Disease Resistance and Genes in 146 Wheat Cultivars (Lines) from the Huang-Huai-Hai Region of China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Seedling Tests
2.3. Adult-Plant Stage Tests in Field
2.4. DNA Extraction
2.5. PCR Amplification and Electrophoresis Analysis
2.6. Data Analysis
3. Results
3.1. Seedling Resistance Evaluation
3.2. Adult-Plant Resistance Evaluation
3.3. Identification of the Resistance Genes Using Molecular Markers
3.3.1. Identification of Yr Genes
3.3.2. Identification of Pm Gene
3.3.3. Identification of Fhb Gene
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
APR | Adult-plant resistance |
ASR | All-stage resistance |
Bgt | Blumeria graminis f.sp. tritici Em. Marchal |
CYR | Chinese yellow rust |
DNA | Deoxyribonucleic acid |
DS | Disease severity |
EST | Expressed sequence tag |
FHB | Fusarium head blight |
Fhb | Fusarium head blight resistance genes |
IT | Infection type |
KASP | Kompetitive allele-specific PCR |
NIL | near isogenic line |
PCR | Polymerase chain reaction |
Pm | Powdery mildew resistance genes |
Pst | Puccinia striiformis Westend. f. sp. tritici Erikss |
SSR | Simple sequence repeat |
STS | Sequence-tagged site |
Yr | Yellow rust (stripe rust) resistance genes |
References
- Chen, X.M. Epidemiology and control of stripe rust (Puccinia striiformis f. sp. tritici) on wheat. Can. J. Plant Pathol. 2005, 27, 314–337. [Google Scholar] [CrossRef]
- Wan, A.M.; Chen, X.M.; He, Z.H. Wheat stripe rust in China. Aust. J. Agric. Res. 2007, 58, 605–619. [Google Scholar] [CrossRef]
- Ma, Z.H. Researches and control of wheat stripe rust in China. J. Plant Prot. 2018, 45, 1–6. [Google Scholar] [CrossRef]
- Wu, J.; Yu, R.; Wang, H.; Zhou, C.; Huang, S.; Jiao, H.; Yu, S.; Nie, X.; Wang, Q.; Liu, S.; et al. A large-scale genomic association analysis identifies the candidate causal genes conferring stripe rust resistance under multiple field environments. Plant Biotechnol. J. 2021, 19, 177–191. [Google Scholar] [CrossRef]
- Samobor, V.; Vukobratović, M.; Jošt, M. Effect of powdery mildew attack on quality parameters and experimental bread baking of wheat. Acta Agric. Slov. 2006, 87, 381–391. Available online: http://aas.bf.uni-lj.si/september2006/18jost.pdf (accessed on 24 April 2021).
- Singh, R.P.; Singh, P.K.; Rutkoski, J.; Hodson, D.P.; He, X.; Jorgensen, L.N.; Hovmoller, M.S.; Huerta-Espino, J. Disease Impact on Wheat Yield Potential and Prospects of Genetic Control. Annu. Rev. Phytopathol. 2016, 54, 303–322. [Google Scholar] [CrossRef] [Green Version]
- Sun, H.G.; Hu, J.H.; Song, W.; Qiu, D.; Cui, L.; Wu, P.P.; Zhang, H.J.; Liu, H.W.; Yang, L.; Qu, Y.F.; et al. Pm61: A recessive gene for resistance to powdery mildew in wheat landrace Xuxusanyuehuang identified by comparative genomics analysis. Theor. Appl. Genet. 2018, 131, 2085–2097. [Google Scholar] [CrossRef]
- Wang, H.W.; Sun, S.L.; Ge, W.Y.; Zhao, L.F.; Hou, B.Q.; Wang, K.; Lyu, Z.F.; Chen, L.Y.; Xu, S.S.; Guo, J.; et al. Horizontal gene transfer of Fhb7 from fungus underlies Fusarium head blight resistance in wheat. Science 2020, 368, 844–849. [Google Scholar] [CrossRef] [PubMed]
- Li, J.B.; Dundas, I.; Dong, C.M.; Li, G.R.; Trethowan, R.; Yang, Z.J.; Hoxha, S.; Zhang, P. Identification and characterization of a new stripe rust resistance gene Yr83 on rye chromosome 6R in wheat. Theor. Appl. Genet. 2020, 133, 1095–1107. [Google Scholar] [CrossRef]
- Zhou, Y.; He, Z.; Zhang, G.S.; Xia, L.Q. Utilization of 1BL/1RS translocation in wheat breeding in China. Zuo Wu Xue Bao 2004, 30, 531–535. [Google Scholar]
- Han, D.J.; Wang, Q.L.; Chen, X.M.; Zeng, Q.D.; Wu, J.H.; Xue, W.B.; Zhan, G.M.; Huang, L.L.; Kang, Z.S. Emerging Yr26-Virulent Races of Puccinia striiformis f. sp. tritici Are Threatening Wheat Production in the Sichuan Basin, China. Plant Dis. 2015, 99, 754–760. [Google Scholar] [CrossRef] [Green Version]
- McIntosh, R.; Mu, J.M.; Han, D.J.; Kang, Z.S. Wheat stripe rust resistance gene Yr24/Yr26: A retrospective review. Crop. J. 2018, 6, 321–329. [Google Scholar] [CrossRef]
- Liu, J.; Chang, Z.J.; Zhang, X.J.; Yang, Z.J.; Li, X.; Jia, J.Q.; Zhan, H.X.; Guo, H.J.; Wang, J.M. Putative Thinopyrum intermedium-derived stripe rust resistance gene Yr50 maps on wheat chromosome arm 4BL. Theor. Appl. Genet. 2013, 126, 265–274. [Google Scholar] [CrossRef]
- Ash, G. Wheat Rusts: An Atlas of Resistance Genes. Australas. Plant Pathol. 1996, 25, 70. [Google Scholar] [CrossRef]
- Sharma-Poudyal, D.; Chen, X.M.; Wan, A.M.; Zhan, G.M.; Kang, Z.S.; Cao, S.Q.; Jin, S.L.; Morgounov, A.; Akin, B.; Mert, Z.; et al. Virulence Characterization of International Collections of the Wheat Stripe Rust Pathogen, Puccinia striiformis f. sp. tritici. Plant Dis. 2013, 97, 379–386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krattinger, S.G.; Sucher, J.; Selter, L.L.; Chauhan, H.; Zhou, B.; Tang, M.Z.; Upadhyaya, N.M.; Mieulet, D.; Guiderdoni, E.; Weidenbach, D.; et al. The wheat durable, multipathogen resistance gene Lr34 confers partial blast resistance in rice. Plant Biotechnol. J. 2016, 14, 1261–1268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, F.; Jia, H.Y.; Zhang, X.J.; Qiao, L.Y.; Li, X.; Zheng, J.; Guo, H.J.; Powers, C.; Yan, L.L.; Chang, Z.J. Positional cloning of PmCH1357 reveals the origin and allelic variation of the Pm2 gene for powdery mildew resistance in wheat. Crop. J. 2019, 7, 771–783. [Google Scholar] [CrossRef]
- He, H.G.; Zhu, S.Y.; Zhao, R.H.; Jiang, Z.N.; Ji, Y.Y.; Ji, J.; Qiu, D.; Li, H.J.; Bie, T.D. Pm21, Encoding a Typical CC-NBS-LRR Protein, Confers Broad-Spectrum Resistance to Wheat Powdery Mildew Disease. Mol. Plant 2018, 11, 879–882. [Google Scholar] [CrossRef] [Green Version]
- Xing, L.; Hu, P.; Liu, J.; Witek, K.; Zhou, S.; Xu, J.; Zhou, W.; Gao, L.; Huang, Z.; Zhang, R.; et al. Pm21 from Haynaldia villosa Encodes a CC-NBS-LRR Protein Conferring Powdery Mildew Resistance in Wheat. Mol. Plant 2018, 11, 874–878. [Google Scholar] [CrossRef] [Green Version]
- Buerstmayr, H.; Ban, T.; Anderson, J.A. QTL mapping and marker-assisted selection for Fusarium head blight resistance in wheat: A review. Plant Breed. 2009, 128, 1–26. [Google Scholar] [CrossRef]
- Bernardo, A.N.; Ma, H.X.; Zhang, D.D.; Bai, G.H. Single nucleotide polymorphism in wheat chromosome region harboring Fhb1 for Fusarium head blight resistance. Mol. Breed. 2012, 29, 477–488. [Google Scholar] [CrossRef]
- Chen, S.L.; Zhang, Z.L.; Sun, Y.Y.; Li, D.S.; Gao, D.R.; Zhan, K.H.; Cheng, S.H. Identification of quantitative trait loci for Fusarium head blight (FHB) resistance in the cross between wheat landrace N553 and elite cultivar Yangmai 13. Mol Breed. 2021, 41, 24. [Google Scholar] [CrossRef]
- Line, R.F.; Qayoum, A. Virulence, aggressiveness, evolution, and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America. Tech. Bull.-United States Dep. Agric. 1992, 44, 1968–1987. [Google Scholar]
- Sheng, B.Q. Wheat powdery mildew was recorded using infection type in seedling stage. Plant Prot. 1984, 6, 49–53. [Google Scholar]
- Su, P.S.; Guo, X.X.; Fan, Y.H.; Wang, L.; Yu, G.H.; Ge, W.Y.; Zhao, L.F.; Ma, X.; Wu, J.J.; Li, A.F.; et al. Application of Brachypodium genotypes to the analysis of type II resistance to Fusarium head blight (FHB). Plant Sci. 2018, 272, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat. XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A. Genome 1993, 36, 476–482. [Google Scholar] [CrossRef] [PubMed]
- Saari, E.E.; Prescott, J.M. A scale for appraising the foliar intensity of wheat diseases. Plant Dis. Rep. 1975, 59, 377–380. [Google Scholar]
- Liu, L.Y.; Dong, Y.Y.; Huang, W.J.; Du, X.P.; Ren, B.Y.; Huang, L.S.; Zheng, Q.; Ma, H.Q. A Disease Index for Efficiently Detecting Wheat Fusarium Head Blight Using Sentinel-2 Multispectral Imagery. IEEE Access 2020, 8, 52181–52191. [Google Scholar] [CrossRef]
- Saghai-Maroof, M.A.; Soliman, K.M.; Jorgensen, R.A.; Allard, R.W. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA 1984, 81, 8014–8018. [Google Scholar] [CrossRef] [Green Version]
- Marchal, C.; Zhang, J.P.; Zhang, P.; Fenwick, P.; Steuernagel, B.; Adamski, N.M.; Boyd, L.; McIntosh, R.; Wulff, B.B.H.; Berry, S.; et al. BED-domain-containing immune receptors confer diverse resistance spectra to yellow rust. Nat. Plants 2018, 4, 662–668. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Yang, Z.J.; Li, G.R.; Zeng, Z.X.; Zhang, Y.; Zhou, J.P.; Liu, Z.H.; Ren, Z.L. Isolation of a new repetive DNA sequece from Secale africanum enables targeting of Secale chromatin in wheat background. Euphytica 2008, 159, 249–258. [Google Scholar] [CrossRef]
- Francis, H.A.; Leitch, A.R.; Koebner, R.M.D. Conversion of a Rapd-Generated Pcr Product, Containing a Novel Dispersed Repetitive Element, into a Fast and Robust Assay for the Presence of Rye Chromatin in Wheat. Theor. Appl. Genet. 1995, 90, 636–642. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.P.; Datta, D.; Priyamvada, S.S.; Tiwari, R. A diagnostic PCR based assay for stripe rust resistance gene Yr10 in wheat. Acta Phytopathol. Entomol. Hung. 2009, 44, 11–18. [Google Scholar] [CrossRef]
- Klymiuk, V.; Yaniv, E.; Huang, L.; Raats, D.; Fatiukha, A.; Chen, S.S.; Feng, L.H.; Frenkel, Z.; Krugman, T.; Lidzbarsky, G.; et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat. Commun. 2018, 9. [Google Scholar] [CrossRef] [Green Version]
- Zou, J.W.; Jia, W.L.; Li, L.X.; Chen, X.; Jia, D.; Yan, C.S. Kasp marker assays for functional genes of important trait in 120 wheat cultivars (lines). Mol. Plant. Breed. 2019, 17, 3945–3959. [Google Scholar] [CrossRef]
- Helguera, M.; Khan, I.A.; Kolmer, J.; Lijavetzky, D.; Zhong, Q.L.; Dubcovsky, J. PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines. Crop. Sci. 2003, 43, 1839–1847. [Google Scholar] [CrossRef]
- Lagudah, E.S.; McFadden, H.; Singh, R.P.; Huerta-Espino, J.; Bariana, H.S.; Spielmeyer, W. Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21–30. [Google Scholar] [CrossRef]
- Lagudah, E.S.; Krattinger, S.G.; Herrera-Foessel, S.; Singh, R.P.; Huerta-Espino, J.; Spielmeyer, W.; Brown-Guedira, G.; Selter, L.L.; Keller, B. Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theor. Appl. Genet. 2009, 119, 889–898. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Zhang, Y.P.; Han, D.J.; Kang, Z.S.; Li, G.P.; Cao, A.Z.; Chen, P.D. SSR and STS markers for wheat stripe rust resistance gene Yr26. Euphytica 2008, 159, 359–366. [Google Scholar] [CrossRef]
- Wu, J.H.; Zeng, Q.D.; Wang, Q.L.; Liu, S.J.; Yu, S.Z.; Mu, J.M.; Huang, S.; Sela, H.A.; Distelfeld, A.; Huang, L.L.; et al. SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26. Theor. Appl. Genet. 2018, 131, 1481–1496. [Google Scholar] [CrossRef]
- He, H.G.; Ji, Y.Y.; Zhu, S.Y.; Li, B.; Zhao, R.H.; Jiang, Z.N.; Bie, T.D. Genetic, Physical and Comparative Mapping of the Powdery Mildew Resistance Gene Pm21 Originating from Dasypyrum villosum. Front. Plant Sci. 2017, 8. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Z.; Wang, Q.L.; Wu, J.H.; Xue, W.B.; Zeng, Q.D.; Huang, L.L.; Kang, Z.S.; Han, D.J. Distribution of powdery mildew resistance gene Pm21 in Chinese winter wheat cultivars and breeding lines based on gene-specific marker. Sci. Agric. Sin. 2014, 47, 2078–2087. [Google Scholar] [CrossRef]
- Liu, Z.; Sun, Q.; Ni, Z.; Yang, T. Development of SCAR markers linked to the Pm21 gene conferring resistance to powdery mildew in common wheat. Plant Breed. 1999, 118, 215–219. [Google Scholar] [CrossRef] [Green Version]
- Brar, G.S.; Brule-Babel, A.L.; Ruan, Y.F.; Henriquez, M.A.; Pozniak, C.J.; Kutcher, H.R.; Hucl, P.J. Genetic factors affecting Fusarium head blight resistance improvement from introgression of exotic Sumai 3 alleles (including Fhb1, Fhb2, and Fhb5) in hard red spring wheat. BMC Plant Biol. 2019, 19. [Google Scholar] [CrossRef] [PubMed]
- Su, Z.Q.; Jin, S.J.; Zhang, D.D.; Bai, G.H. Development and validation of diagnostic markers for Fhb1 region, a major QTL for Fusarium head blight resistance in wheat. Theor. Appl. Genet. 2018, 131, 2371–2380. [Google Scholar] [CrossRef]
- Su, Z.Q.; Bernardo, A.; Tian, B.; Chen, H.; Wang, S.; Ma, H.X.; Cai, S.B.; Liu, D.T.; Zhang, D.D.; Li, T.; et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat. Genet. 2019, 51, 1099–1105. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Q.D.; Han, D.J.; Wang, Q.L.; Yuan, F.P.; Wu, J.H.; Zhang, L.; Wang, X.J.; Huang, L.L.; Chen, X.M.; Kang, Z.S. Stripe rust resistance and genes in Chinese wheat cultivars and breeding lines. Euphytica 2014, 196, 271–284. [Google Scholar] [CrossRef] [Green Version]
- Zhu, G.; Peng, M.; Liu, J.; Zou, X.; Wang, H.; Yang, L.; Gao, C.; Liu, Y. Evaluation on resistance of wheat varieties (lines) to Fusarium head blight, strip rust, powdery mildew and sharp eyespot in Hubei province. Plant Prot. 2020, 46, 204–209. [Google Scholar] [CrossRef]
- Wu, J.H.; Wang, Q.L.; Chen, X.M.; Wang, M.J.; Mu, J.M.; Lv, X.N.; Huang, L.L.; Han, D.J.; Kang, Z.S. Stripe rust resistance in wheat breeding lines developed for central Shaanxi, an overwintering region for Puccinia striiformis f. sp tritici in China. Can. J. Plant Pathol. 2016, 38, 317–324. [Google Scholar] [CrossRef]
- Li, Q.; Wang, B.T.; Chao, K.X.; Guo, J.; Song, J.R.; Yue, W.Y.; Li, Q. Molecular Detection of Stripe Rust Resistance Gene(s) in 115 Wheat Cultivars (lines) from the Yellow and Huai River Valley Wheat Region. J. Phytopathol. 2016, 164, 946–958. [Google Scholar] [CrossRef]
- Gebreslasie, Z.S.; Huang, S.; Zhan, G.M.; Badebo, A.; Zeng, Q.D.; Wu, J.H.; Wang, Q.L.; Liu, S.J.; Huang, L.L.; Wang, X.J.; et al. Stripe rust resistance genes in a set of Ethiopian bread wheat cultivars and breeding lines. Euphytica 2020, 216. [Google Scholar] [CrossRef] [Green Version]
- Yang, W.X.; Yang, F.P.; Dan, L.; He, Z.H.; Shang, X.W.; Xia, X.C. Molecular characterization of slow-rusting genes Lr34/Yr18 in Chinese wheat cultivars. Acta Agron. Sin. 2008, 34, 1109–1113. [Google Scholar] [CrossRef]
- Huang, L.; Xiao, X.Z.; Liu, B.; Gao, L.; Gong, G.S.; Chen, W.Q.; Zhang, M.; Liu, T.G. Identification of Stripe Rust Resistance Genes in Common Wheat Cultivars from the Huang-Huai-Hai Region of China. Plant Dis. 2020, 104, 1763–1770. [Google Scholar] [CrossRef] [PubMed]
- Guan, F.N.; Long, L.; Yao, F.J.; Wang, Y.Q.; Jiang, Q.T.; Kang, H.Y.; Chen, G.Y. Evaluation of Resistance to Stripe Rust and Molecular Detection of Important Known Yr Gene(s) of 152 Chinese Wheat Landraces from the Huang-huai-hai. Sci. Agric. Sin. 2020, 53, 3629–3637. [Google Scholar] [CrossRef]
- Singh, R.P.; Huerta-Espino, J.; William, H.M. Genetics and Breeding for Durable Resistance to Leaf and Stripe Rusts in Wheat. Turk. J. Agric. For. 2005, 29, 121–127. Available online: https://journals.tubitak.gov.tr/agriculture/issues/tar-05-29-2/tar-29-2-4-0402-2.pdf (accessed on 25 April 2021).
- Song, W.; Xie, C.J.; Du, J.K.; Xie, H.; Liu, Q.; Ni, Z.F.; Liu, Z.Y. A “one-marker-for-two-genes” approach for efficient molecular discrimination of Pm12 and Pm21 conferring resistance to powdery mildew in wheat. Mol. Breed. 2009, 23, 357–363. [Google Scholar] [CrossRef]
- Cheng, B.; Ding, Y.Q.; Gao, X.; Cao, N.; Xin, Z.H.; Zhang, L.Y. The diversity of powdery mildew resistance gene loci among wheat germplasm in Southwest China. Cereal Res. Commun. 2020, 48, 65–70. [Google Scholar] [CrossRef] [Green Version]
- Lu, N.; Lu, M.X.; Liu, P.; Xu, H.X.; Qiu, X.L.; Hu, S.S.; Wu, Y.A.; Bai, S.L.; Wu, J.Z.; Xue, S.L. Fine Mapping a Broad-Spectrum Powdery Mildew Resistance Gene in Chinese Landrace Datoumai, PmDTM, and Its Relationship with Pm24. Plant Dis. 2020, 104, 1709–1714. [Google Scholar] [CrossRef]
- Mergoum, M.; Frohberg, R.C.; Stack, R.W. Breeding hard red spring wheat for Fusarium head blight resistance. Wheat Prod. Stressed Environ. 2007, 12, 161–167. [Google Scholar] [CrossRef]
- Anderson, J.A.; Wiersma, J.J.; Linkert, G.L.; Kolmer, J.; Jin, Y.; Dill-Macky, R.; Wiersma, J.V.; Hareland, G.A. Registration of ‘Sabin’ wheat. J. Plant Regist. 2012, 6, 174–179. [Google Scholar] [CrossRef]
- Xu, F.; Wang, J.M.; Yang, G.Q.; Song, Y.L.; Liu, L.L.; Li, L.J.; Li, Y.H.; Han, Z.H.; Zhang, J.J. Evaluation of the comprehensive resistance to Fusarium head blight and detection of the resistance gene Fhb1 in main wheat cultivars in the Huanghuai winter wheat region. Plant Prot. 2020, 46, 84–92. [Google Scholar] [CrossRef]
- Zhu, Z.W.; Xu, D.A.; Cheng, S.H.; Gao, C.B.; Xia, X.C.; Hao, Y.F. Characterization of Fusarium Head Blight Resistance Gene Fhb1 and Its Putative Ancestor in Chinese Wheat Germplasm. Acta Agron. Sin. 2018, 4, 473–482. [Google Scholar] [CrossRef]
Selected Gene(s) | Primer Name | Primer Sequence (5′-3′) | Annealing Temp (°C) | Product Size (bp) | Reference |
---|---|---|---|---|---|
Yr5 | Yr5-M1 | FAM:GAAGGTGACCAAGTTCATGCTATATCACTGCTGCCTGTAGTGGA | [30] | ||
HEX:GAAGGTCGGAGTCAACGGATTATCACTGCTGCCTGTAGTGGG | |||||
Reverse:ACGAGTAGCTGTAATTAAACCAACAATGAA | |||||
Yr5-candidate | FAM:GAAGGTGACCAAGTTCATGCTCAGGAGATCTTGAAGGACAT | [30] | |||
HEX:GAAGGTCGGAGTCAACGGATTCAGGAGATCTTAAAGGAATA | |||||
Reverse:AAACTCTTTGACTGGTACTCG | |||||
Yr9 | H20 | F:GTTGGAAGGGAGCTCGAGCTG | 60 | +1598 | [31] |
R:GTTGGGCAGAAAGGTCGACATC | |||||
AF1/AF4 | F:GGAGACATCATGAAACATTTG | 60 | +1500 | [32] | |
R:CTGTTGTTGGGCAGAAAG | |||||
Yr10 | Yr10F/Yr10R | F:TCAAAGACATCAAGAGCCGC | 64 | 540 | [33] |
R:TGGCCTACATGAACTCTGGAT | |||||
Yr10F1/Yr10R1 | F:TTGGAATTGGCGACAAGCGT | 64 | 755 | [33] | |
R:GTGATGATTACCCACTTCCTC | |||||
Yr15 | uhw300 | F:CCGTGTCAGCCACCTACAAT | 58 | 936 | [34] |
R:GCACTCTACCACCGAACACA | |||||
Yr15-R8 | RAM:GAAGGTGACCAAGTTCATGCTCAGATCCCCGGTTTCTCTCAAG | [35] | |||
HEX:GAAGGTCGGAGTCAACGGATTCAGATCCCCGGTTCTCTCAAA | |||||
Reverse:CCCCCAAATGATCGAGAATA | |||||
Yr17 | VENTRIUP/LN2 | F:AGGGGCTACTGACCAAGGCT | 65 | 262 | [36] |
R:TGCAGCTACAGCAGTATGTACACAAAA | |||||
SC385 | F:CTGAATACAAACAGCAAACCAG | 54 | 400 | [36] | |
R:ACAGAAAGTGATCATTTCCATC | |||||
Yr18 | CSlV34 | 58 | [37] | ||
F:GTTGGTTAAGACTGGTGATGG | |||||
R:TGCTTGCTATTGCTGAATAGT | |||||
Cssfrs3 | TTGATGAAACCAGTTTTTTTTCTA | 58 | [38] | ||
GCCATTTAACATAATCATGATGGA | |||||
GTTGGTTAAGACTGGTGATGG | |||||
TGCTTGCTATTGCTGAATAGT | |||||
Yr26 | WE173 | F:GGGACAAGGGGAGTTGAAGC | 55 | 510 | [39] |
R:GAGAGTTCCAAGCAGAACAC | −750 | ||||
WRS435 | FAM:GAAGGTGACCAAGTTCATGCTGCACATATCCTACGCCTCTGT | [40] | |||
HEX:GAAGGTCGGAGTCAACGGATTGCACATATCCTACGCCTCTGG | |||||
Reverse:CCGCAATCATTTATTTGAGCCTCAG | |||||
Pm21 | ws-1 | F:TTGGTGTTTTGCTTCTGGA | 55 | 949 | [41,42] |
R:CTGATATTGCGGTGAATGTT | |||||
SCAR1400 | F:CACTCTCCTCAAACCTTGCAAG | 55 | 1400 | [43] | |
R:CACTCTCCTCCACTAACAGAGG | |||||
Fhb1 | His-InDel | F:ATGCGTGCGCTGTACTTG | 65 | 1309 | [44,45] |
R:CGTCACAGAGTCCAGTGAAA | −2061 | ||||
Fhb1-TaHRC-KASP | FAM:GAAGGTGACCAAGTTCATGCTTTGGGCTCACGTCGTGCAAATGGT | [46] | |||
HEX:GAAGGTCGGAGTCAACGGATTTGTCTGTTTCGCTGGGATG | |||||
Reverse:CTTCCAGTTTCTGCTGCCAT |
Gene | Primer | DNA (μL) | Taq/U (μL) | dNTP/mM (μL) | MgCl2/mM(μL) | 10× buffer (μL) | ddH2O (μL) | 2× ES Taq Master Mix (μL) | F/R-Primer (μL) |
---|---|---|---|---|---|---|---|---|---|
Yr9 | AF1/AF4 | 0.6 | 0.75 | 0.4 | 1 | 1 | 6.1 | 7.5 | 0.4 |
H20 | 1 | 0.75 | 0.2 | 2 | 1 | 4.9 | 7.5 | 0.8 | |
Yr10 | Yr10F/Yr10R | 1 | 0.75 | 0.2 | 2 | 1 | 4.5 | 7.5 | 1 |
Yr10F1/Yr10R1 | 1 | 0.75 | 0.2 | 2 | 1 | 4.5 | 7.5 | 1 | |
Yr15 | Uhw300 | 2.1 | 1 | 2.5 | 0.16 | 1 | 2.4 | 7.5 | 1.5 |
Yr17 | VENTRIU-LN2 | 1 | 1 | 0.2 | 1.5 | 1 | 6.1 | 7.5 | 0.2 |
SC-385 | 2.1 | 1 | 0.2 | 1.5 | 1 | 3.4 | 7.5 | 1 | |
Yr18 | Cslv34 | 2.1 | 1 | 2.5 | 0.16 | 1 | 2.4 | 7.5 | 1.5 |
Cssfrs3 | 3 | 1 | 2.5 | 0.16 | 1 | 5.5 | 10 | 0.5:0.25 | |
Yr26 | WE173 | 1 | 0.75 | 0.2 | 2 | 1 | 5.3 | 7.5 | 0.6 |
Pm21 | WS-1 | 2.1 | 1 | 0.5 | 1.2 | 1 | 2.4 | 7.5 | 1.5 |
SCAR1400 | 1 | 1 | 0.2 | 1 | 1 | 8 | 10 | 0.5 | |
Fhb1 | His-InDel | 1 | 1 | 0.2 | 2.5 | 1 | 7 | 10 | 1 |
Gene | Primer | Pre-Degeneration (94 °C, min) | Generation (94 °C, S) | Annealing (°C, S) | Extension (72 °C, S) | Number of Cycles | Final Extension |
---|---|---|---|---|---|---|---|
Yr9 | AF1/AF4 | 3 | 15 | 55,60 | 120 | 45 | 7 |
H20 | 5 | 60 | 60,60 | 120 | 45 | 10 | |
Yr10 | Yr10F/Yr10R | 4 | 30 | 64,30 | 60 | 35 | 10 |
Yr10F1/Yr10R1 | 4 | 30 | 64,30 | 60 | 35 | 10 | |
Yr15 | Uhw300 | 4 | 60 | 64,30 | 120 | 32 | 10 |
Yr17 | VENTRIUP-LN2 | 4 | 45 | 65,30 | 60 | 35 | 10 |
SC-385 | 3 | 45 | 54,30 | 60 | 30 | 10 | |
Yr18 | Cslv34 | 4 | 45 | 58,45 | 60 | 34 | 10 |
Cssfrs3 | 4 | 45 | 58,45 | 50 | 35 | 5 | |
Yr26 | WE173 | 4 | 45 | 55,45 | 60 | 34 | 10 |
Pm21 | WS-1 | 4 | 30 | 55,60 | 60 | 35 | 10 |
SCAR1400 | 5 | 50 | 55,50 | 120 | 36 | 10 | |
Fhb1 | His-InDel | 3 | 30 | 65,30 | 150 | 35 | 7 |
Step | Description | Temperature | Time | Number of Cycles Per Step |
---|---|---|---|---|
1 | Activation | 94 °C | 15 min | 1 cycle |
2 | Denaturation | 94 °C | 20 s | 10 cycles |
Annealing/Elongation | 55–61 °C | 60 s (drop 0.6 °C per cycle) | ||
3 | Denaturation | 94 °C | 20 s | 26 cycles |
Annealing/Elongation | 55 °C | 60 s |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, K.; Li, X.; Li, Y.; Wang, Z.; Zhao, B.; Wang, B.; Li, Q. Disease Resistance and Genes in 146 Wheat Cultivars (Lines) from the Huang-Huai-Hai Region of China. Agronomy 2021, 11, 1025. https://doi.org/10.3390/agronomy11061025
Ma K, Li X, Li Y, Wang Z, Zhao B, Wang B, Li Q. Disease Resistance and Genes in 146 Wheat Cultivars (Lines) from the Huang-Huai-Hai Region of China. Agronomy. 2021; 11(6):1025. https://doi.org/10.3390/agronomy11061025
Chicago/Turabian StyleMa, Kangjie, Xiaoyan Li, Ying Li, Zihao Wang, Bingjie Zhao, Baotong Wang, and Qiang Li. 2021. "Disease Resistance and Genes in 146 Wheat Cultivars (Lines) from the Huang-Huai-Hai Region of China" Agronomy 11, no. 6: 1025. https://doi.org/10.3390/agronomy11061025