Development and Validation of an Allele-Specific Marker for Resistance to Bacterial Halo Blight in Coffea arabica
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. AS-PCR Primer Development
2.3. The Psg_QL1 Marker Validation for MAS and Inheritance Study
2.3.1. Molecular Analyses
2.3.2. Phenotypic Evaluations
2.3.3. Genetic Linkage between Psg_QL1 Marker and Qualitative Resistance to BHB
3. Results
3.1. AS-PCR Primer Development
3.2. The Psg_QL1 Marker Validation for MAS and Inheritance Study
3.2.1. Phenotypic Evaluations
3.2.2. Molecular Analyses
3.2.3. Genetic Linkage between Psg_QL1 Marker and Qualitative Resistance to BHB
4. Discussion
4.1. AS-PCR Primer Development
4.2. The Psg_QL1 Marker Validation for MAS and Inheritance Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- CECAFÉ: Conselho dos Exportadores de Café do Brasil. Relatório Mensal Junho 2019. Available online: http://www.sapc.embrapa.br/arquivos/consorcio/informe_estatistico/CECAFE_Relatorio_Mensal_JUNHO_2019.pdf (accessed on 22 June 2021).
- ICO: Internacional Coffee Organization. Trade Statistics Tables 2020. Available online: https://www.ico.org/prices/po-production.pdf (accessed on 20 February 2021).
- Lashermes, P.; Combes, M.C.; Robert, J.; Trouslot, P.; D’Hont, A.; Anthony, F.; Charrier, A. molecular characterization and origin of the Coffea arabica L. genome. Mol. Gen. Genet. 1999, 261, 259–266. [Google Scholar] [CrossRef] [PubMed]
- van der Vossen, H.; Bertrand, B.; Charrier, A. Next generation variety development for sustainable production of arabica coffee (Coffea arabica L.): A review. Euphytica 2015, 204, 243–256. [Google Scholar] [CrossRef]
- Krug, C.A.; Mendes, J.E.T.; Carvalho, A. Taxonomia de Coffea arabica L. In Boletim Técnico NO. 62; Instituto Agronômico de Campinas: Campinas, Brazil, 1939; pp. 9–57. [Google Scholar]
- van der Vossen, H.A.M. Coffee selection and breeding. In Coffee: Botany Biochemistry and Production of Beans and Beverage; Clifford, M.N., Wilson, K.C., Eds.; Croom Herm: London, UK, 1985; pp. 48–96. [Google Scholar]
- Anthony, F.; Bertrand, B.; Quiros, O.; Wilches, A.; Lashermes, P.; Berthaud, J.; Charrier, A. Genetic diversity of wild coffee (Coffea arabica L.) using molecular markers. Euphytica 2001, 118, 53–65. [Google Scholar] [CrossRef]
- Lashermes, P.; Andrzejewski, S.; Bertrand, B.; Combes, M.C.; Dussert, S.; Graziosi, G.; Trouslot, P.; Anthony, F. Molecular analysis of introgressive breeding in coffee (Coffea arabica L.). Theor. Appl. Genet. 2000, 100, 139–146. [Google Scholar] [CrossRef]
- Scalabrin, S.; Toniutti, L.; Di Gaspero, G.; Scaglione, D.; Magris, G.; Vidotto, M.; Pinosio, S.; Cattonaro, F.; Magni, F.; Jurman, I.; et al. A single polyploidization event at the origin of the tetraploid genome of Coffea arabica is responsible for the extremely low genetic variation in wild and cultivated germplasm. Sci. Rep. 2020, 10, 4642. [Google Scholar] [CrossRef] [Green Version]
- do Amaral, J.F.; Teixeira, C.; Pinheiro, E.D. A bactéria causadora da mancha-aureolada do cafeeiro. In Arquivo do Instituto Biológico; Instituto Biológico: São Paulo, Brazil, 1956; Volume 23, pp. 151–155. [Google Scholar]
- Badel, J.L.; Zambolim, L. Coffee bacterial diseases: A plethora of scientific opportunities. Plant Pathol. 2019, 68, 411–425. [Google Scholar] [CrossRef] [Green Version]
- Zoccoli, D.M.; Takatsu, A.; Uesugi, C.H. Ocorrência de mancha aureolada em cafeeiros na região do Triângulo Mineiro e Alto Paranaíba. Bragantia 2011, 70, 843–849. [Google Scholar] [CrossRef] [Green Version]
- Ziska, L.H.; Bradley, B.A.; Wallace, R.D.; Bargeron, C.T.; LaForest, J.H.; Choudhury, R.A.; Garrett, K.A.; Vega, F.E. Climate change, carbon dioxide, and pest biology, managing the future: Coffee as a case study. Agronomy 2018, 8, 152. [Google Scholar] [CrossRef] [Green Version]
- De La Vega, F.M.; Lazaruk, K.D.; Rhodes, M.D.; Wenz, M.H. Assessment of two flexible and compatible SNP genotyping platforms: TaqMan® SNP genotyping assays and the SNPlexTM genotyping system. Mutat. Res.-Fundam. Mol. Mech. Mutagen. 2005, 573, 111–135. [Google Scholar] [CrossRef]
- Semagn, K.; Babu, R.; Hearne, S.; Olsen, M. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): Overview of the technology and its application in crop improvement. Mol. Breed. 2014, 33, 1–14. [Google Scholar] [CrossRef]
- Ugozzoli, L.; Wallace, R.B. Allele-specific polymerase chain reaction. Meth. Enzymol. 1991, 2, 42–48. [Google Scholar] [CrossRef]
- Liu, J.; Huang, S.; Sun, M.; Liu, S.; Liu, Y.; Wang, W.; Zhang, X.; Wang, H.; Hua, W. An improved allele-specific PCR primer design method for SNP marker analysis and its application. Plant Methods 2012, 8, 34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petruska, J.; Goodman, M.F.; Boosalis, M.S.; Sowers, L.C.; Cheong, C.; Tinoco, I. Comparison between DNA melting thermodynamics and DNA polymerase fidelity. Proc. Natl. Acad. Sci. USA 1988, 85, 6252–6256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cha, R.S.; Zarbl, H.; Keohavong, P.; Thilly, W.G. Mismatch amplification mutation assay (MAMA): Application to the c-H-ras gene. PCR Methods Appl. 1992, 2, 14–20. [Google Scholar] [CrossRef] [Green Version]
- Mohan, S.K.; Cardoso, R.M.L.; Paiva, M.A. Resistência em germoplasma de Coffea ao crestamento bacteriano incitado por Pseudomonas garcae. Pesqui. Agropecuária Bras. 1978, 13, 53–64. [Google Scholar]
- Ito, D.S.; Sera, T.; Sera, G.H.; Del Grossi, L.; Kanayama, F.S. Resistance to bacterial blight in arabica coffee cultivars. Crop Breed. Appl. Biotechnol. 2008, 8, 99–103. [Google Scholar] [CrossRef]
- Sera, G.H.; Sera, T.; Fazuoli, L.C. IPR 102—Dwarf arabica coffee cultivar with resistance to bacterial halo blight. Crop Breed. Appl. Biotechnol. 2017, 17, 403–407. [Google Scholar] [CrossRef] [Green Version]
- Fernandes, L.E.; dos Santos, W.G.; Carducci, F.C.; Fonseca, I.C.B.; Rodrigues, L.M.R.; Beriam, L.O.S.; Pereira, C.T.M.; Shigueoka, L.H.; Sera, G.H. Resistance of arabica coffee cultivars to leaf wounds and Pseudomonas syringae under field conditions. Aust. J. Crop Sci. 2020, 14, 46–50. [Google Scholar] [CrossRef]
- Andreazi, E.; Sera, G.H.; de Faria, R.T.; Sera, T.; Shigueoka, L.H.; Carvalho, F.G.; Carducci, F.C.; Chamlet, D. Performance of F1 hybrids of arabica coffee with simultaneous resistance to leaf rust, bacterial blight and leaf miner. Coffee Sci. 2015, 10, 375–382. [Google Scholar]
- Rodrigues, L.M.R.; Destéfano, S.A.L.; Almeida, I.M.G.; Beriam, L.O.S.; Toma-Braghini, M.; Guerreiro Filho, O. Multiple resistance to bacterial halo blight and bacterial leaf spot in Coffea spp. Plant Pathol. 2019, 86, 1–9. [Google Scholar] [CrossRef]
- Ariyoshi, C.; Sant’ana, G.C.; Felicio, M.S.; Sera, G.H.; Nogueira, L.M.; Rodrigues, L.M.R.; Ferreira, R.V.; da Silva, B.S.R.; Resende, M.L.V.; Destéfano, S.A.L.; et al. Genome-wide association study for resistance to Pseudomonas syringae pv. garcae in Coffea arabica. Front. Plant Sci. 2022, 13, 989847. [Google Scholar] [CrossRef] [PubMed]
- Jones, J.D.G.; Dangl, J.L. The plant immune system. Nat. Rev. 2006, 444, 16. [Google Scholar] [CrossRef] [PubMed]
- Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
- Salojärvi, J. Arabica Coffee Genome Consortium. Chromosome-level assembly of allotetraploid Coffea arabica reveals the complex history of a recent allopolyploid. In Proceedings of the 28th International Conference on Coffee Science (ASIC), Montpellier, France, 28 June–1 July 2021. [Google Scholar]
- Untergasser, A.; Nijveen; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, 71–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wangkumhang, P.; Chaichoompu, K.; Ngamphiw, C.; Ruangrit, U.; Chanprasert, J.; Assawamakin, A.; Tongsima, S. WASP: A Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations. BMC Genet. 2007, 8, 275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bui, M.; Liu, Z. Simple allele-discriminating PCR for cost-effective and rapid genotyping and mapping. Plant Methods 2009, 5, 1. [Google Scholar] [CrossRef] [Green Version]
- Owczarzy, R.; Tataurov, A.V.; Wu, Y.; Manthey, J.A.; McQuisten, K.A.; Almabrazi, H.G.; Pedersen, K.F.; Lin, Y.; Garretson, J.; McEntaggart, N.O.; et al. IDT SciTools: A suite for analysis and design of nucleic acid oligomers. Nucleic Acids Res. 2008, 36, 163–169. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- RStudio Team. RStudio: Integrated development for R; RStudio, PBC: Boston, MA, USA, 2020; Available online: http://www.rstudio.com/ (accessed on 1 January 2021).
- Rodrigues, L.M.R.; Almeida, I.M.G.; Patrício, F.R.A.; Beriam, L.O.S.; Maciel, K.W.; Toma-Braghini, M.; Guerreiro Filho, O. Aggressiveness of strains and inoculation methods for resistance assessment to bacterial halo blight on coffee seedlings. J. Phytopathol. 2017, 165, 105–114. [Google Scholar] [CrossRef]
- Moncada, M.D.P.; Tovar, E.; Montoya, J.C.; González, A.; Spindel, J.; McCouch, S. A genetic linkage map of coffee (Coffea arabica L.) and QTL for yield, plant height, and bean size. Tree Genet. Genomes 2016, 12, 5. [Google Scholar] [CrossRef]
- Sant’ana, G.C.; Pereira, L.F.P.; Pot, D.; Ivamoto, S.T.; Domingues, D.D.; Ferreira, R.V.; Pagiatto, N.F.; da Silva, B.S.R.; Nogueira, L.M.; Kitzberger, C.S.G.; et al. Genome-wide association study reveals candidate genes influencing lipids and diterpenes contents in Coffea arabica L. Sci. Rep. 2018, 8, 465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gimase, J.M.; Thagana, W.M.; Omondi, C.O.; Cheserek, J.J.; Gichimu, B.M.; Gichuru, E.K.; Ziyomo, C.; Sneller, C.H. Genome-Wide Association Study identify the genetic loci conferring resistance to Coffee Berry Disease (Colletotrichum kahawae) in Coffea arabica var. Rume Sudan. Euphytica 2020, 216, 86. [Google Scholar] [CrossRef]
- Nonato, J.V.A.; Carvalho, H.F.; Borges, K.L.R.; Padilha, L.; Maluf, M.P.; Fritsche-Neto, R.; Guerreiro Filho, O. Association mapping reveals genomic regions associated with bienniality and resistance to biotic stresses in arabica coffee. Euphytica 2021, 217, 190. [Google Scholar] [CrossRef]
- Hirotsu, N.; Murakami, N.; Kashiwagi, T.; Ujiie, K.; Ishimaru, K. Protocol: A simple gel-free method for SNP genotyping using allele-specific primers in rice and other plant species. Plant Methods 2010, 6, 12. [Google Scholar] [CrossRef] [PubMed]
- Peyret, N.; Seneviratne, P.A.; Allawi, H.T.; Santalucia, J. Nearest-Neighbor Thermodynamics and NMR of DNA Sequences with Internal A.A, C.C, G.G, and T.T Mismatches. Biochemistry 1999, 38, 3468–3477. [Google Scholar] [CrossRef]
- Drenkard, E.; Richter, B.G.; Rozen, S.; Stutius, L.M.; Angell, N.A.; Mindrinos, M.; Cho, R.J.; Oefner, P.J.; Davis, R.W.; Ausubel, F.M. A simple procedure for the analysis of single nucleotide polymorphisms facilitates map-based cloning in Arabidopsis. Plant Physiol. 2000, 124, 1483–1492. [Google Scholar] [CrossRef] [Green Version]
- Kim, M.; Lestari, P.; Moon, K.; Lee, H. SNP identification and SNAP marker development for a GmNARK gene controlling supernodulation in soybean. Theor. Appl. Genet. 2005, 110, 1003–1010. [Google Scholar] [CrossRef]
- Kushalappa, A.C.; Yogendra, K.N.; Karre, S. Plant innate immune response: Qualitative and quantitative resistance. Crit. Rev. Plant Sci. 2016, 35, 38–55. [Google Scholar] [CrossRef] [Green Version]
- Cui, H.; Tsuda, K.; Parker, J.E. Effector-triggered immunity: From pathogen perception to robust defense. Annu. Rev. Plant Biol. 2015, 66, 487–511. [Google Scholar] [CrossRef]
- Corwin, J.A.; Kliebenstein, D.J. Quantitative resistance: More than just perception of a pathogen. Plant Cell 2015, 29, 655–665. [Google Scholar] [CrossRef]
Sequence | TA °C | CG% | Size | Amplicon | |
---|---|---|---|---|---|
Psg_QL1 forward | 5′TTTATCTATCTGATGTGCTGG 3′ | 55 °C | 38.09% | 21 bp | 224 bp |
Psg_QL1 reverse | 5′TACATCGGCAGCCTCAGAAA 3′ | 56 °C | 50.00% | 20 bp |
Hairpin | Self-Dimer | Cross-Dimer | |
---|---|---|---|
Psg_QL1 forward | 0.96 | −3.14 | −5.61 |
Psg_QL1 reverse | 0.76 | −6.21 |
R_ | rr | GL | χ2 | P(1) | ||
---|---|---|---|---|---|---|
exp | obs | exp | obs | |||
BC Population | ||||||
19 | 20 | 19 | 18 | 1 | 0 ns | 100% |
F2 Population | ||||||
103.5 | 114 | 34.5 | 24 | 1 | 1.95 ns | 16.18% |
PCR+ | PCR− | GL | χ2 | P(1) | ||
---|---|---|---|---|---|---|
exp | obs | exp | obs | |||
BC Population | ||||||
19 | 20 | 19 | 18 | 1 | 0 ns | 100% |
F2 Population | ||||||
103.5 | 109 | 34.5 | 29 | 1 | 0.41 ns | 51.98% |
Parameter | Total |
---|---|
Accuracy of method (AM) (%) | 93.75 |
False negative rate (FNR) (%) | 17.02 |
False positive rate (FPR) (%) | 2.33 |
Total error rate (TER) (%) | 6.25 |
χ2 McNemar | 1.45 * |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ariyoshi, C.; Sera, G.H.; Rodrigues, L.M.R.; Carvalho, F.G.; Shigueoka, L.H.; Mendonça, A.E.S.; Pereira, C.T.M.; Destéfano, S.A.L.; Pereira, L.F.P. Development and Validation of an Allele-Specific Marker for Resistance to Bacterial Halo Blight in Coffea arabica. Agronomy 2022, 12, 3178. https://doi.org/10.3390/agronomy12123178
Ariyoshi C, Sera GH, Rodrigues LMR, Carvalho FG, Shigueoka LH, Mendonça AES, Pereira CTM, Destéfano SAL, Pereira LFP. Development and Validation of an Allele-Specific Marker for Resistance to Bacterial Halo Blight in Coffea arabica. Agronomy. 2022; 12(12):3178. https://doi.org/10.3390/agronomy12123178
Chicago/Turabian StyleAriyoshi, Caroline, Gustavo Hiroshi Sera, Lucas Mateus Rivero Rodrigues, Filipe Gimenez Carvalho, Luciana Harumi Shigueoka, Ana Ester Socatelli Mendonça, Carlos Theodoro Motta Pereira, Suzete Aparecida Lanza Destéfano, and Luiz Filipe Protasio Pereira. 2022. "Development and Validation of an Allele-Specific Marker for Resistance to Bacterial Halo Blight in Coffea arabica" Agronomy 12, no. 12: 3178. https://doi.org/10.3390/agronomy12123178