP Zinc transporter
PPTG_10399−3.91146760.01740912D-arabinose 1-dehydrogenase, Zn-dependent alcohol dehydrogenase family
Table 4. DEGs identified in Wz-H isolate of P. nicotianae by comparing transcriptomes in inoculated K 326 Wz/Wz to inoculated Hicks.
Table 4. DEGs identified in Wz-H isolate of P. nicotianae by comparing transcriptomes in inoculated K 326 Wz/Wz to inoculated Hicks.
Up-Regulated GenelogFCFDRAnnotation in NCBI
PPTG_011621.759739460.03399441Exonuclease-Endonuclease-Phosphatase (EEP) domain superfamily
PPTG_014841.663310020.01294692Amino_oxidase; Flavin containing amine oxidoreductase
PPTG_087211.365733350.03296512SCP-like extracellular protein domain
PPTG_126931.355657870.0217849NA
PPTG_159821.228899160.03661908NAD(P)-dependent dehydrogenase
PPTG_174421.148158540.03856894Isoprenylcysteine carboxyl methyltransferase (ICMT) family
PPTG_199491.093942160.00569986Peptidase domain in the S8 and S53 families
PPTG_067671.092395420.02680104Cytochrome P450
PPTG_106661.050562690.02831652Rossmann-fold NAD(P)(+)-binding proteins
PPTG_234191.017401890.0217849large tegument protein UL36;
PPTG_043770.940435420.03296512Major Facilitator Superfamily (MFS) proteins
PPTG_054700.911873910.01702338SPRY domain in Ran binding proteins
PPTG_228530.859439940.03296512Putative storage protein LPV
PPTG_130130.83072650.0217849Cyst germination specific acidic repeat protein
PPTG_203680.827588490.02281486NA
PPTG_015880.825797180.02281486Tetratricopeptide repeat
PPTG_043410.787025060.014592Kazal type serine protease inhibitors
PPTG_006550.76586040.02490186Iron-enterobactin transporter ATP-binding protein
PPTG_085590.763099340.03296512NA
PPTG_006230.756650290.0217849The Phox Homology domain, a phosphoinositide binding module
PPTG_225600.722355220.04236865Ricin-type beta-trefoil
PPTG_075530.718361690.03296512HAM34-like putative membrane protein
PPTG_019060.698456440.03303654Cytochrome P450
PPTG_117770.698399190.03303654Alpha-N-acetylglucosaminidase (NAGLU) tim-barrel domain
PPTG_130160.686303190.03147853Glycosyltransferase (GlcNAc)
PPTG_173230.662675430.03303654tRNA binding domain
PPTG_150530.660977030.04910001NA
PPTG_031130.655861160.03147853NA
PPTG_003400.549045340.04815318Dynein heavy chain and region D6 of dynein motor
Down-Regulated GenelogFCFDRAnnotation in NCBI
PPTG_17561−0.58584540.04815318Biotinyl_lipoyl_domains
PPTG_12754−0.64074690.0361385860S ribosomal protein L38
PPTG_02651−0.83430730.03303654TLR4 regulator and MIR-interacting MSAP
PPTG_00501−0.89332850.03147853Abhydrolase
PPTG_21942−0.92967310.03842764Phosphate acetyltransferase
PPTG_11197−1.03589660.033036543′-phosphoadenosine 5′-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase or related enzyme
PPTG_08585−1.06291250.02281486Old yellow enzyme (OYE)-like FMN binding domain
PPTG_21974−1.13839510.02281486NA
PPTG_13205−1.22685290.04815318Elicitin
PPTG_21937−1.24920390.03296512START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily
PPTG_05327−1.28371310.03147853NA
PPTG_15084−1.51598090.04674932TKL/DRK protein kinase
PPTG_02595−1.55671190.03303654NAD(P)+-dependent aldehyde dehydrogenase superfamily
PPTG_09275−1.69349630.00080536NADPH-dependent FMN reductase
PPTG_18743−1.72314320.03661908NA
PPTG_15596−1.76148630.02490186START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily
PPTG_23779−1.77048770.00245828NAD(P)H:FMN oxidoreductases, oxygen-insensitive nitroreductase, flavin reductase P, dihydropteridine reductase, NADH oxidase or NADH dehydrogenase.
PPTG_05968−2.03609540.02831652Redox-sensitive bicupin YhaK, pirin superfamily
PPTG_20266−2.15550070.0217849NADPH-dependent FMN reductase
PPTG_05967−2.46759840.00569986Redox-sensitive bicupin YhaK, pirin superfamily
PPTG_16697−3.39933240.04099675Solute carrier families 5 and 6-like
Table 5. Enriched KEGG pathways in the Wz-Wz and Wz-H isolates of P. nicotianae on K 326 Wz/Wz.
Table 5. Enriched KEGG pathways in the Wz-Wz and Wz-H isolates of P. nicotianae on K 326 Wz/Wz.
IsolateDEG RegulationTermRich-FactorCorrected p-Value
Wz-Wzup-regulatedSpliceosome0.0180.049
down-regulatedUbiquinone and other terpenoid-quinone biosynthesis0.1180.008
Biosynthesis of secondary metabolites0.0100.040
Wz-Hdown-regulatedBiosynthesis of secondary metabolites0.0150.000
Ubiquinone and other terpenoid-quinone biosynthesis0.1180.002
Biosynthesis of antibiotics0.0160.002
Glyoxylate and dicarboxylate metabolism0.0530.005
Glycine, serine and threonine metabolism0.0510.006
Metabolic pathways0.0050.007
Carbon metabolism0.0140.043
Ascorbate and aldarate metabolism0.0670.049
Sulfur metabolism0.0590.049
Histidine metabolism0.0560.049
Table 6. SNPs identified in thte Wz-Wz and Wz-H isolates of P. nicotianae.
Table 6. SNPs identified in thte Wz-Wz and Wz-H isolates of P. nicotianae.
CHROMPOSGeneAnnotationWz-WzWz-H
70000001852490811188712PPTG_07972Hypothetical proteinC/CC/T
7000000185249382599392PPTG_05817Transcription factor SC/CC/T
7000000185249084546281PPTG_05165Hypothetical proteinT/CT/T
7000000185249172182510PPTG_17734Crinkler familyG/AG/G
70000001852493442066387PPTG_03590Hypothetical proteinG/AG/G
70000001852490611073008NANAA/TT/T
70000001852493442066377PPTG_03590Hypothetical proteinA/GG/G
70000001852493442066882PPTG_03590Hypothetical proteinC/TT/T
Table 7. Number of DEGs identified in K 326 Wz/Wz inoculated with either the Wz-Wz or the Wz-H isolate of P. nicotianae compared to Hicks inoculated with the same isolate.
Table 7. Number of DEGs identified in K 326 Wz/Wz inoculated with either the Wz-Wz or the Wz-H isolate of P. nicotianae compared to Hicks inoculated with the same isolate.
Tobacco Genotype for DEG IdentificationIsolate for Inoculation Total No. of DEGsUp-Regulated DEGsDown-Regulated DEGs
K 326 Wz/WzWz-Wz608305303
K 326 Wz/WzWz-H567174393
Shared DEGs25794163
Table 8. GO terms enriched for DEGs exclusively identified in K326 Wz/Wz inoculated with the Wz-Wz isolate.
Table 8. GO terms enriched for DEGs exclusively identified in K326 Wz/Wz inoculated with the Wz-Wz isolate.
Up-Regulated DEGs in K326 Wz/Wz
GO AccessionTermTerm Typep ValueFDR
GO: 0044710single-organism metabolic processP3.40 × 10−60.0019
GO: 0044281small molecule metabolic processP0.000150.0063
GO: 0044712single-organism catabolic processP0.000150.0063
GO: 0046031ADP metabolic processP0.000180.0063
GO: 0009179purine ribonucleoside diphosphate metabolic processP0.000180.0063
GO: 0046496nicotinamide nucleotide metabolic processP0.000150.0063
GO: 1901575organic substance catabolic processP0.000130.0063
GO: 0051186cofactor metabolic processP6.50 × 10−50.0063
GO: 0044723single-organism carbohydrate metabolic processP0.000160.0063
GO: 0006757ATP generation from ADPP0.000180.0063
GO: 0006732coenzyme metabolic processP7.40 × 10−50.0063
GO: 0009135purine nucleoside diphosphate metabolic processP0.000180.0063
GO: 0009185ribonucleoside diphosphate metabolic processP0.000180.0063
GO: 0072524pyridine-containing compound metabolic processP0.000170.0063
GO: 0006096glycolytic processP0.000180.0063
GO: 0019362pyridine nucleotide metabolic processP0.000150.0063
GO: 0006733oxidoreduction coenzyme metabolic processP0.000190.0063
GO: 0044724single-organism carbohydrate catabolic processP0.000260.0075
GO: 0009056catabolic processP0.000250.0075
GO: 0006090pyruvate metabolic processP0.000290.0082
GO: 0006165nucleoside diphosphate phosphorylationP0.000320.0086
GO: 0009132nucleoside diphosphate metabolic processP0.000420.011
GO: 0016209antioxidant activityF8.40 × 10−50.011
GO: 0003824catalytic activityF8.50 × 10−50.011
GO: 0046939nucleotide phosphorylationP0.000530.012
GO: 0005975carbohydrate metabolic processP0.000530.012
GO: 0016052carbohydrate catabolic processP0.000560.012
GO: 0016903oxidoreductase activity, acting on the aldehyde or oxo group of donorsF0.000170.014
GO: 0006082organic acid metabolic processP0.00140.03
GO: 0043436oxoacid metabolic processP0.00160.033
GO: 0019752carboxylic acid metabolic processP0.00160.033
GO: 0043168anion bindingF0.000570.035
GO: 1901135carbohydrate derivative metabolic processP0.00250.048
Down-Regulated DEGs in K326 Wz/Wz
GO AccessionTermTerm Typep ValueFDR
GO: 0000786nucleosomeC5.10 × 10−272.10 × 10−25
GO: 0032993protein-DNA complexC5.10 × 10−272.10 × 10−25
GO: 0044815DNA packaging complexC8.30 × 10−272.20 × 10−25
GO: 0000785chromatinC3.40 × 10−266.90 × 10−25
GO: 0046982protein heterodimerization activityF1.60 × 10−262.40 × 10−24
GO: 0031497chromatin assemblyP5.30 × 10−267.70 × 10−24
GO: 0065004protein-DNA complex assemblyP8.30 × 10−267.70 × 10−24
GO: 0034728nucleosome organizationP5.30 × 10−267.70 × 10−24
GO: 0006334nucleosome assemblyP5.30 × 10−267.70 × 10−24
GO: 0071824protein-DNA complex subunit organizationP8.30 × 10−267.70 × 10−24
GO: 0006333chromatin assembly or disassemblyP1.10 × 10−258.80 × 10−24
GO: 0006323DNA packagingP1.70 × 10−251.20 × 10−23
GO: 0071103DNA conformation changeP2.60 × 10−241.50 × 10−22
GO: 0044427chromosomal partC1.00 × 10−231.70 × 10−22
GO: 0005694chromosomeC1.90 × 10−222.50 × 10−21
GO: 0006325chromatin organizationP7.90 × 10−234.10 × 10−21
GO: 0034622cellular macromolecular complex assemblyP4.30 × 10−212.00 × 10−19
GO: 0051276chromosome organizationP1.00 × 10−204.20 × 10−19
GO: 0065003macromolecular complex assemblyP1.30 × 10−205.00 × 10−19
GO: 0070271protein complex biogenesisP8.40 × 10−202.80 × 10−18
GO: 0006461protein complex assemblyP8.40 × 10−202.80 × 10−18
GO: 0022607cellular component assemblyP4.90 × 10−191.50 × 10−17
GO: 0071822protein complex subunit organizationP1.40 × 10−183.90 × 10−17
GO: 0043933macromolecular complex subunit organizationP4.60 × 10−181.20 × 10−16
GO: 0044085cellular component biogenesisP3.80 × 10−179.70 × 10−16
GO: 0006996organelle organizationP5.30 × 10−171.30 × 10−15
GO: 0046983protein dimerization activityF1.70 × 10−131.30 × 10−11
GO: 0016043cellular component organizationP5.30 × 10−121.20 × 10−10
GO: 0071840cellular component organization or biogenesisP3.10 × 10−116.90 × 10−10
GO: 0044422organelle partC2.30 × 10−102.30 × 10−9
GO: 0044446intracellular organelle partC2.30 × 10−102.30 × 10−9
GO: 0003677DNA bindingF5.50 × 10−112.80 × 10−9
GO: 0043234protein complexC4.90 × 10−94.50 × 10−8
GO: 0043232intracellular non-membrane-bounded organelleC1.30 × 10−89.40 × 10−8
GO: 0043228non-membrane-bounded organelleC1.30 × 10−89.40 × 10−8
GO: 0005634nucleusC3.00 × 10−62.00 × 10−5
GO: 0009987cellular processP2.10 × 10−64.30 × 10−5
GO: 0003676nucleic acid bindingF1.30 × 10−65.10 × 10−5
GO: 0032991macromolecular complexC8.20 × 10−65.10 × 10−5
GO: 0006352DNA-templated transcription, initiationP6.00 × 10−60.00012
GO: 0043231intracellular membrane-bounded organelleC0.00020.0011
GO: 0043227membrane-bounded organelleC0.00020.0011
GO: 0043229intracellular organelleC0.000710.0034
GO: 0043226organelleC0.000710.0034
GO: 1901576organic substance biosynthetic processP0.000250.0046
GO: 0009058biosynthetic processP0.000250.0046
GO: 1901363heterocyclic compound bindingF0.000190.005
GO: 0097159organic cyclic compound bindingF0.000190.005
GO: 0019438aromatic compound biosynthetic processP0.000450.008
GO: 1901362organic cyclic compound biosynthetic processP0.00060.009
GO: 0097659nucleic acid-templated transcriptionP0.000590.009
GO: 0006351transcription, DNA-templatedP0.000590.009
GO: 0032774RNA biosynthetic processP0.00060.009
GO: 0044249cellular biosynthetic processP0.000570.009
GO: 0034654nucleobase-containing compound biosynthetic processP0.00180.027
GO: 0044424intracellular partC0.00610.028
GO: 0065007biological regulationP0.00240.034
GO: 0050794regulation of cellular processP0.00250.034
GO: 0005622intracellularC0.00810.035
GO: 0044711single-organism biosynthetic processP0.00290.039
GO: 0050789regulation of biological processP0.00310.04
GO: 0065008regulation of biological qualityP0.00340.042
GO: 0018130heterocycle biosynthetic processP0.00360.043
Table 9. GO terms enriched for DEGs exclusively identified in K326 Wz/Wz inoculated with the Wz-H isolate.
Table 9. GO terms enriched for DEGs exclusively identified in K326 Wz/Wz inoculated with the Wz-H isolate.
Down-Regulated DEGs in K326 Wz/Wz
GO AccessionTermTerm Typep ValueFDR
GO: 0006457protein foldingP9.70 × 10−113.60 × 10−8
GO: 0051082unfolded protein bindingF1.30 × 10−92.90 × 10−7
GO: 0005488bindingF2.30 × 10−50.0025
GO: 0043565sequence-specific DNA bindingF0.000350.026
GO: 1901363heterocyclic compound bindingF0.00110.048
GO: 0001071nucleic acid binding transcription factor activityF0.00150.048
GO: 0097159organic cyclic compound bindingF0.00110.048
GO: 0003700transcription factor activity, sequence-specific DNA bindingF0.00150.048
Table 10. GO terms enriched for DEGs identified in K326Wz/Wz across inoculations using the Wz-Wz and Wz-H isolates.
Table 10. GO terms enriched for DEGs identified in K326Wz/Wz across inoculations using the Wz-Wz and Wz-H isolates.
GO Terms Enriched for Up-Regulated DEGs in K326 Wz/Wz
GO AccessionTermTerm Typep ValueFDR
GO: 0004867serine-type endopeptidase inhibitor activityF2.60 × 10−114.20 × 10−9
GO: 0030414peptidase inhibitor activityF1.40 × 10−84.40 × 10−7
GO: 0061134peptidase regulator activityF1.40 × 10−84.40 × 10−7
GO: 0004866endopeptidase inhibitor activityF1.40 × 10−84.40 × 10−7
GO: 0061135endopeptidase regulator activityF1.40 × 10−84.40 × 10−7
GO: 0044710single-organism metabolic processP2.10 × 10−60.00012
GO: 0004857enzyme inhibitor activityF1.30 × 10−50.00036
GO: 0050660flavin adenine dinucleotide bindingF8.80 × 10−50.0018
GO: 0030234enzyme regulator activityF7.70 × 10−50.0018
GO: 0098772molecular function regulatorF0.000140.0025
GO: 0044699single-organism processP0.000150.0043
GO: 0016491oxidoreductase activityF0.000350.0057
GO: 0055114oxidation-reduction processP0.000320.0063
GO: 0050662coenzyme bindingF0.000850.012
GO: 0048037cofactor bindingF0.00210.029
GO Terms Enriched for Down-Regulated DEGs in K326 Wz/Wz
GO AccessionTermTerm Typep ValueFDR
GO: 0016758transferase activity, transferring hexosyl groupsF3.9 × 10−50.01
GO: 0016757transferase activity, transferring glycosyl groupsF0.000290.013
GO: 0015405P-P-bond-hydrolysis-driven transmembrane transporter activityF0.000430.013
GO: 0042626ATPase activity, coupled to transmembrane movement of substancesF0.000210.013
GO: 0015399primary active transmembrane transporter activityF0.000430.013
GO: 0043492ATPase activity, coupled to movement of substancesF0.000230.013
GO: 0016491oxidoreductase activityF0.000480.013
GO: 0016820hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substancesF0.000420.013
GO: 0016667oxidoreductase activity, acting on a sulfur group of donorsF0.000360.013
GO: 0016887ATPase activityF0.000730.018
GO: 0006457protein foldingP0.000310.032
GO: 0042592homeostatic processP0.00040.032
GO: 0019725cellular homeostasisP0.000220.032
GO: 0045454cell redox homeostasisP0.000170.032
GO: 0042623ATPase activity, coupledF0.00210.048
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jin, J.; Shi, R.; Lewis, R.S.; Shew, H.D. RNAseq Reveals Differential Gene Expression Contributing to Phytophthora nicotianae Adaptation to Partial Resistance in Tobacco. Agronomy 2021, 11, 656. https://doi.org/10.3390/agronomy11040656

AMA Style

Jin J, Shi R, Lewis RS, Shew HD. RNAseq Reveals Differential Gene Expression Contributing to Phytophthora nicotianae Adaptation to Partial Resistance in Tobacco. Agronomy. 2021; 11(4):656. https://doi.org/10.3390/agronomy11040656

Chicago/Turabian Style

Jin, Jing, Rui Shi, Ramsey Steven Lewis, and Howard David Shew. 2021. "RNAseq Reveals Differential Gene Expression Contributing to Phytophthora nicotianae Adaptation to Partial Resistance in Tobacco" Agronomy 11, no. 4: 656. https://doi.org/10.3390/agronomy11040656

APA Style

Jin, J., Shi, R., Lewis, R. S., & Shew, H. D. (2021). RNAseq Reveals Differential Gene Expression Contributing to Phytophthora nicotianae Adaptation to Partial Resistance in Tobacco. Agronomy, 11(4), 656. https://doi.org/10.3390/agronomy11040656

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop