Next Article in Journal
Minor Treatments Can Play a Significant Role in Preserving Natural Habitats and Protected Species on the Shore of a Central European Lake
Previous Article in Journal
Effects of Nitrogen Application Rate on Rhizosphere Microbial Diversity in Oilseed Rape (Brassica napus L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 11
Issue 8
10.3390/agronomy11081541
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association between Soil Acidity and Bacterial Wilt Occurrence in Potato Production in Ethiopia

by
Shiferaw Tafesse
1,2,3,*,
Ciska Braam
4,
Barbara van Mierlo
2,
Berga Lemaga
3 and
Paul C. Struik
1
1
Centre for Crop Systems Analysis, Wageningen University and Research Centre, P.O. Box 430, 6700 AK Wageningen, The Netherlands
2
Knowledge, Technology and Innovation Group, Wageningen University and Research Centre, P.O. Box 8130, 6700 EW Wageningen, The Netherlands
3
International Potato Center (CIP), CGIAR Research Program on Roots, Tubers and Bananas (RTB), P.O. Box ILRI c\o CIP 5689, Addis Ababa, Ethiopia
4
Laboratory of Phytopathology, Wageningen University and Research Centre, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(8), 1541; https://doi.org/10.3390/agronomy11081541
Submission received: 18 June 2021 / Revised: 10 July 2021 / Accepted: 14 July 2021 / Published: 31 July 2021
Browse Figures
Versions Notes

Abstract

:
Soil acidity is one of the main constraints to crop production worldwide. In Ethiopia, the problem of soil acidity has been increasing. Currently, more than 40% of cultivated land in the country has a soil pH < 5.5. Recently, bacterial wilt (caused by Ralstonia solanacearum) has become a serious problem, reaching epidemic levels in some of the major potato growing districts in the country. However, it is currently unknown if the current outbreak of bacterial wilt in potato production is associated with soil acidification or not. To examine the association between bacterial wilt and soil acidification, we conducted a field survey and field experiments and detected and characterised R. solanacearum strains. The study showed that 50% of potato fields were very strongly acidic (pH 4.5–5.0) and bacterial wilt incidence was higher in potato fields with low soil pH. The field experiments indicated that lime application significantly increased soil pH (p < 0.001) and reduced bacterial wilt incidence (p < 0.001). The more lime was applied, the stronger the positive effect on soil pH and the stronger the reduction in bacterial wilt incidence. Bacterial wilt incidence was on average 10.8% under 12 t/ha lime application, while it was about 40% in control plots (without lime) after 90 days. All R. solanacearum strains isolated from the symptomatic potato plants were Phylotype II. Our findings show that the current outbreak of bacterial wilt in Ethiopia is associated with soil acidification. They add to the understanding of the risk factors for bacterial wilt in potato. Aside from farm hygiene, sanitation and cultural practices, addressing soil acidification using lime needs to be considered as an additional component of an integrated package to deal with bacterial wilt in potato under acidic soil conditions.

1. Introduction

Potato is an important food and nutrition security crop for Ethiopians, and it is grown by close to four million smallholder farmers [1]. Bacterial wilt, caused by a soil-borne pathogen (Ralstonia solanacearum), has recently become a serious constraint to potato production in Ethiopia, jeopardising food security efforts [2,3]. The disease has spread widely in the last few years. Previous studies showed that the occurrence of bacterial wilt seemed more prominent in some potato growing districts than in other areas [3,4,5]. Causes of variation in disease incidence among the districts remain unclear. However, cool highlands that have historically been known to be free from bacterial wilt are now being affected by the disease [2,6,7].
Studies have shown that free movement of latently infected seed potato contributed to the spreading of the disease in Ethiopia [6]. Limited knowledge among farmers and the lack of a coordinated action among the various actors in the country’s potato production system constrained effective management of the disease [8,9]. Furthermore, poor quality of seed produced and marketed by seed potato cooperatives has contributed to the spreading of the disease [10]. The interdependency among seed and ware potato farmers (e.g., sharing of farm tools and labour sharing) coupled with the infectiveness of the existing seed potato quality assurance system in Ethiopia has also made it difficult to manage the outbreak of the disease [10,11]. Apart from this knowledge about the primary social conditions facilitating the spreading of the disease, there is very little knowledge on biophysical factors that could explain the outbreak of the disease in the country.
Many studies have shown that about 40% of the arable land in Ethiopia is currently covered by acidic soils (pH < 5.5), and the problem of soil acidity has been increasing in the country [12,13]. The problem of soil acidity is aggravated in Ethiopia mainly because of the complete removal of crop residues from crop fields, overgrazing and high rainfall that washes basic cations and organic matter away through soil erosion and leaching [14,15,16]. Long-term application of acid-forming inorganic fertilisers like urea and diammonium phosphate (DAP) have also considerably contributed to soil acidification in the country [12,15,17,18]. According to several studies, the problem of soil acidity is rampant in high rainfall areas of the western, northwestern, southwestern and southern parts of Ethiopia [12,13,19,20]. In contrast, the northern and eastern parts of the country have alkaline soils [13,21].
Soil pH affects various chemical and biological processes in the soil. Solubility and availability of plant nutrients such as calcium, magnesium, phosphorous, potassium and trace metals depend on soil pH [22]. Many studies have shown that the activities of different soil microorganisms are strongly influenced by soil pH [23,24,25]. In particular, Bååth and Arnebrant [26] and Hartman et al. [27] reported the effect of soil pH on the abundance and diversity of bacteria. There are plant-growth-promoting (beneficial) and -pathogenic (harmful) bacteria in the soil. Beneficial bacteria (e.g., Pseudomonas fluorescens, Bacillus pumilis, Bacillus cereus) supply nutrients to plants, enhance plant growth and protect plants from various pathogens [28,29,30,31]. Plant-pathogenic bacteria (e.g., Xanthomonas oryzae, Ralstonia solanacearum) have harmful effects on plants and cause significant economic losses [30,32,33].
The knowledge about the relationship between Ralstonia solanacearum and soil acidity is limited. Recent research has shown that Ralstonia solanacearum, which causes bacterial wilt in tobacco, has been found to be more serious under acidic soil conditions [34]. Furthermore, the same research showed that acidic conditions are conducive to the expression of virulence genes of the pathogen while the expression of a resistance gene is restrained in tobacco [34]. Growth and antagonistic activity of the antagonistic bacteria Bacillus cereus and Pseudomonas fluorescens were also suppressed at pH < 5.5 [30,34,35].
In this paper, we describe our efforts to study the relationship between soil acidity and incidence of bacterial wilt in potato production in Ethiopia. Our study was designed with the main objective of understanding the extent of soil acidification in major potato growing districts in Ethiopia and to elucidate whether there is an association between the occurrence of bacterial wilt and soil acidification. We also tested through field experiments liming as a management method to decrease soil acidity and thus suppress the pathogen in the context of smallholder potato growers in Ethiopia. Moreover, since knowledge of the genetic diversity of the pathogen is important to control the disease, the study also aimed to detect and characterise Ralstonia solanacearum strains in seed and ware potatoes. The specific objectives of this study were:
  • To determine the extent to which soil acidification is a problem in major potato growing districts in Ethiopia.
  • To assess the extent of bacterial wilt incidence in potato fields and its relationship with soil acidity.
  • To examine the effect of different levels of lime application on soil acidity and the incidence of bacterial wilt.
  • To detect and characterise Ralstonia solanacearum strains in potato fields.

2. Materials and Methods

2.1. Soil Sampling and Bacterial Wilt Incidence Survey in Potato Fields

Soil samples were collected (0–20 cm) from 147 randomly selected potato fields to determine the status of soil acidity in seven potato growing districts (Wolmera, Meta Robi, Ada’a Barga, Dendi, Jeldu, Ambo and Wonchi) in the central highlands of the country. Soil pH analysis was done in a suspension of 1:2.5 soil:water at Ambo University Chemistry Laboratory. An assessment of bacterial wilt incidence was also carried out. Three quadrants (about 5 m × 5 m each) were selected from each field, with disease incidence assessed as the percentage of wilted plants of the total number of plants in the three quadrants.

2.2. Field Experiments

2.2.1. Site Description and Experimental Design

To examine the effect of soil amelioration using lime on bacterial wilt incidence, field experiments were conducted at three sites in Wolmera district in the Oromia regional state of Ethiopia during the main potato growing season (June to October) of 2018. Over the past two decades, this district has served as a hub for seed potato production. The sites were Bakaka, Gaba Robi and Wolmera Choke. The soil type at each site is a well-drained nitisol. Initial soil pH was determined. Details of the experimental sites are presented in Table 1.
At each of the three sites, an experiment was conducted in a randomised complete block design with five treatments, replicated three times. The five treatments included a control (no lime), lime at 3 t/ha, lime at 6 t/ha, lime at 9 t/ha and lime at 12 t/ha. Lime was obtained from Guder Lime Factory, Oromia, Ethiopia. Individual plot size was 3 m × 3 m. The different quantities of lime were mixed with the soil one day before potato plants were planted. The number of plants per plot was 40 (i.e., a plant density of 44,444 plants per ha). Before the plots were treated, soil samples were collected from each site and initial pH and soil texture were assessed. Changes in soil pH were monitored by collecting and analysing soil samples from each plot on 30, 60, 90 and 120 days after treatment.

2.2.2. Inoculation

To examine the effect of lime on bacterial wilt incidence under different soil pH conditions, permission was obtained from Wolmera District Office of Agriculture to inoculate the plots with Ralstonia solanacearum. Each plant in each plot was inoculated with 10 mL of a bacterial suspension (108 CFU/mL) of the local Ralstonia solanacearum strain (WA36; Phylotype II). The bacteria were cultivated on modified semi-selective media (M-SMSA) [36]. An isolated colony was transferred to a 250 mL Erlenmeyer flask and incubated in a rotary shaker. Dilution of bacterial suspension was performed using distilled water and the suspension was adjusted to 108 CFU/mL. Dilution was checked by measuring optical density (OD600 nm) with a spectrophotometer. The inoculation was carried out by drenching at the base of each potato plant after 30 days of planting (Figure 1). Disease development was monitored weekly and the final bacterial wilt incidence (percentage of wilted plants over total number of plants per plot) was calculated 90 days after inoculation.

2.3. Detection and Characterisation of Ralstonia solanacearum

2.3.1. Potato Tuber Sampling

Potato tuber samples were collected from symptomatic plants from nine major potato growing districts (the seven districts mentioned above and two additional ones). Three tubers were taken from a selected potato plant with wilting symptoms. A total of 135 samples were collected, including from most of the potato fields from where soil samples were collected, in collaboration with an expert from Holeta Agricultural Biotechnology Research Centre and agricultural extension workers from the districts.

2.3.2. Isolation of Ralstonia solanacearum Strains and DNA Extraction

Isolation of Ralstonia solanacearum strains was performed at the National Agricultural Biotechnology Research Centre, Holeta, Ethiopia. Each potato tuber sample was washed with tap water and the surface was disinfected using 70% ethanol. Strips along the vascular ring were then removed from each potato tuber, added into an extraction buffer and placed on a shaker for 15–20 min to allow the release of bacteria. Streaking of bacterial suspensions was done on modified semi-selective media (M-SMSA) [37] and purification of R. solanacearum colonies was done on tetrazolium chloride (TZC) agar medium [38]. DNA was extracted from presumptive Ralstonia solanacearum pure cultures using the DNeasy Blood and Tissue kit (supplied by QIAGEN).

2.3.3. Detection and Identification of Ralstonia solanacearum

To identify the bacterial isolates, a Ralstonia solanacearum species-specific universal primer pair (759/760) was used for polymerase chain reaction (PCR) amplification [39] at the Laboratory of Phytopathology, Wageningen University and Research, Wageningen, the Netherlands. PCR cycling conditions were run with initial denaturation at 95 °C for 15 min, followed by 30 cycles of 94 °C for 30 s, 59 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 10 min. PCR products were checked through electrophoresis using agarose gel.

2.3.4. Phylotype Identification

Phylotype identification was done following a protocol described by [40]. Multiplex PCR amplification was done using Ralstonia solanacearum species complex (RSSC)-specific universal primer and phylotype-specific primers (Table 2). PCR cycling conditions were initial denaturation during 9 min at 96 °C; 30 cycles of 1 min at 95 °C, 1 min at 70 °C, 2 min at 72 °C, and final extension of 10 min at 72 °C. Examination of PCR products was conducted by electrophoresis using 1% agarose gel stained with ethidium bromide. A known Phylotype I strain (PD 7123), Ralstonia pseudosolanacearum, was used as a positive control. This representative strain was obtained from the National Plant Protection Organisation (NPPO) of the Netherlands.

2.4. Data Analysis

A correlation analysis was conducted to evaluate the relationship between pH and incidence of bacteria wilt in potato fields (%). A scatter plot graph was constructed using the ggplot2 R package.
In order to assess how lime affected the soil pH, a linear regression analysis was performed using the R statistical package (version 3.6.1) [41]. Similarly, to determine the effect of lime application on bacterial wilt incidence, a linear regression analysis was done. Furthermore, multiple comparisons of the means were performed using the least significant difference method (LSD) after analysis of variance (ANOVA). Graphs were drawn using the ggplot2 package of R.

3. Results

3.1. Soil Acidity Status in Potato Fields

We assessed the proportions of the 147 potato fields that fell in different soil pH ranges. The pH values in the sampled potato fields ranged from 4.40 to 5.94. The highest proportion (50%) of the potato fields was very strongly acidic (pH 4.5–5.0), followed by strongly acidic (pH 5.1–5.5; 30%), as indicated in Figure 2. Only 11% of the fields were moderately acidic (pH 5.6–6.0), while 9% were extremely acidic (3.5–4.4) and none were neutral or alkaline. These findings show the wide prevalence of soil acidity in these potato fields.

3.2. Correlation between Soil Acidity and Bacterial Wilt Incidence

The incidence of bacterial wilt in 147 seed and ware potato fields in the central highlands of the country ranged from 0.0 to 19.7%. As indicated in Figure 3, we found a negative correlation between soil pH and bacterial wilt incidence (R = −0.27, p = 9 × 10−4).

3.3. Effect of Lime on Soil pH Value

The application of lime significantly affected soil pH in the field experiment: the more lime was applied, the higher the pH value of the soil became (Figure 4). The regression analysis showed that the factors of time and location were not significant in accounting for variation in pH (data not shown).

3.4. Effect of Lime on Bacterial Wilt Incidence

Bacterial wilt incidence was explained significantly by lime application rate in the field experiment. A separate linear regression analysis considering bacterial wilt incidence as a dependent variable and lime rate as an independent variable is depicted in Figure 5. The bacterial wilt incidence was reduced by an increase in lime application rate. This effect was stronger when the assessment was done later, because the increase in bacterial wilt incidence over time was stronger at lower rates of lime application (data not shown). Location was not significant in explaining the variation in the incidence of bacterial wilt. Bacterial wilt incidence on average was 10.8% under 12 t/ha lime application, while it was about 40% in control plots (without lime) after 90 days of inoculation. Furthermore, analysis of variance followed by mean separation indicated there was no statistically significant variation between the lime application rates of 12 t/ha and 9 t/ha. However, there was significant variation between the lime application rates of 6 t/ha and 3 t/ha (Table 3).

3.5. Phylotype Identification of Ralstonia solanacearum Isolates

Bacterial isolates from samples collected from the various potato fields were confirmed to be Ralstonia solanacearum by PCR amplification using the Ralstonia species complex (RSSC) universal primer pair (759/760). PCR amplification yielded a single 280-bp fragment. All Ralstonia solanacearum isolates that gave a positive PCR reaction using the universal primer pair were identified as Phylotype II using multiplex PCR based on the amplicon size (Figure 6).

4. Discussion

4.1. Extent of Soil Acidity in Major Potato Growing Areas

The results of this study show that the extent of soil acidity in potato fields in the central highlands of Ethiopia is worrisome (Figure 2). All investigated potato fields had low soil pH values. The findings observed in this study mirror those of previous assessments that have indicated the pervasiveness of soil acidity in arable lands in Ethiopia [13,21,42]. The high soil acidity could be due to improper use of acid-forming fertilisers and soil erosion or leaching that washes away the basic cations calcium, magnesium, sodium and potassium [14,15,22]. When basic cations are leached or washed away by soil erosion, acidic cations (hydrogen and aluminium) replace them, causing soil acidity [22,43].

4.2. Association between Soil Acidity and Bacterial Wilt Incidence

This study showed a weak negative association (R = −0.27) between bacterial wilt incidence and the soil pH (Figure 3). Highly acidic potato fields had a higher incidence of bacterial wilt in most samples. The occurrence of bacterial wilt depends on various conditions, such as whether the seed is infected or not. It can also depend on whether the pathogen has previously infested the crop field or not. In addition to these and other risk factors, potato fields with lower pH values seemed to have a higher incidence of the disease (higher number of wilted plants per field) than those with relatively higher soil pH values. A previous study conducted to investigate the epidemiology of the disease in the Ethiopian potato production system showed that the incidence of the disease reached an epidemic level in some districts such as Chencha [6]. This study indicated that bacterial wilt incidence reached more than 96% in some potato fields in this district. Another recent study indicated that this district receives high rainfall [44], which could be one of the leading causes of soil acidification via the leaching of basic cations. Furthermore, a recent soil acidity map (Figure 7) developed by the Ethiopian Agricultural Transformation Agency shows that the soil acidity problem is rampant in arable lands of the Chencha district [13].
Likewise, in the Amhara region, one of the major potato growing areas that has been severely affected by bacterial wilt, soil acidity is also a serious problem. For instance, the soil pH map indicated in Figure 7 for Guagusa Shikudad, one of the potato growing districts in the region, shows that most of the district is strongly acidic [13]. Furthermore, a previous study reported a severe incidence of bacterial wilt in this district [4].
A key reason why bacterial wilt incidence is more severe in some potato fields than in other ones might thus be the soil acidity status of the potato fields. Moreover, across different parts of the country, the current serious incidence of the disease seems to be intensified by the wide spread of soil acidification in high rainfall areas in the country. Overall, it looks like the bacterial wilt problem in the country is most severe in areas affected most by soil acidity and which receive high rainfall.

4.3. Liming Reduces Bacterial Wilt Incidence

The field experiments showed that application of lime at different rates significantly increased soil pH (Figure 4). The highest change in soil pH was observed under 12 t/ha of lime (Figure 4). Our results confirm other studies showing that liming is an effective and common practice to ameliorate soil acidity [22,45,46]. Lime has immediate and residual effects on soil acidity. Due to the low solubility of lime in water, its residual effects can last for years [42,46,47,48]. Thus, unlike fertilisers, lime should not be applied every year, since its benefits persist for more than five years [47,49].
The findings of this study show that liming reduced bacterial wilt incidence under all rates of lime application (Figure 5; Table 3). Bacterial wilt incidence was only 10% under 12 t/ha, compared to about 40% under the unlimed plot (Table 3). Since Ralstonia solanacearum is (also) a soil-borne pathogen, soil chemical and biological properties affect its growth and development. This result is in line with the findings of recent studies. Li et al. [34] reported that Ralstonia solanacearum can survive well under acidic soil conditions. Furthermore, this study has shown that the growth of the antagonistic bacteria Pseudomonas fluorescens and Bacillus cereus are suppressed under acidic soil conditions. Likewise, Shen et al. [35] and Wu et al. [50] reported suppression of bacterial wilt incidence and reduction in abundances of Ralstonia solanacearum through lime application in field conditions. The finding of this study also align with other many studies that have shown that soil pH is one of the key factors determining the composition of the soil microbial community [24,30,51].
Potato is an acid-tolerant crop and grows well under acidic soil conditions (pH 4.5–6.0). Hence, farmers in the highly acidic highlands of Ethiopia can expand potato production as it is a good alternative to cereals, which are sensitive to acidic soil conditions. However, if bacterial wilt is not controlled well, acidic conditions can intensify disease incidence, resulting in considerable yield loss. Therefore, dealing with soil acidity could help to reduce the impact of the disease in areas affected by soil acidification and sustain potato production, as revealed by this study.

4.4. Detection and Characterisation of Ralstonia solanacearum Strains

The results of this study revealed low genetic diversity among the R. solanacearum strains affecting potato in Ethiopia, although further phylogenetic analysis is needed using more samples through partial endoglucanase (egl) sequences, based on the protocol developed by Fegan and Prior [40]. All strains belonged to Phylotype II (Figure 6). This finding confirms previous studies that reported Ralstonia solanacearum strains isolated from potato as Phylotype II [5,6]. Furthermore, many studies conducted in East African countries have reported Ralstonia solanacearum isolated from potato mainly as Phylotype II [52,53]. However, according to the previous classification of the R. solanacearum species complex, Phylotype II is composed of strains mainly from America [39]. Phylotype II strains are maintained to be R. solanacearum by a recent work that revised the taxonomy of the R. solanacearum species complex [54]. Studies show that Phylotype II strains are cold-tolerant [55,56]. The wide occurrence of this phylotype in the warm climate of Ethiopia and in other East African countries shows the adaptability of the pathogen to various environmental conditions and its ability to cause damage worldwide. Moreover, these findings show that similar strains of Ralstonia solanacearum spread in the country and in the East African region, threatening the potato industry.
These findings of this study confirm the wide spread of this disease across different potato growing districts in Ethiopia. Abdurahman et al. [6] suggested that this spread was caused by the uncontrolled movement of latently infected seed tubers. Large nongovernmental organisations and government offices of agriculture usually purchase and distribute seed potato without knowing whether the seed is infected or not, because they do not have reliable means to check seed health. This necessitates strengthening of the capacity of seed potato cooperatives to become effectively involved in quality declared seed production through a robust monitoring system. Improving farmers’ knowledge and practices through experiential and social learning approaches should be prioritised to foster collective action involving both seed and ware potato growers [57]. Developing quarantine systems could also support efforts to control the disease in the country’s smallholder potato production. In particular, strengthening regional-level seed quality control laboratories is needed to be able to detect latent infection of Ralstonia solanacearum using a standard protocol for the pathogen [58] and to limit further spread of the disease through the distribution of infected seed potatoes.

5. Conclusions

The Phylotype II of the pathogen Ralstonia solanacearum has spread widely throughout Ethiopia, probably because it can adopt to diverse environmental conditions. The findings of this study show the association between the occurrence of bacterial wilt across major potato growing areas in Ethiopia and soil acidification. Improvement of soil acidity using lime may significantly reduce the incidence of the disease. While soil acidity by itself is a serious constraint to potato production due to its effect on the availability of plant nutrients even though potato is relatively acid-tolerant, it also affects the productivity by enhancing the incidence of bacterial wilt. Hence, ameliorating soil acidity urgently requires attention from various actors in the country’s potato production system because dealing with soil acidity is a prerequisite for the effective management of bacterial wilt. Integrating the application of lime as part of the existing extension services to manage bacterial wilt could be a promising strategy and benefit potato farmers. Future studies need to explore further how lime application affects the population of Ralstonia solanacearum and the diversity of soil microbial population in acidic soils over periods of years.

Author Contributions

S.T. and P.C.S. initiated and designed the study. Data collection was conducted by S.T. Laboratory analysis was carried out by S.T. and C.B. Data analysis was done by S.T. and P.C.S. with input by B.v.M. Manuscript was prepared by S.T. with input and editing by P.C.S., B.v.M. and B.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Interdisciplinary Research and Education Fund (INREF) of Wageningen University, and the CGIAR Research Program on Roots, Tubers and Bananas (RTB) and supported by CGIAR Trust Fund contributors.

Data Availability Statement

Data may be made available after request.

Acknowledgments

The authors would like to thank Laurens Deurhof, Adeba Tilahun, Doni Hinsene, and Gert Kema for the technical support during laboratory work.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. CSA. Agricultural Sample Survey Report on Area, Production and Farm Management Practice of Belg Season Crops Private Peasant Holdings; Statistical Bulletin: Addis Ababa, Ethiopia, 2016; Volume 1. [Google Scholar]
  2. CIP. 12th Six-Month Program Report; Better Potato for Better Life Project; CIP: Addis Ababa, Ethiopia, 2016. [Google Scholar]
  3. Gorfu, D.; Woldegiorgis, G.; Kassa, B. Bacterial Wilt: An Emerging Threat to Ethiopian Potato Industry. Seed potato tuber production and dissemination: Experiences, challenges and prospects. In Proceedings of the National Workshop on Seed Potato Tuber Production and Dissemination, Bahir Dar, Ethiopia, 12–14 March 2012. [Google Scholar]
  4. Bekele, B.; Abate, E.; Asefa, A.; Dickinson, M. Incidence of potato viruses and bacterial wilt disease in the west Amhara sub-region of Ethiopia. J. Plant Pathol. 2011, 93, 149–157. [Google Scholar]
  5. Lemessa, F.; Zeller, W. Isolation and characterisation of Ralstonia solanacearum strains from Solanaceae crops in Ethiopia. J. Basic Microbiol. 2007, 47, 40–49. [Google Scholar] [CrossRef]
  6. Abdurahman, A.; Griffin, D.; Elphinstone, J.; Struik, P.C.; Schulz, S.; Schulte-Geldermann, E.; Sharma, K. Molecular characterization of Ralstonia solanacearum strains from Ethiopia and tracing potential source of bacterial wilt disease outbreak in seed potatoes. Plant Pathol. 2017, 66, 826–834. [Google Scholar] [CrossRef] [Green Version]
  7. Kassa, B. Potato Bacterial Wilt Management in the Central Highlands of Ethiopia. Eth. J. Agric. Sci. 2016, 26, 83–97. [Google Scholar]
  8. Damtew, E.; Tafesse, S.; Lie, R.; Van Mierlo, B.; Lemaga, B.; Sharma, K.; Struik, P.C.; Leeuwis, C. Diagnosis of management of bacterial wilt and late blight in potato in Ethiopia: A systems thinking perspective. NJAS-Wagen. J. Life Sci. 2018, 86, 12–24. [Google Scholar] [CrossRef]
  9. Tafesse, S.; Damtew, E.; Van Mierlo, B.; Lie, R.; Lemaga, B.; Sharma, K.; Leeuwis, C.; Struik, P.C. Farmers’ knowledge and practices of potato disease management in Ethiopia. NJAS-Wagen. J. Life Sci. 2018, 86, 25–38. [Google Scholar] [CrossRef]
  10. Tafesse, S.; Lie, R.; van Mierlo, B.; Struik, P.C.; Lemaga, B.; Leeuwis, C. Analysis of a monitoring system for bacterial wilt management by seed potato cooperatives in Ethiopia: Challenges and Future Directions. Sustainability 2020, 12, 3580. [Google Scholar] [CrossRef]
  11. Schulz, S.; Woldegiorgis, G.; Hailemariam, G.; Aliyi, A.; Haar, J. Sustainable Seed Potato Production in Ethiopia: From Farm-Saved to Quality Declared Seed. Seed potato tuber production and dissemination: Experiences, challenges and prospects. In Proceedings of the National Workshop on Seed Potato Tuber Production and Dissemination, Bahir Dar, Ethiopia, 12–14 March 2012. [Google Scholar]
  12. Agegnehu, G.; Amede, T. Integrated soil fertility and plant nutrient management in tropical agro-ecosystems: A review. Pedosphere 2017, 27, 662–680. [Google Scholar] [CrossRef]
  13. ATA. Soil Fertility Mapping and Fertilizer Blending; Agricultural Transformation Agency (ATA): Addis Ababa, Ethiopia, 2014. [Google Scholar]
  14. Abebe, M. Nature and Management of Acid Soils in Ethiopia; Haramaya University: Dire Dawa, Ethiopia, 2007. [Google Scholar]
  15. Abate, E.; Hussein, S.; Laing, M.; Mengistu, F. Soil acidity under multiple land-uses: Assessment of perceived causes and indicators, and nutrient dynamics in small-holders’ mixed-farming system of northwest Ethiopia. Acta Agric. Scand. Sect. B Soil Plant Sci. 2017, 67, 134–147. [Google Scholar] [CrossRef]
  16. Elias, E. Characteristics of Nitisol profiles as affected by land use type and slope class in some Ethiopian highlands. Environ. Syst. Res. 2017, 6, 20. [Google Scholar] [CrossRef] [Green Version]
  17. Barak, P.; Jobe, B.O.; Krueger, A.R.; Peterson, L.A.; Laird, D.A. Effects of long-term soil acidification due to nitrogen fertilizer inputs in Wisconsin. Plant Soil 1997, 197, 61–69. [Google Scholar] [CrossRef]
  18. Guo, J.H.; Liu, X.J.; Zhang, Y.; Shen, J.L.; Han, W.X.; Zhang, W.F.; Christie, P.; Goulding, K.W.T.; Vitousek, P.M.; Zhang, F.S. Significant acidification in major Chinese croplands. Science 2010, 327, 1008–1010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Warner, J.; Yirga, C.; Gameda, S.; Rashid, S.; Alemu, D. Soil Acidity Problems in Ethiopia: Magnitude, Current Awareness and Practices, and Policy Actions. In Proceedings of the Research for Ethiopia’s Agricultural Policy Presented for EIAR 50th Anniversary, Addis Ababa, Ethiopia, 1 July 2016. [Google Scholar]
  20. Kebede, F.; Yamoah, C. Soil fertility status and numass fertilizer recommendation of typic hapluusterts in the northern highlands of Ethiopia. World Appl. Sci. J. 2009, 6, 1473–1480. [Google Scholar]
  21. Agegnehu, G.; Yirga, C.; Erkossa, T. Soil Acidity Management; Ethiopian Institute of Agricultural Research (EIAR): Addis Ababa, Ethiopia, 2019. [Google Scholar]
  22. Weil, R.; Brady, N. The Nature and Properties of Soils (Global Edition); Pearson: London, UK, 2016. [Google Scholar]
  23. Garbeva, P.V.; Van Veen, J.A.; Van Elsas, J.D. Microbial diversity in soil: Selection of microbial populations by plant and soil type and implications for disease suppressiveness. Annu. Rev. Phytopathol. 2004, 42, 243–270. [Google Scholar] [CrossRef] [PubMed]
  24. Rousk, J.; Brookes, P.C.; Bååth, E. The microbial PLFA composition as affected by pH in an arable soil. Soil Biol. Biochem. 2010, 42, 516–520. [Google Scholar] [CrossRef]
  25. Zhou, Z.; Wang, C.; Luo, Y. Meta-analysis of the impacts of global change factors on soil microbial diversity and functionality. Nat. Commun. 2020, 11, 1–10. [Google Scholar]
  26. Bååth, E.; Arnebrant, K. Growth rate and response of bacterial communities to pH in limed and ash treated forest soils. Soil Biol. Biochem. 1994, 26, 995–1001. [Google Scholar] [CrossRef]
  27. Hartman, W.H.; Richardson, C.J.; Vilgalys, R.; Bruland, G.L. Environmental and anthropogenic controls over bacterial communities in wetland soils. Proc. Natl. Acad. Sci. USA 2008, 105, 17842–17847. [Google Scholar] [CrossRef] [Green Version]
  28. Bai, B.; Yang, X.; Zhao, Q.; Liu, R.; Ren, J. Inoculations with Pseudomonas fluorescens and Bacillus cereus affect the soil enzyme activity, growth and rhizosphere microbial diversity of Taxus chinensis var. mairei. Plant Soil 2020, 455, 41–52. [Google Scholar] [CrossRef]
  29. Lodewyckx, C.; Vangronsveld, J.; Porteous, F.; Moore, E.R.; Taghavi, S.; Mezgeay, M.; Daniel, V.D.L. Endophytic bacteria and their potential applications. Crit. Rev. Plant Sci. 2002, 21, 583–606. [Google Scholar] [CrossRef]
  30. Wang, R.; Zhang, H.; Sun, L.; Qi, G.; Chen, S.; Zhao, X. Microbial community composition is related to soil biological and chemical properties and bacterial wilt outbreak. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Strobel, G.; Daisy, B. Bioprospecting for microbial endophytes and their natural products. Microbiol. Mol. Biol. Rev. 2003, 67, 491–502. [Google Scholar] [CrossRef] [Green Version]
  32. Elphinstone, J. The current bacterial wilt situation: A global overview. In Bacterial Wilt: The Disease and the Ralstonia solanacearum Species Complex; Allen, C., Prior, P., Hayward, A.C., Eds.; American Phytopathological Society: Saint Paul, MN, USA, 2005; pp. 9–28. [Google Scholar]
  33. Hayward, A. Biology and epidemiology of bacterial wilt caused by Pseudomonas solanacearum. Annu. Rev. Phytopathol. 1991, 29, 65–87. [Google Scholar] [CrossRef] [PubMed]
  34. Li, S.; Liu, Y.; Wang, J.; Yang, L.; Zhang, S.; Xu, C.; Ding, W. Soil acidification aggravates the occurrence of bacterial wilt in South China. Front. Microbiol. 2017, 8, 703. [Google Scholar] [CrossRef] [Green Version]
  35. Shen, G.; Zhang, S.; Liu, X.; Jiang, Q.; Ding, W. Soil acidification amendments change the rhizosphere bacterial community of tobacco in a bacterial wilt affected field. Appl. Microbiol. Biotechnol. 2018, 102, 9781–9791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Elphinstone, J.; Stanford, H.; Stead, D. Detection of Ralstonia Solanacearum in Potato Tubers, Solanum Dulcamara and Associated Irrigation Water. In Bacterial Wilt Disease; Springer: Berlin/Heidelberg, Germany, 1998; pp. 133–139. [Google Scholar]
  37. Elphinstone, J.; Hennessy, J.; Wilson, J.; Stead, D. Sensitivity of different methods for the detection of Ralstonia solanacearum in potato tuber extracts. EPPO Bull. 1996, 26, 663–678. [Google Scholar] [CrossRef]
  38. Kelman, A. The relationship of pathogenicity of Pseudomonas solanacearum to colony appearance in a tetrazolium medium. Phytopathology 1953, 44, 693–695. [Google Scholar]
  39. Opina, N.; Tavner, F.; Hollway, G.; Wang, J.; Li, T.; Maghirang, R.; Fegan, M.; Hayward, A.; Krishnapillai, V.; Hong, W.; et al. A novel method for development of species and strain-specific DNA proves and PCR primers for identifying Burkholderia Solanacearum (formerly Pseudomonas Solanacearum). Asia. Pac. J. Mol. Biol. Biotechnol. 1997, 5, 19–30. [Google Scholar]
  40. Fegan, M.; Prior, P. How complex is the Ralstonia solanacearum species complex? In Bacterial Wilt Disease and the Ralstonia Solanacearum Species Complex; Allen, C., Prior, P., Hayward, A.C., Eds.; APS Press: Saint Paul, MN, USA, 2005; Volume 1, pp. 449–461. [Google Scholar]
  41. R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2013; Available online: http://www.R-project.org (accessed on 20 April 2020).
  42. Gurmessa, B. Soil acidity challenges and the significance of liming and organic amendments in tropical agricultural lands with reference to Ethiopia. Environ. Dev. Sustain. 2020, 23, 77–99. [Google Scholar] [CrossRef]
  43. Fageria, N.K.; Nascente, A.S. Management of soil acidity of South American soils for sustainable crop production. Adv. Agron. 2014, 128, 221–275. [Google Scholar]
  44. Minda, T.T.; van der Molen, M.K.; Struik, P.C.; Combe, M.; Jiménez, P.A.; Khan, M.S.; Jordi, V.D.A. The combined effect of elevation and meteorology on potato crop dynamics: A 10-year study in the Gamo Highlands, Ethiopia. Agric. For. Meteorol. 2018, 262, 166–177. [Google Scholar] [CrossRef]
  45. Opala, P.A.; Odendo, M.; Muyekho, F.N. Effects of lime and fertilizer on soil properties and maize yields in acid soils of Western Kenya. Afr. J. Agric. Res. 2018, 13, 657–663. [Google Scholar]
  46. Rengel, Z. Soil pH, soil health and climate change. In Soil Health and Climate Change; Springer: Heidelberg, Germany; Dordrecht, The Netherlands; London, UK; New York, NY, USA, 2011; pp. 69–85. [Google Scholar]
  47. da Costa, C.H.M.; Crusciol, C.A.C. Long-term effects of lime and phosphogypsum application on tropical no-till soybean–oat–sorghum rotation and soil chemical properties. Eur. J. Agron. 2016, 74, 119–132. [Google Scholar] [CrossRef] [Green Version]
  48. Kisinyo, P.; Othieno, C.; Gudu, S.; Okalebo, J.; Opala, P.; Ng’Etich, W.K.; Nyambati, R.O.; Ouma, E.O.; Agalo, J.J.; Kebeney, S.J.; et al. Immediate and residual effects of lime and phosphorus fertilizer on soil acidity and maize production in western Kenya. Exp. Agric. 2014, 50, 128–143. [Google Scholar] [CrossRef]
  49. Lukin, V.V.; Epplin, F.M. Optimal frequency and quantity of agricultural lime applications. Agric. Syst. 2003, 76, 949–967. [Google Scholar] [CrossRef]
  50. Wu, K.; Yuan, S.; Wang, L.; Shi, J.; Zhao, J.; Shen, B.; Shen, Q. Effects of bio-organic fertilizer plus soil amendment on the control of tobacco bacterial wilt and composition of soil bacterial communities. Biol. Fertil. Soils 2014, 50, 961–971. [Google Scholar] [CrossRef]
  51. Högberg, M.N.; Högberg, P.; Myrold, D.D. Is microbial community composition in boreal forest soils determined by pH, C-to-N ratio, the trees, or all three? Oecologia 2007, 150, 590–601. [Google Scholar] [CrossRef] [PubMed]
  52. Abdurahman, A.; Parker, M.L.; Kreuze, J.; Elphinstone, J.G.; Struik, P.C.; Kigundu, A.; Arengo, E.; Sharma, K. Molecular epidemiology of Ralstonia solanacearum species complex strains causing bacterial wilt of potato in Uganda. Phytopathology 2019, 109, 1922–1931. [Google Scholar] [CrossRef] [Green Version]
  53. Fouché-Weich, J.; Poussier, S.; Trigalet-Demery, D.; Berger, D.; Coutinho, T. Molecular identification of some African strains of Ralstonia solanacearum from eucalypt and potato. J. Gen. Plant Pathol. 2006, 72, 369–373. [Google Scholar] [CrossRef]
  54. Safni, I.; Cleenwerck, I.; De Vos, P.; Fegan, M.; Sly, L.; Kappler, U. Polyphasic taxonomic revision of the Ralstonia solanacearum species complex: Proposal to emend the descriptions of Ralstonia solanacearum and Ralstonia syzygii and reclassify current R. syzygii strains as Ralstonia syzygii subsp. syzygii subsp. nov., R. solanacearum phylotype IV strains as Ralstonia syzygii subsp. indonesiensis subsp. nov., banana blood disease bacterium strains as Ralstonia syzygii subsp. celebesensis subsp. nov. and R. solanacearum phylotype I and III strains as Ralstonia pseudosolanacearum sp. nov. Int. J. Syst. Evol. Microbiol. 2014, 64, 3087–3103. [Google Scholar]
  55. Cellier, G.; Prior, P. Deciphering phenotypic diversity of Ralstonia solanacearum strains pathogenic to potato. Phytopathology 2010, 100, 1250–1261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Milling, A.; Meng, F.; Denny, T.P.; Allen, C. Interactions with hosts at cool temperatures, not cold tolerance, explain the unique epidemiology of Ralstonia solanacearum race 3 biovar 2. Phytopathology 2009, 99, 1127–1134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Tafesse, S.; Van Mierlo, B.; Leeuwis, C.; Lie, R.; Lemaga, B.; Struik, P.C. Combining experiential and social learning approaches for crop disease management in a smallholder context: A complex socio-ecological problem. Socio Ecolog. Pract. Res. 2020, 2, 265–282. [Google Scholar] [CrossRef]
  58. EPPO. PM 7/21 (2) Ralstonia solanacearum, R. pseudosolanacearum and R. syzygii (Ralstonia solanacearum species complex). EPPO Bull. 2018, 48, 32–63. [Google Scholar]
Agronomy 11 01541 g001 550
Figure 1. Field experiment. (A) Inoculation of each plant by drenching, (B) Bacterial suspension prepared for inoculation in Erlenmeyer flasks, and (C) Experimental plots at one of the sites (Wolmera Choke).
Figure 1. Field experiment. (A) Inoculation of each plant by drenching, (B) Bacterial suspension prepared for inoculation in Erlenmeyer flasks, and (C) Experimental plots at one of the sites (Wolmera Choke).
Agronomy 11 01541 g001
Agronomy 11 01541 g002 550
Figure 2. Proportion of soil pH ranges in sampled potato fields (n = 147).
Figure 2. Proportion of soil pH ranges in sampled potato fields (n = 147).
Agronomy 11 01541 g002
Agronomy 11 01541 g003 550
Figure 3. Correlation between soil acidity and bacterial wilt incidence in different potato fields. Each point indicates an observation of soil pH and bacterial wilt incidence from a different potato field.
Figure 3. Correlation between soil acidity and bacterial wilt incidence in different potato fields. Each point indicates an observation of soil pH and bacterial wilt incidence from a different potato field.
Agronomy 11 01541 g003
Agronomy 11 01541 g004 550
Figure 4. Linear regression curves showing highly significant positive relationships between soil pH and lime application for different dates of measurement (R = 0.93, p < 2.2 × 10–16 after 30 days, R = 0.91, p < 2.2 × 10–16 after 60, 90 and 120 days).
Figure 4. Linear regression curves showing highly significant positive relationships between soil pH and lime application for different dates of measurement (R = 0.93, p < 2.2 × 10–16 after 30 days, R = 0.91, p < 2.2 × 10–16 after 60, 90 and 120 days).
Agronomy 11 01541 g004
Agronomy 11 01541 g005 550
Figure 5. Linear regression curves showing highly significant negative relationships between bacterial wilt incidence and lime application for three dates of disease observation after inoculation (R = −0.80, p = 2.8 × 10–11 for time after 30 days; R = −0.84, p = 8.8 × 10–13 for time after 60 days; R = −0.87, p = 1.74 × 10–14 for time after 90 days).
Figure 5. Linear regression curves showing highly significant negative relationships between bacterial wilt incidence and lime application for three dates of disease observation after inoculation (R = −0.80, p = 2.8 × 10–11 for time after 30 days; R = −0.84, p = 8.8 × 10–13 for time after 60 days; R = −0.87, p = 1.74 × 10–14 for time after 90 days).
Agronomy 11 01541 g005
Agronomy 11 01541 g006 550
Figure 6. Detection and identification of Ralstonia solanacearum strains. Lanes 1, 21, 41 and 52: molecular marker (100 bp); Lanes 20, 40, 50 and 57: negative control; Lanes 2–19, 22–39, 42–49 and 52–55: isolates of this study; Lane 57: Phylotype 1 (PD 7123) positive control).
Figure 6. Detection and identification of Ralstonia solanacearum strains. Lanes 1, 21, 41 and 52: molecular marker (100 bp); Lanes 20, 40, 50 and 57: negative control; Lanes 2–19, 22–39, 42–49 and 52–55: isolates of this study; Lane 57: Phylotype 1 (PD 7123) positive control).
Agronomy 11 01541 g006
Agronomy 11 01541 g007 550
Figure 7. Map of soil pH for (a) Chencha district (Southern Nations, Nationalities, and Peoples’ Regional State, Ethiopia), and (b) Guagusa Shikudad district (Amhara Regional State, Ethiopia). Reproduced with kind permission from the Ethiopian Agricultural Transformation Agency [13].
Figure 7. Map of soil pH for (a) Chencha district (Southern Nations, Nationalities, and Peoples’ Regional State, Ethiopia), and (b) Guagusa Shikudad district (Amhara Regional State, Ethiopia). Reproduced with kind permission from the Ethiopian Agricultural Transformation Agency [13].
Agronomy 11 01541 g007
Table
Table 1. Description of experimental sites.
Table 1. Description of experimental sites.
Experimental SiteLocationAltitude(m)Soil pHSoil Texture (%)
LatitudeLongitude SandSiltClay
Bakaka09°06′28.8′’ N038°28′3.1′’ E25215.22503020
Gaba Robi09°07′33.8′’ N038°26′39.3′’ E25924.8147.53022.5
Wolmera Choke09°06′13.2′’ N038°31′55.5′’ E24594.5857.53012.5
Table
Table 2. List of primers used for multiplex PCR.
Table 2. List of primers used for multiplex PCR.
PrimerPrimer Sequence (5′ to 3′)SpecificityAmplicon Size (bp)Reference
759FGTCGCCGTCAACTCACTTTCCUniversal R.-solanacearum-specific primer280[39]
760RGTCGCCGTCAGCAATGCGGAATCG Reverse
Nmult21:1FCGTTGATGAGGCGCGCAATTTPhylotype I144[40]
Nmult21:2FAAGTTATGGACGGTGGAAGTCPhylotype II372
Nmult23:AFATTACSAGAGCAATCGAAAGATTPhylotype III91
Nmult22:InFATTGCCAAGACGAGAGAAGTAPhylotype IV213
Nmult22:RRTCGCTTGACCCTATAACGAGTAAll phylotypesReverse
Table
Table 3. Effects of different lime application rates on bacterial wilt incidence (values in the same column followed by the same letter do not differ significantly (p < 0.05)). The values are averaged over the three locations.
Table 3. Effects of different lime application rates on bacterial wilt incidence (values in the same column followed by the same letter do not differ significantly (p < 0.05)). The values are averaged over the three locations.
Lime TreatmentsBacterial Wilt Incidence after 90 Days
Control39.4 ± 8.46 a
3 t/ha31.4 ± 6.26 b
6 t/ha23.6 ± 7.24 c
9 t/ha12.5 ± 3.95 d
12 t/ha10.8 ± 4.33 d
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tafesse, S.; Braam, C.; van Mierlo, B.; Lemaga, B.; Struik, P.C. Association between Soil Acidity and Bacterial Wilt Occurrence in Potato Production in Ethiopia. Agronomy 2021, 11, 1541. https://doi.org/10.3390/agronomy11081541

AMA Style

Tafesse S, Braam C, van Mierlo B, Lemaga B, Struik PC. Association between Soil Acidity and Bacterial Wilt Occurrence in Potato Production in Ethiopia. Agronomy. 2021; 11(8):1541. https://doi.org/10.3390/agronomy11081541

Chicago/Turabian Style

Tafesse, Shiferaw, Ciska Braam, Barbara van Mierlo, Berga Lemaga, and Paul C. Struik. 2021. "Association between Soil Acidity and Bacterial Wilt Occurrence in Potato Production in Ethiopia" Agronomy 11, no. 8: 1541. https://doi.org/10.3390/agronomy11081541

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop