Antioxidant Response and Calcium-Dependent Protein Kinases Involvement in Canola (Brassica napus L.) Tolerance to Drought
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material, Experimental Design, and Drought Stress Treatments
2.2. Relative Water Content, Leaf Temperature, Chlorophyll Fluorescence (Fv/Fm) and Electrolyte Leakage Index
2.3. Lipid Peroxidation
2.4. Enzyme Extraction, Protein Determination and Antioxidant Enzyme Activity
2.5. RNA Isolation and Gene Expression
2.6. Statistical Analyses
3. Results
3.1. Effect of Drought Stress on Physiological Traits
3.2. Lipid Peroxidation
3.3. Antioxidant Enzyme Activities
3.4. Calcium-Dependent Protein Kinases (CDPK) Gene Expression in Canola Leaves and Promoter Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- FAO. FAOSTAT. Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 22 December 2017).
- Elferjani, R.; Soolanayakanahally, R. Canola responses to drought, heat, and combined stress: Shared and specific effects on carbon assimilation, seed yield, and oil composition. Front. Plant Sci. 2018, 9, 1224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bray, E.A. Plant responses to water deficit. Trends Plant Sci. 1997, 2, 48–54. [Google Scholar] [CrossRef]
- Seki, M.; Umezawa, T.; Urano, K.; Shinozaki, K. Regulatory metabolic networks in drought stress responses. Curr. Opin. Plant Biol. 2007, 10, 296–302. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.; Zhu, Z.; Guo, Q.; Ma, H.; Zhu, L. Alternate wetting and drying irrigation-mediated changes in the growth, photosynthesis and yield of the medicinal plant Tulipa edulis. Ind. Crops Prod. 2015, 66, 81–88. [Google Scholar] [CrossRef]
- Nayyar, H.; Gupta, D. Differential sensitivity of C3 and C4 plants to water deficit stress: Association with oxidative stress and antioxidants. Environ. Exp. Bot. 2006, 58, 106–113. [Google Scholar] [CrossRef]
- Efeoğlu, B.; Ekmekçi, Y.; Çiçek, N. Physiological responses of three maize cultivars to drought stress and recovery. S. Afr. J. Bot. 2009, 75, 34–42. [Google Scholar] [CrossRef] [Green Version]
- Aberkane, H.; Belkadi, B.; Kehel, Z.; Filali-Maltouf, A.; Tahir, I.S.A.; Meheesi, S.; Amri, A. Assessment of drought and heat tolerance of durum wheat lines derived from interspecific crosses using physiological parameters and stress indices. Agronomy 2021, 11, 695. [Google Scholar] [CrossRef]
- Shokat, S.; Novák, O.; Široká, J.; Singh, S.; Gill, K.S.; Roitsch, T.; Großkinsky, D.K.; Liu, F. Elevated CO2 modulates the effect of heat stress responses in Triticum aestivum by differential expression of an isoflavone reductase-like gene. J. Exp. Bot. 2021, 72, 7594–7609. [Google Scholar] [CrossRef]
- Ulfat, A.; Shokat, S.; Li, X.; Fang, L.; Großkinsky, D.K.; Majid, S.A.; Roitsch, T.; Liu, F. Elevated carbon dioxide alleviates the negative impact of drought on wheat by modulating plant metabolism and physiology. Agric. Water Manag. 2021, 250, 106804. [Google Scholar] [CrossRef]
- Miller, G.; Suzuki, N.; Ciftci-Yilmaz, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
- Noctor, G.; Mhamdi, A.; Foyer, C.H. The roles of reactive oxygen metabolism in drought: Not so cut and dried. Plant Physiol. 2014, 164, 1636–1648. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hirayama, T.; Shinozaki, K. Research on plant abiotic stress responses in the post-genome era: Past, present and future. Plant J. 2010, 61, 1041–1052. [Google Scholar] [CrossRef]
- Bowler, C.; Montagu, M.V.; Inze, D. Superoxide dismutase and stress tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1992, 43, 83–116. [Google Scholar] [CrossRef]
- Shokat, S.; Großkinsky, D.K.; Roitsch, T.; Liu, F. Activities of leaf and spike carbohydrate-metabolic and antioxidant enzymes are linked with yield performance in three spring wheat genotypes grown under well-watered and drought conditions. BMC Plant Biol. 2020, 20, 400. [Google Scholar] [CrossRef]
- Whalley, H.J.; Knight, M.R. Calcium signatures are decoded by plants to give specific gene responses. New Phytol. 2013, 197, 690–693. [Google Scholar] [CrossRef]
- Luan, S.; Kudla, J.; Rodriguez-Concepcion, M.; Yalovsky, S.; Gruissem, W. Calmodulins and Calcineurin B–like Proteins: Calcium Sensors for Specific Signal Response Coupling in Plants. Plant Cell. 2002, 14, S389–S400. [Google Scholar] [CrossRef] [Green Version]
- Kudla, J.; Batistič, O.; Hashimoto, K. Calcium signals: The lead currency of plant information processing. Plant Cell 2010, 22, 541–563. [Google Scholar] [CrossRef]
- Romeis, T.; Herde, M. From local to global: CDPKs in systemic defense signaling upon microbial and herbivore attack. Curr. Opin. Plant Biol. 2014, 20, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Harper, J.F.; Breton, G.; Harmon, A. Decoding Ca2+ signals through plant protein kinases. Annu. Rev. Plant Biol. 2004, 55, 263–288. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.-Y.; Wu, W.-H. AtCPK23 functions in Arabidopsis responses to drought and salt stresses. Plant Mol. Biol. 2007, 65, 511–518. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Tian, Y.-S.; Peng, R.-H.; Xiong, A.-S.; Zhu, B.; Jin, X.-F.; Gao, F.; Fu, X.-Y.; Hou, X.-L.; Yao, Q.-H. AtCPK6, a functionally redundant and positive regulator involved in salt/drought stress tolerance in Arabidopsis. Planta 2010, 231, 1251–1260. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.-J.; Wei, F.-J.; Wang, C.; Wu, J.-J.; Ratnasekera, D.; Liu, W.-X.; Wu, W.-H. Arabidopsis calcium-dependent protein kinase CPK10 functions in abscisic acid- and Ca2+-mediated stomatal regulation in response to drought stress. Plant Physiol. 2010, 154, 1232–1243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, H.; Liu, W.-Z.; Zhang, Y.; Deng, M.; Niu, F.; Yang, B.; Wang, X.; Wang, B.; Liang, W.; Deyholos, M.K. Identification, expression and interaction analyses of calcium-dependent protein kinase (CPK) genes in canola (Brassica napus L.). BMC Genom. 2014, 15, 211. [Google Scholar] [CrossRef] [Green Version]
- Mirzai, M.; Moeini, A.; Ghanati, F. Effects of drought stress on the lipid peroxidation and antioxidant enzyme activities in two canola (Brassica napus L.) cultivars. J. Agric. Sci. Technol. (JAST) 2013, 15, 593–602. [Google Scholar]
- Zahedi, H.; Moghadam, H.T. Effect of drought stress on antioxidant enzymes activities with zeolite and selenium application in canola cultivars. Res. Crops 2011, 12, 388–392. [Google Scholar]
- Weatherley, P.E. Studies in the water relations of the cotton plant: I. The field measurements of water deficits in leaves. New Phytol. 1950, 49, 81–97. [Google Scholar] [CrossRef]
- Strasserf, R.J.; Srivastava, A. Polyphasic chlorophyll a fluorescence transient in plants and cyanobacteria. Photochem. Photobiol. 1995, 61, 32–42. [Google Scholar] [CrossRef]
- Dionisio-Sese, M.L.; Tobita, S. Antioxidant responses of rice seedlings to salinity stress. Plant Sci. 1998, 135, 1–9. [Google Scholar] [CrossRef]
- Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef]
- Polle, A.; Otter, T.; Seifert, F. Apoplastic peroxidases and lignification in needles of Norway spruce (Picea abies L.). Plant Physiol. 1994, 106, 53–60. [Google Scholar] [CrossRef] [Green Version]
- Aebi, H. Catalase In Vitro. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1984; Volume 105, pp. 121–126. [Google Scholar]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Higo, K.; Ugawa, Y.; Iwamoto, M.; Korenaga, T. Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 1999, 27, 297–300. [Google Scholar] [CrossRef] [Green Version]
- Alexieva, V.; Sergiev, I.; Mapelli, S.; Karanov, E. The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant Cell Environ. 2001, 24, 1337–1344. [Google Scholar] [CrossRef]
- Sabagh, A.E.; Hossain, A.; Barutçular, C.; Islam, M.S.; Ratnasekera, D.; Kumar, N.; Meena, R.S.; Gharib, H.S.; Saneoka, H.; da Silva, J.A.T. Drought and salinity stress management for higher and sustainable canola (Brassica napus L.) production: A critical review. Aust. J. Crop Sci. 2019, 13, 88–96. [Google Scholar] [CrossRef]
- Amani, I.; Fischer, R.A.; Reynolds, M.P. Canopy temperature depression association with yield of irrigated spring wheat cultivars in a hot climate. J. Agron. Crop Sci. 1996, 176, 119–129. [Google Scholar] [CrossRef]
- Morrison, M.J.; Stewart, D.W. Heat stress during flowering in summer Brassica. Crop Sci. 2002, 42, 797–803. [Google Scholar] [CrossRef]
- Balota, M.; Payne, W.A.; Evett, S.R.; Lazar, M.D. Canopy temperature depression sampling to assess grain yield and genotypic differentiation in winter wheat. Crop Sci. 2007, 47, 1518–1529. [Google Scholar] [CrossRef]
- Baker, N.R. Chlorophyll fluorescence: A probe of photosynthesis in vivo. Annu. Rev. Plant Biol. 2008, 59, 89–113. [Google Scholar] [CrossRef] [Green Version]
- Isoda, A. Effects of water stress on leaf temperature and chlorophyll fluorescence parameters in cotton and peanut. Plant Prod. Sci. 2010, 13, 269–278. [Google Scholar] [CrossRef]
- Miao, Y.; Bi, Q.; Qin, H.; Zhang, X.; Tan, N. Moderate drought followed by re-watering initiates beneficial changes in the photosynthesis, biomass production and Rubiaceae-type cyclopeptides (RAs) accumulation of Rubia yunnanensis. Ind. Crops Prod. 2020, 148, 112284. [Google Scholar] [CrossRef]
- Hussain, T.; Koyro, H.-W.; Zhang, W.; Liu, X.; Gul, B.; Liu, X. Low salinity improves photosynthetic performance in Panicum antidotale under drought stress. Front. Plant Sci. 2020, 11, 481. [Google Scholar] [CrossRef]
- Jia, Y.; Xiao, W.; Ye, Y.; Wang, X.; Liu, X.; Wang, G.; Li, G.; Wang, Y. Response of photosynthetic performance to drought duration and re-watering in maize. Agronomy 2020, 10, 533. [Google Scholar] [CrossRef] [Green Version]
- Biswas, K.; Adhikari, S.; Tarafdar, A.; Kumar, R.; Saha, S.; Ghosh, P. Reactive Oxygen Species and Antioxidant Defence Systems in Plants: Role and Crosstalk under Biotic stress. In Sustainable Agriculture in the Era of Climate Change; Springer: Berlin/Heidelberg, Germany, 2020; pp. 265–292. [Google Scholar]
- Choudhury, S.; Panda, P.; Sahoo, L.; Panda, S.K. Reactive oxygen species signaling in plants under abiotic stress. Plant Signal. Behav. 2013, 8, e23681. [Google Scholar] [CrossRef] [Green Version]
- Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: A review. Ann. Bot. 2003, 91, 179–194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Filek, M.; Walas, S.; Mrowiec, H.; Rudolphy-Skórska, E.; Sieprawska, A.; Biesaga-Kościelniak, J. Membrane permeability and micro-and macroelement accumulation in spring wheat cultivars during the short-term effect of salinity-and PEG-induced water stress. Acta Physiol. Plant. 2012, 34, 985–995. [Google Scholar] [CrossRef] [Green Version]
- Mullineaux, P.M.; Baker, N.R. Oxidative stress: Antagonistic signaling for acclimation or cell death? Plant Physiol. 2010, 154, 521–525. [Google Scholar] [CrossRef] [Green Version]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [Green Version]
- Goswami, B.; Rankawat, R.; Gadi, B. Physiological and antioxidative responses associated with drought tolerance of Lasiurus sindicus Henr. endemic to Thar desert, India. Braz. J. Bot. 2020, 43, 761–773. [Google Scholar] [CrossRef]
- Guo, Z.; Ou, W.; Lu, S.; Zhong, Q. Differential responses of antioxidative system to chilling and drought in four rice cultivars differing in sensitivity. Plant Physiol. Biochem. 2006, 44, 828–836. [Google Scholar] [CrossRef]
- Anjum, S.A.; Ashraf, U.; Tanveer, M.; Khan, I.; Hussain, S.; Shahzad, B.; Zohaib, A.; Abbas, F.; Saleem, M.F.; Ali, I. Drought induced changes in growth, osmolyte accumulation and antioxidant metabolism of three maize hybrids. Front. Plant Sci. 2017, 8, 69. [Google Scholar] [CrossRef] [PubMed]
- Niu, J.; Zhang, S.; Liu, S.; Ma, H.; Chen, J.; Shen, Q.; Ge, C.; Zhang, X.; Pang, C.; Zhao, X. The compensation effects of physiology and yield in cotton after drought stress. J. Plant Physiol. 2018, 224, 30–48. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Shi, S.; Wang, B.; Zhao, J. Physiological and biochemical changes in different drought-tolerant alfalfa (Medicago sativa L.) varieties under PEG-induced drought stress. Acta Physiol. Plant. 2018, 40, 25. [Google Scholar] [CrossRef]
- Hosseini, S.M.; Hasanloo, T.; Mohammadi, S. Physiological characteristics, antioxidant enzyme activities, and gene expression in 2 spring canola (Brassica napus L.) cultivars under drought stress conditions. Turk. J. Agric. For. 2015, 39, 413–420. [Google Scholar] [CrossRef]
- Jung, S. Variation in antioxidant metabolism of young and mature leaves of Arabidopsis thaliana subjected to drought. Plant Sci. 2004, 166, 459–466. [Google Scholar] [CrossRef]
- Ludwig, A.A.; Romeis, T.; Jones, J.D.G. CDPK-mediated signalling pathways: Specificity and cross-talk. J. Exp. Bot. 2004, 55, 181–188. [Google Scholar] [CrossRef] [Green Version]
- Schulz, P.; Herde, M.; Romeis, T. Calcium-dependent protein kinases: Hubs in plant stress signaling and development. Plant Physiol. 2013, 163, 523–530. [Google Scholar] [CrossRef] [Green Version]
- Falcon, S.; Gentleman, R. Using GOstats to test gene lists for GO term association. Bioinformatics 2007, 23, 257–258. [Google Scholar] [CrossRef] [Green Version]
- Llorca, C.M.; Potschin, M.; Zentgraf, U. bZIPs and WRKYs: Two large transcription factor families executing two different functional strategies. Front. Plant Sci. 2014, 5, 169. [Google Scholar] [CrossRef] [Green Version]
- Choi, H.-i.; Hong, J.-h.; Ha, J.-o.; Kang, J.-y.; Kim, S.Y. ABFs, a family of ABA-responsive element binding factors. J. Biol. Chem. 2000, 275, 1723–1730. [Google Scholar] [CrossRef] [Green Version]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biolology 2006, 57, 781–803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, C.Z.; Chen, Y.; Wang, C.; Kong, Y.H.; Wu, W.H.; Chen, Y.F. Arabidopsis RAV 1 transcription factor, phosphorylated by S n RK 2 kinases, regulates the expression of ABI 3, ABI 4, and ABI 5 during seed germination and early seedling development. Plant J. 2014, 80, 654–668. [Google Scholar] [CrossRef]
- Rushton, D.L.; Tripathi, P.; Rabara, R.C.; Lin, J.; Ringler, P.; Boken, A.K.; Langum, T.J.; Smidt, L.; Boomsma, D.D.; Emme, N.J. WRKY transcription factors: Key components in abscisic acid signalling. Plant Biotechnol. J. 2012, 10, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Baldoni, E.; Genga, A.; Cominelli, E. Plant MYB Transcription factors: Their role in drought response mechanisms. Int. J. Mol. Sci. 2015, 16, 15811–15851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Accession No. | Gene Locus | Primer Sequence |
---|---|---|---|
BnaCDPK6 | XM_013788076.2 | LOC106348352 | For 5′ TCAAGGACAAAGTCTACGAGGGTAA 3′ Rev 5′ TCTTTTACAGGAACGGGATTGTTG 3′ |
BnaCDPK10 | XM_013860191.2 | LOC106419410 | For 5′ AGTCAGATCGAGATTGAAGCAGTT 3′ Rev 5′ TTGAGTTCCGGGCAAGTTATTCTA 3′ |
BnaCDPK14 | XM_013896624 | LOC106454505 | For 5′ CGGATTGCGTAAACTAGGAATTGTTG 3′ Rev 5′ CTGCCCATCTTTCTGATGTGTACC 3′ |
BnaActin7 | XM_013858992 | LOC106418315 | For 5′ TGGGTTTGCTGGTGACGAT 3′ Rev 5′TGCCTAGGACGACCAACAATACT 3′ |
Element Name | Sequence | Number of Elements | ||
---|---|---|---|---|
BnaCDPK6 | BnaCDPK10 | BnaCDPK14 | ||
ABRERATCAL | MACGYGB | 1 | 1 | - |
ABRELATERD1 | ACGTG | 1 | 1 | 1 |
CGCGBOXAT | VCGCGB | 8 | 2 | - |
WBOXNTCHN48 | CTGACY | 1 | 2 | 2 |
WBOXNTERF3 | TGACY | 3 | 5 | 3 |
WBOXHVISO1 | TGACT | 2 | 3 | 2 |
WBOXATNPR1 | TTGAC | 3 | 5 | - |
WBBOXPCWRKY1 | TTTGACY | 1 | - | - |
RAV1AAT | CAACA | 3 | 5 | 2 |
MYBGAHV | TAACAAA | 2 | 2 | - |
MYBCORE | CNGTTR | 5 | 2 | 7 |
MYB1AT | WAACCA | 6 | 2 | - |
MYBST1 | GGATA | 5 | 2 | 3 |
MYBPLANT | MACCWAMC | 2 | - | 2 |
MYBCOREATCYCB1 | AACGG | 1 | - | 6 |
MYBPZM | CCWACC | 1 | 1 | 1 |
MYB1LEPR | GTTAGTT | - | 1 | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmadi, H.; Abbasi, A.; Taleei, A.; Mohammadi, V.; Pueyo, J.J. Antioxidant Response and Calcium-Dependent Protein Kinases Involvement in Canola (Brassica napus L.) Tolerance to Drought. Agronomy 2022, 12, 125. https://doi.org/10.3390/agronomy12010125
Ahmadi H, Abbasi A, Taleei A, Mohammadi V, Pueyo JJ. Antioxidant Response and Calcium-Dependent Protein Kinases Involvement in Canola (Brassica napus L.) Tolerance to Drought. Agronomy. 2022; 12(1):125. https://doi.org/10.3390/agronomy12010125
Chicago/Turabian StyleAhmadi, Hossein, Alireza Abbasi, Alireza Taleei, Valiollah Mohammadi, and José J. Pueyo. 2022. "Antioxidant Response and Calcium-Dependent Protein Kinases Involvement in Canola (Brassica napus L.) Tolerance to Drought" Agronomy 12, no. 1: 125. https://doi.org/10.3390/agronomy12010125