Next Article in Journal
Spatiotemporal Characteristics of Dryness/Wetness in the Wine Regions of China from 1981 to 2015
Previous Article in Journal
Can Cold Plasma Be Used for Boosting Plant Growth and Plant Protection in Sustainable Plant Production?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 4
10.3390/agronomy12040842
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nitrate-Induced MtCLE34 Gene Lacks the Ability to Reduce Symbiotic Nodule Number and Carries Nonsense Mutation in a Few Accessions of Medicago truncatula

by
Maria Lebedeva
*,
Kristina Dvornikova
and
Lyudmila Lutova
Department of Genetics and Biotechnology, Saint Petersburg State University, Universitetskaya emb. 7/9, Saint Petersburg 199034, Russia
*
Author to whom correspondence should be addressed.
Agronomy 2022, 12(4), 842; https://doi.org/10.3390/agronomy12040842
Submission received: 1 March 2022 / Revised: 22 March 2022 / Accepted: 28 March 2022 / Published: 29 March 2022
Browse Figures
Versions Notes

Abstract

:
Legume plants form nitrogen-fixing nodules on their roots in symbiosis with soil bacteria rhizobia. The number of symbiotic nodules is controlled by a host plant via a systemic mechanism known as autoregulation of nodulation (AON). The key players of AON are the CLE peptides which are produced in the root in response to rhizobia inoculation and are transported via xylem to the shoot. In the shoot, the CLE peptides are recognized by a CLV1-like receptor kinase, which results in subsequent inhibition of nodule development in the root via a negative feedback mechanism. In addition to the CLE peptides induced by rhizobia, nitrate-induced CLE peptides involved in the control of nodulation have been identified. In Medicago truncatula, the MtCLE34 gene has been described, which was activated by nitrate and in response to rhizobial inoculation. However, this gene contains a premature stop codon in the reference M. truncatula genome of the A17 line, and therefore, it was suggested to be a pseudogene. Here, we analyzed nucleotide sequences of the MtCLE34 gene available from the genomes of different M. truncatula accessions from the Medicago HAPMAP project and found that the majority of M. truncatula accession lines do not carry nonsense mutations in the MtCLE34 gene and should encode functional products. Overexpression of the MtCLE34 gene from the R108 line, which does not have a premature stop codon, did not inhibit nodulation. Therefore, in spite of having high sequence similarity to the nodulation-suppressing CLE genes, the MtCLE34 gene from the R108 line was not able to trigger AON in M. truncatula. Our findings shed light on the evolutionary changes in the CLE proteins in legume plants and can be used in the future to understand which amino acid residues within CLE proteins could be important for their ability to suppress nodulation.

1. Introduction

The CLE (CLAVATA3/EMBRYO SURROUNDING REGION-related) peptides are key regulators of plant development and systemic response to mineral nutrition [1]. This peptide family includes post-translationally modified peptides, which are produced from premature proteins through proteolytic processing and post-translational modifications. Premature CLE proteins include an N-terminal signaling domain, a central variable region, and a conserved C-terminal CLE domain, while some CLE proteins may have multiple CLE domains [2]. The CLE domain, consisting of 12–13 amino acid residues, corresponds to a mature functional CLE peptide, which is cleaved out from a precursor protein due to proteolysis. In addition, certain post-translational modifications are necessary for the activity of CLE peptides. Specifically, the conserved proline residues in the 4th and 7th positions of the CLE domain are hydroxylated to form hydroxyproline; moreover, some of the CLE peptides undergo tri-arabinosylation of the 7th hydroxyproline residues, and such modification is essential for their activity [3,4].
In legume plants, CLE peptides have been recruited for the systemic regulation of symbiotic nodulation [5]. Nodules develop on legume roots under low-nitrogen conditions due to symbiotic interaction with soil bacteria rhizobia, and in these organs, bacteria fix atmospheric nitrogen for plant demands. Nodulation-related CLE peptides are involved in the control of nodule number, and their production in the root triggers signaling pathway inhibiting nodulation. The CLE genes inhibiting nodulation have been described in model legumes, including Lotus japonicus (LjCLE-RS1 (CLE-ROOT SIGNAL 1), LjCLE-RS2, and LjCLE-RS3) [6,7], Medicago truncatula (MtCLE13, MtCLE12, MtCLE35) [8,9,10,11], and soybean (GmRIC1 (RHIZOBIUM INDUCED CLE 1), GmRIC2, GmNIC1 (NITRATE INDUCED CLE 1), and GmNIC2) [12]. The homologues of these genes have been described in pea [13] and common bean [14]; however, their functional analysis has not been performed yet. The CLE peptides act as mobile regulators of nodulation. They are produced in the root and are capable of triggering the systemic inhibition of nodulation through a shoot-acting CLV1-like receptor kinase [6,8,12]. Specifically, root-produced LjCLE-RS2 from L. japonicus was found in the xylem sap collected from the shoot, and this peptide directly binds to the CLV1-like receptor kinase LjHAR1 (HYPERNODULATION ABERRANT ROOT FORMATION1) [15].
Two signaling pathways activating nodulation-related CLEs are known. First, the expression of the CLE genes is induced in response to inoculation with rhizobia, and as a result, the CLE peptides are produced in the root and trigger a feedback mechanism through a shoot-acting CLE receptor to inhibit subsequent nodulation [6]. The NIN (NODULE INCEPTION) transcription factor is responsible for CLEs activation in response to rhizobial inoculation [16,17]. The second pathway involves the nitrate-dependent activation of nodulation-related CLE genes, which is mediated by the NLP (NIN-like proteins) transcription factors in response to nitrate treatment [18]. This mechanism is responsible for the nitrate-dependent inhibition of nodulation. Some of the nodulation-related CLEs, including LjCLE-RS1 [6], MtCLE13 and MtCLE12 [8], GmRIC1 and GmRIC2 [12], are induced by rhizobial inoculation, but are not responsive to nitrate treatment. Other nodulation-related CLE genes, such as LjCLE-RS2, LjCLE-RS3 [6,7], and MtCLE35 [9,10,11], are activated by both rhizobia-induced signaling pathway and by nitrate. In addition, the GmNIC1 and GmNIC2 genes from soybean are activated by nitrate, but not in response to early rhizobia-induced signaling pathway [12]. These nodulation-related genes systemically inhibit nodulation when overexpressed, suggesting that their products act in a long-distance control of nodulation involving shoot-acting receptors, except for nitrate-induced GmNIC1 and GmNIC2 genes which were reported to act as local regulators of nodule numbers in the root [12].
In M. truncatula, a close homolog of soybean nitrate-induced CLE genes, the MtCLE34 gene, has been described, the expression of which was activated both by nitrate treatment and by rhizobial inoculation [10]. However, since this gene contains a premature stop codon according to the reference M. truncatula genome sequences, it was suggested to be a pseudogene. Here, we have analyzed nucleotide sequences of the MtCLE34 gene in the genomes of M. truncatula accessions from the Medicago HAPMAP project (https://medicagohapmap2.org/, accessed on 10 January 2022) [19], and found that the premature stop codon in the MtCLE34 gene present in the reference genome of the A17 line was absent in the majority of other M. truncatula accessions. In particular, in the R108 line, which is widely used as a model line for research purposes, the premature stop codon in the MtCLE34 gene is absent; therefore, this gene should encode a functional protein in the R108 line. We overexpressed the MtCLE34 gene from the R108 line and found that it did not inhibit nodulation, in contrast to other nodulation-related CLE genes characterized in M. truncatula and other legumes. Therefore, in spite of having high sequence similarity to nodulation-inhibiting CLE genes, the MtCLE34 gene is not likely to be involved in the control of nodule number in M. truncatula. The reasons for this should be investigated in further studies, which could help to understand which amino acid residues are important for nodulation-inhibiting properties of CLE premature proteins in legume plants.

2. Materials and Methods

2.1. Plant Material, Bacterial Strains, and Growth Conditions

M. truncatula A17 and R108 seeds were sterilized with sulfuric acid and washed several times with sterile distilled water, then transferred to the plates with 1% agar for germination. For expression analysis, plants were grown first on Fahraeus [20] medium for one week and then transferred to the pots containing vermiculite moistened with nitrogen free liquid Fahraeus medium. Plants were grown in the growth chambers under a 16-h photoperiod at 21 °C (75% relative humidity). Sinorhizobium meliloti strain Sm2011 (1 mL of liquid culture grown in YEB medium up to OD600 = 0.7) was used for inoculation of each plant. Inoculated roots as well as non-inoculated control roots were harvested and used for RNA extraction. Nodules were counted four weeks after rhizobial inoculation.
Agrobacterium rhizogenes-mediated plant transformation was carried out as described in [21]. Nitrate treatment of M. truncatula plants was performed as described in [9].

2.2. RNA Extraction and cDNA Synthesis

RNA extraction was performed using TRIZol reagent according to the manufacturer’s instructions (Thermo Scientific, Waltham, MA, USA). Rapid Out DNA Removal Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used for DNase treatment. The concentration and quality of extracted RNA was measured using a NanoDrop 2000c UV-Vis Spectrophotometer (Thermo Scientific, Waltham, MA, USA). Equal amount (300–500 ng) of RNA was used for cDNA synthesis performed using Revert Aid Reverse Transcriptase kit (Thermo Scientific, Waltham, MA, USA).

2.3. Quantitative Reverse Transcription PCR (qRT-PCR) Analysis

RT-PCR experiments were performed on a CFX-96 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) using SYBR Green intercalating dyes (Sintol, Moscow, Russia). The data were analyzed by the CFX Manager software with the 2–ΔΔ Ct method [22]. Actin (Medtr7g026230) and ubiquitin (Medtr4g091580) genes were used as reference genes. All the qRT-PCRs were conducted in three technical repeats. Primers used for MtCLE34 expression analysis were: MtCLE34qPCR_FOR: TGCATTCATGGAGAGTAATAAGAAGA and MtCLE34qPCR_REV: TCAGTGGTGTCTAGGGTCAGG. The specificity of PCR amplification was confirmed based on dissociation curves (55–95 °C).

2.4. Molecular Cloning

The CDS sequence of MtCLE34 (Medtr2g091120) from R108 was amplified using high fidelity Phusion polymerase (Thermo Fisher Scientific, Waltham, MA, USA). Through two rounds of PCR amplification the attB sites were attached to the PCR fragment. MtCLE34_CDS_FOR: 5′-AAAAAAGCAGGCTTCATGGCAAACTTAAACAAAGTAGTATG -3′ and MtCLE34_CDS_REV: 5′-CAAGAAAGCTGGGTTTCAGTGGTGTCTAGGGTCAGGC-3′ were used in the first round of PCR (the sequences of the attB sites are underlined). The PCR product was cloned into the pDONR221 vector (Thermo Fisher Scientific, Waltham, MA, USA), and then to the destination vector pB7WG2D (VIB-UGent PSB Plasmid Repository, Ghent, Belgium) using LR Clonase™ II enzyme (Thermo Fisher Scientific, Waltham, MA, USA). The resulting vector was verified by sequencing and was introduced into Agrobacterium rhizogenes strain MSU440.

2.5. GFP Fluorescence Detection

Detection of GFP fluorescence in transgenic roots was performed using Leica M205 FA fluorescence stereo microscope (Leica Microsystems Inc., Wetzlar, Germany). The images were processed using the ImageJ software [23].

2.6. Statistical Methods and Computer Software

In gene expression analysis, three samples, each combining the material from three plants, have been used for each measurement. Student’s t-test was used to compare gene expression levels. The box plot for nodule number in MtCLE34-overexpressing and control (GUS-overexpressing) plants was drawn in RStudio (https://rstudio.com/, accessed on 10 January 2022). Wilcoxon test was used to compare nodule numbers on transgenic MtCLE34-overexpressing and control (GUS-overexpressing) roots of composite plants. In each variant from 10 to 15 plants have been analyzed, and three independent experiments were performed.
The locations of the MtCLE34 region in the genomes of 23 accessions were determined using BLAST algorithm available at https://medicagohapmap2.org/blast (accessed on 10 January 2022). Genome sequences of 23 M. truncatula accessions were downloaded from HAPMAP2 Medicago project, and the sequences corresponding to MtCLE34 regions were retrieved using faidx program from SAMtools [24]. BCF file with SNP data was downloaded from HAPMAP2 Medicago project [19] and analyzed with BCFtools program from SAMtools [24]. Phylogenetic tree of M. truncatula accessions was constructed based on SNP data using neighbor-joining algorithm implemented in TASSEL 5 software [25]. Tree was visualized with iTOL software [26]. Multiple alignment of protein sequences was performed using UGENE software (http://ugene.net/ru/, accessed on 10 January 2022) [27] with Clustal W algorithm. Amino acid sequences of the nodulation-related premature CLE proteins were downloaded from Phytozome v12.1 or Genbank NCBI databases. Signal peptide and putative cleavage site position were determined using SignalP-5.0 [28].

3. Results

3.1. The Expression Analysis of the MtCLE34 Gene in Response to Nodulation and Nitrate Treatment

In Medicago truncatula, MtCLE34 has been described previously as a pseudogene lacking a functional CLE-domain and as a close homolog of the nitrate-activated CLEs of soybean (GmNIC1a and GmNIC1b) and LjCLE40 of Lotus japonicus [10,29]. Mens et al. found that MtCLE34 expression was upregulated by both rhizobia inoculation and nitrate [10]. Our results confirmed that the MtCLE34 expression was increased in the root after 24 h of nitrate treatment (10 mM KNO3) as well as in developing nodules (Figure 1). In our experiments, the expression of the MtCLE34 gene was upregulated at 7 dpi (days after inoculation). At later stages of nodulation, its expression increased reaching maximal levels in mature nodules at 21 dpi. In comparison to its close homologue, the MtCLE35 gene, which is also induced by nitrate and in response to rhizobial inoculation, the MtCLE34 showed later induction during nodulation: the MtCLE35 gene was increased at 5 dpi under the same experimental conditions (see Figure S1A). The expression of both genes was relatively high in the mature nodule at 21 dpi.
According to LCM-RNA-seq data obtained by Roux et al., [30] the MtCLE34 gene is mostly expressed in the interzone and the fixation zone of the mature nodule, whereas MtCLE35 is expressed in the infection zone as well as in the meristematic zones (see Figure S1B). In addition to MtCLE34, the expression of another nodulation-related CLE gene, MtCLE13, was also observed in the interzone and the fixation zone (Figure S1B). We also compared the dynamics of the MtCLE34 expression with the expression levels of other nodulation-related MtCLE genes using publicly available transcriptomic data obtained by Boschiero et al. [30]. In contrast to the MtCLE12 and MtCLE13 genes, which demonstrated nodule-specific expression patterns, the MtCLE34 and MtCLE35 genes were also expressed in inoculated roots at relatively high levels suggesting that these two nitrate-regulated genes could have broader roles in root system development (Figure S1C). In this set of transcriptomic data, the MtCLE34 gene demonstrated the expression dynamics with a peak at 10 dpi, similar to one of the MtCLE13 gene; however, at 4 dpi, MtCLE34 expression is lower than that of the MtCLE13 gene, confirming a delayed activation of MtCLE34 in comparison to other nodulation-related CLEs.
To sum up, the expression of both genes, MtCLE34 and MtCLE35, was induced in response to nitrate and rhizobial inoculation; however, MtCLE34 is induced later during inoculation and shows a distinct expression pattern in the mature nodule according to publicly available LCM-RNA-seq data.

3.2. Characterization of the MtCLE34 Gene in the A17 and R108 Lines

In the nucleotide sequences present in the Medicago truncatula A17 r5.0 genome [31] obtained for the Jemalong A17 line, there is a premature stop codon located in the variable region of the MtCLE34 gene upstream of the CLE domain coding region (TAG, 48–50 bp of the coding DNA sequence) (Figure 2). We checked if this stop codon is also present in other Medicago accessions. First, we analyzed the sequence of the MtCLE34 gene in the R108 line (R108 v. 1.0, GenBank assembly accession: GCA_002024945.1, https://www.ncbi.nlm.nih.gov/assembly/GCA_002024945.1/, http://ugene.net/ru/, accessed on 1 January 2022). We found that in contrast to A17, R108 does not have the stop codon in the corresponding position of the MtCLE34 gene. Sequence analysis of the MtCLE34 gene amplified from DNA of the A17 and R108 lines confirmed that R108 has the CAG codon (coding for Gln50) at the 148–150th bp positions instead of the stop codon TAG present in A17 (see Figure S2). Thus, the MtCLE34 gene of the R108 line does not have nonsense mutation and, therefore, should have a functional protein product.

3.3. Natural Variation in the MtCLE34 Gene in M. truncatula Accessions from Medicago Hapmap Project

Next, we analyzed the nucleotide sequences of the MtCLE34 gene in Medicago accessions available from the HAPMAP2 Medicago Analysis Portal https://medicagohapmap2.org/ (accessed on 1 January 2022). This database includes the genomes of 23 inbred M. truncatula accessions, as well as SNP data for 226 accession lines [19]. We searched for nucleotide sequences of MtCLE34 using the BLAST algorithm available at https://medicagohapmap2.org/blast, http://ugene.net/ru/ (accessed on 1 January 2022) in the genomes of 23 accessions. The alignment of the corresponding amino acid sequences is shown in Figure 3. Among 23 accessions, only two lines, A17 (HM341) and HM058, contain the premature stop codon at the 148–150 bp positions, whereas all the other lines have the CAG codon coding for Gln50. Moreover, there is natural variation of amino acids at position 26 of the MtCLE34 protein: most of the Medicago accessions have Leu at this position, whereas the R108 and HM017 lines have Val, and HM056 has a Phe residue (see Figure 3).
We have also checked SNP data for 316 accession lines available from Stanton-Geddes et al., 2013 [19]. In addition to the A17 (HM341/HM101) and HM058 lines, two more lines, HM256 and HM038, bear the premature stop codon in the MtCLE34 gene (chr2:39237092). However, sequencing of these two lines has overall low depth of coverage in this position (three reads for HM256 and only one read for HM038). In addition to this, HM058 accession seems to be heterozygous for this SNP (chr2:39237092) since it contains both TAG (4 out of 6 reads) and CAG (2 out of 6 reads) alleles according to variant call data (see Table 1).
Therefore, only 4 out of 316 accessions have the nonsense mutation in the MtCLE34 gene. Did this mutation originate once in the course of evolution of M. truncatula or due to independent evolutionary events in different accessions? We constructed a phylogenetic tree based on SNP data for Chromosome 2, where the MtCLE34 gene is located. According to this tree, the A17 (HM341/HM101) and HM256 lines are very close to each other and are clustered together, suggesting that the nonsense mutation in the MtCLE34 gene has a common origin in these two lines. The HM038 line belongs to the same subgroup as the A17 (HM341/HM101) and HM256 lines, whereas HM058 is from a different subgroup (see Figure S3). The close relation of the A17 and HM256 lines is consistent with the fact that both these accessions were derived from Australian ecotypes (https://medicagohapmap2.org/germplasm, accessed on 3 January 2022), whereas the HM038 line originated from Portugal and the HM058 line is from Spain. Taking into account that HM058 is a probable heterozygote combining two alleles of the MtCLE34 gene, a mutant and a functional one, and that the sequencing of the HM038 accession had very low depth of coverage in the MtCLE34 region, we could not make any conclusion whether the nonsense mutation in the MtCLE34 gene in A17 and HM256 lines arose independently from the HM038 and HM058 lines or not.

3.4. Overexpression of the MtCLE34 Gene from the R108 Line Does Not Inhibit Nodulation

In order to investigate if the MtCLE34 gene has the ability to inhibit nodulation as does its close homologues from other legumes, we have constructed a vector for its overexpression, which contains CDS of MtCLE34 from the R108 line under the 35S promoter (35S::MtCLE34) and the GFP-overexpressing cassette for the selection of transgenic roots. In control vector, the β-glucuronidase (GUS) gene under the 35S promoter (35S::GUS) was used. We have analyzed the effect of MtCLE34 overexpression in transgenic roots on nodule number in both A17 (Figure 4) and R108 (Figure S4) lines. The overexpression of the MtCLE34 gene in transgenic roots was confirmed by RT-qPCR analysis. We have not observed a statistically significant reduction in nodule number on MtCLE34-overexpressing roots in comparison to GUS-overexpressing control roots in both lines (Figure 4 and Figure S4). Under the same experimental conditions, the overexpression of the MtCLE35 gene inhibited nodulation [9]. Therefore, the MtCLE34 gene from the R108 line does not suppress nodulation.

4. Discussion

Here, we showed that the MtCLE34 gene carries a premature stop-codon in several M. truncatula accessions, including the A17 line, which is used as the reference genotype for sequencing and as a model line in many laboratories. In addition to A17, the premature stop codon was also found in three other accessions, including the HM256 line, which is closely related to A17. The majority of other accessions available from the HAPMAP2 Medicago project (https://medicagohapmap2.org/, accessed on 10 January 2022), and the model R108 line in particular, do not have nonsense mutations in the MtCLE34 gene.
MtCLE34 is closely related to other nodulation-related CLEs in legume. The closest homologues of MtCLE34 are nitrate-regulated GmNIC1 and GmNIC2 genes from soybean. Similar to the expression patterns of the GmNIC1 and GmNIC2 genes, the expression of MtCLE34 is also upregulated by nitrate. The closest homologues of these genes include the LjCLE40 gene upregulated by nitrate in L. japonicus [7,29], and the PsNIC1-like gene (PsCam041632) from pea [13]. Collectively, these genes form a group of NIC-like CLEs. The expression of MtCLE34 is also induced in response to rhizobial inoculation. In our experiment it was activated a little later in comparison to another nodulation-related gene MtCLE35, and the same results were obtained by Mens et al. [10] and in the transcriptomic study by Boschiero et al. [30]. The expression of the PsNIC1-like gene was also induced upon nodulation: it was upregulated at 14 dpi, whereas the induction of another nodulation-related gene, PsCLE13, was visible at 7 dpi [13]. Interestingly, Reid et al. found that GmNIC1 was only slightly, though not significantly, induced at 48 h after rhizobial inoculation and its expression was not detectable until later; however, in this study the expression dynamic of the GmNIC1 gene was studied only at early stages of nodulation (until 3 dpi) [12]. In more recent study the induction of GmNIC1 was found at 7 dpi [32]. Finally, the LjCLE40 gene also demonstrated a more delayed activation in response to rhizobial inoculation in comparison to the nodulation-related LjCLE-RS1-3 genes [7]. Therefore, the NIC-like genes from different legumes are activated in response to the nitrate treatment and after rhizobial inoculation, but show a delayed activation in response to rhizobial inoculation in comparison to other nodulation-related CLE genes. Further functional studies focusing on the role of NIC-like genes at the later stages of nodulation are required to elucidate the possible roles of these genes in nodule development and functioning.
The protein products of the NIC-like CLE genes share homology not only within the CLE domain but also within the region including a putative cleavage site (K-(X)-ESRS -motif), and the region within the variable domain (KASFAK-motif). In addition to this, there are several Lys residues within the variable domain that are conserved in the NIC-like CLE proteins (see Figure 5). Within the CLE domain, the NIC-like CLE proteins demonstrate high sequence similarity with other nodulation-related CLEs. In particular, the CLE domains of MtCLE34 and MtCLE35 differ in only two amino acids, in the 5th and 10th positions of the CLE domain. The CLE domains of GmNIC1 and GmNIC2 also differ from that of MtCLE35 in two residues: in the 9th and 10th positions (see Figure 5). MtCLE34 and NIC-like proteins from pea and L. japonicus have identical CLE domains. However, in contrast to soybean GmNIC1 and GmNIC2, they have Gln in the 5th position of their CLE domain, whereas soybean GmNICs and the majority of all other nodulation-related CLEs have Gly in this position.
All the NIC-like CLE proteins, including MtCLE34, lack C-terminal extension at the very end of the CLE premature proteins, which is present in all the other nodulation-related CLE peptides except MtCLE12 (see Figure 5) [5]. This C-terminal extension domain was suggested to protect the CLE propeptides from the protease enzymes present in the xylem sap, and, therefore, it is thought to be essential for the function of systemically-acting CLE peptides [5]. Indeed, all the nodulation-related CLE peptides (except MtCLE12) which systemically suppress nodulation and, therefore, are supposed to move through the xylem to the shoot, have the C-terminal extension domain. The K-(X)-ESRS-motif, conservative among the NIC-like CLE proteins, includes a putative cleavage site (ES-RS) predicted by SignalP-5.0 [28]. Interestingly, the majority of all other nodulation-related CLEs (which systemically suppress nodulation) have a conservative TLQAR motif in this region [5,6], which also includes a predicted cleavage site (QA-R(X)). Such difference in conservative sequences within the putative cleavage sites between the NIC-like CLE proteins and other nodulation-related CLEs (which are capable of systemic inhibition of nodulation), suggests that these two groups of CLE proteins may utilize different mechanisms for their proteolytic processing. Moreover, at the position 26 of the MtCLE34 protein from R108 (marked with an arrow in Figure 5), which is adjacent to the predicted cleavage site, there is a Val residue, whereas the majority of the MtCLE34 premature proteins from other Medicago accessions and all other nodulation-related CLE proteins have a conservative Leu residue in this position. It is of interest to determine whether this amino acid substitution is crucial for MtCLE34 processing and functioning.
We confirmed that the expression of MtCLE34 is induced in response to nitrate and rhizobial inoculation as it was previously found for its close homologue, the MtCLE35 gene [9,10,11]. However, MtCLE34 is induced later during inoculation and shows a distinct expression pattern in the mature nodule according to publicly available LCM-RNA-seq data in comparison to the MtCLE35 gene. This suggests that the functions of these two nitrate-induced genes might have diverged during evolution.
We found that overexpression of the MtCLE34 gene from the R108 line (without the premature stop codon) does not inhibit nodulation, suggesting that MtCLE34 is not involved in the control of nodule number in the R108 line. Previously, using the same experimental approach we showed that the MtCLE35 gene systemically suppressed nodulation [9]. Among the NIC-like CLE genes, only GmNIC1 has been studied previously using an overexpression-based approach [12]. It was found that GmNIC1 caused an approximate 50% reduction in nodule number in soybean, suggesting that it is capable of nodulation inhibition, although such reduction was not as strong as that observed for the GmRIC1 and GmRIC2 genes, which almost completely blocked nodulation when overexpressed [12]. Moreover, GmNIC1 reduced nodulation locally, but not in a systemic way as it was observed for GmRIC1 and GmRIC2 and other nodulation-suppressing CLEs from other legumes [12,32]. For the LjCLE40 gene, which also belongs to the NIC-like CLE group, the effect of its overexpression on nodulation has not been studied yet [7]. It is intriguing to study if the NIC-like CLE genes from other legumes, including L. japonicus and pea, have the ability to suppress nodulation.
Therefore, our findings suggest that the NIC-like gene MtCLE34 is not essential for the viability of M. truncatula since natural nonsense mutation occurred in this gene during the evolution of this legume species which has not been accompanied by the obvious changes in nodulation phenotype or its nitrate responsiveness. The MtCLE34 gene from the R108 line, lacking the premature stop codon and therefore encoding a functional product, did not show the ability to reduce nodule number in our study. One cannot exclude the possibility that MtCLE34 could function at later stages of nodulation by fine-tuning nodule functioning and nitrogen fixation in response to nitrate availability. Future studies should evaluate the possible roles of the NIC-like genes at later stages of nodulation. Moreover, it is important to understand which regions and which amino acid substitutions in the MtCLE34 protein made it unable to reduce nodule number in comparison to other known nodulation-related CLEs. This could be accomplished in further studies by using domain swap technique and by producing mutant versions of the MtCLE34 protein.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy12040842/s1, Figures S1–S4. Figure S1. (A) The expression levels of the MtCLE34 and MtCLE35 genes at different days after inoculation (dpi) in comparison to the non-inoculated control roots (cont). Results are mean ± SEM of three technical repeats of one biological repeat, representative for three independent experiments. (B) Expression of the MtCLE34, MtCLE35, MtCLE13 and MtCLE12 genes in different nodule zones according to LCM-RNA-seq data, publicly available on the INRA website (https://iant.toulouse.inra.fr/symbimics/, accessed on 10 January 2022). Meristematic zone (FI), distal and proximal infection zone (FIId and FIIp), inter-zone (IZ) and fixation zone (ZIII). Genes IDs according to Mt20120830-LIPM (Roux et al., 2014): Mt0016_10620 (MtCLE34), Mt0016_10619 (MtCLE35), Mt0003_01264 (MtCLE13), Mt0003_01265 (MtCLE12). (C) The heat map diagrams illustrating expression levels of the MtCLE34, MtCLE35, MtCLE13 and MtCLE12 genes in different organs drawn according to FPKM values available from The Medicago truncatula Small Secreted Peptide Database https://mtsspdb.zhaolab.org/database/, [30]. (D) Expression of the MtCLE34, MtCLE35, MtCLE13 and MtCLE12 genes at 0, 4, 10, 14 and 28 dpi according to SSP Gene Expression Atlas (SSP-GEA) available in The Medicago truncatula Small Secreted Peptide Database https://mtsspdb.zhaolab.org/database/ (accessed on 10 January 2022), [30]. Figure S2. Alignment of coding DNA sequences of the MtCLE34 gene from the A17 and R108 lines. Figure S3. Phylogenetic tree of 316 M. truncatula accessions constructed based on SNP data for Chromosome 2 available from Stanton-Geddes et al., 2013 [19]. Highlighted with a red color are the lines which carry nonsense mutation in the MtCLE34 gene (HM101 (=A17), HM256, HM038, HM058). Figure S4. Number of nodules on transgenic roots of the R108 line carrying the 35S:GUS (control) or 35S:MtCLE34 construct in four weeks after rhizobial inoculation.

Author Contributions

Conceptualization, M.L.; investigation, M.L.; validation, K.D.; writing—original draft preparation, M.L.; writing—review and editing, M.L. and L.L.; supervision, M.L.; funding acquisition, L.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Ministry of Science and Higher Education of the Russian Federation, in accordance with agreement № 075-15-2020-922 date 16.11.2020 on providing a grant in the form of subsidies from the Federal budget of Russian Federation for state support of a World-class Scientific Center “Agrotechnologies for the Future”.

Acknowledgments

The authors thank the Research Resource Center for Molecular and Cell Technologies of Saint-Petersburg State University for the equipment used in this study. The authors thank Alexander Zhernakov (ARRIAM, Russia) for the help with SNP data analysis. We also thank our colleagues Irina Dodueva and Varvara Tvorogova (SPSU, Russia) for the discussion of the results.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Okamoto, S.; Tabata, R.; Matsubayashi, Y. Long-Distance Peptide Signaling Essential for Nutrient Homeostasis in Plants. Curr. Opin. Plant Biol. 2016, 34, 35–40. [Google Scholar] [CrossRef] [PubMed]
  2. Oelkers, K.; Goffard, N.; Weiller, G.F.; Gresshoff, P.M.; Mathesius, U.; Frickey, T. Bioinformatic Analysis of the CLE Signaling Peptide Family. BMC Plant Biol. 2008, 8, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Ohyama, K.; Shinohara, H.; Ogawa-Ohnishi, M.; Matsubayashi, Y. A Glycopeptide Regulating Stem Cell Fate in Arabidopsis Thaliana. Nat. Chem. Biol. 2009, 5, 578–580. [Google Scholar] [CrossRef] [PubMed]
  4. Imin, N.; Patel, N.; Corcilius, L.; Payne, R.J.; Djordjevic, M.A. CLE Peptide Tri-Arabinosylation and Peptide Domain Sequence Composition Are Essential for SUNN-Dependent Autoregulation of Nodulation in Medicago Truncatula. New Phytol. 2018, 218, 73–80. [Google Scholar] [CrossRef] [Green Version]
  5. Hastwell, A.H.; Gresshoff, P.M.; Ferguson, B.J. The Structure and Activity of Nodulation-Suppressing CLE Peptide Hormones of Legumes. Funct. Plant Biol. 2015, 42, 229–238. [Google Scholar] [CrossRef] [Green Version]
  6. Okamoto, S.; Ohnishi, E.; Sato, S.; Takahashi, H.; Nakazono, M.; Tabata, S.; Kawaguchi, M. Nod Factor/Nitrate-Induced CLE Genes That Drive HAR1-Mediated Systemic Regulation of Nodulation. Plant Cell Physiol. 2009, 50, 67–77. [Google Scholar] [CrossRef] [Green Version]
  7. Nishida, H.; Handa, Y.; Tanaka, S.; Suzaki, T.; Kawaguchi, M. Expression of the CLE-RS3 Gene Suppresses Root Nodulation in Lotus Japonicus. J. Plant Res. 2016, 129, 909–919. [Google Scholar] [CrossRef] [Green Version]
  8. Mortier, V.; Den Herder, G.; Whitford, R.; Van de Velde, W.; Rombauts, S.; D’haeseleer, K.; Holsters, M.; Goormachtig, S. CLE Peptides Control Medicago Truncatula Nodulation Locally and Systemically. Plant Physiol. 2010, 153, 222–237. [Google Scholar] [CrossRef] [Green Version]
  9. Lebedeva, M.; Azarakhsh, M.; Yashenkova, Y.; Lutova, L. Nitrate-Induced CLE Peptide Systemically Inhibits Nodulation in Medicago Truncatula. Plants 2020, 9, 1456. [Google Scholar] [CrossRef]
  10. Mens, C.; Hastwell, A.H.; Su, H.; Gresshoff, P.M.; Mathesius, U.; Ferguson, B.J. Characterisation of Medicago Truncatula CLE34 and CLE35 in Nitrate and Rhizobia Regulation of Nodulation. New Phytol. 2021, 229, 2525–2534. [Google Scholar] [CrossRef]
  11. Moreau, C.; Gautrat, P.; Frugier, F. Nitrate-Induced CLE35 Signaling Peptides Inhibit Nodulation through the SUNN Receptor and MiR2111 Repression. Plant Physiol. 2021, 185, 1216–1228. [Google Scholar] [CrossRef]
  12. Reid, D.E.; Ferguson, B.J.; Gresshoff, P.M. Inoculation-and Nitrate-Induced CLE Peptides of Soybean Control NARK-Dependent Nodule Formation. Mol. Plant Microbe Interact. 2011, 24, 606–618. [Google Scholar] [CrossRef] [Green Version]
  13. Samorodova, A.P.; Tvorogova, V.E.; Tkachenko, A.A.; Potsenkovskaya, E.A.; Lebedeva, М.А.; Tikhonovich, I.A.; Lutova, L.А. Agrobacterial Tumors Interfere with Nodulation and Demonstrate the Expression of Nodulation-Induced CLE Genes in Pea. J. Plant Physiol. 2018, 221, 94–100. [Google Scholar] [CrossRef]
  14. Ferguson, B.J.; Li, D.; Hastwell, A.H.; Reid, D.E.; Li, Y.; Jackson, S.A.; Gresshoff, P.M. The Soybean (Glycine max) Nodulation-Suppressive CLE Peptide, GmRIC1, Functions Interspecifically in Common White Bean (Phaseolus vulgaris), but Not in a Supernodulating Line Mutated in the Receptor PvNARK. Plant Biotechnol. J. 2014, 12, 1085–1097. [Google Scholar] [CrossRef]
  15. Okamoto, S.; Shinohara, H.; Mori, T.; Matsubayashi, Y.; Kawaguchi, M. Root-Derived CLE Glycopeptides Control Nodulation by Direct Binding to HAR1 Receptor Kinase. Nat. Commun. 2013, 4, 2191. [Google Scholar] [CrossRef]
  16. Soyano, T.; Hirakawa, H.; Sato, S.; Hayashi, M.; Kawaguchi, M. NODULE INCEPTION Creates a Long-Distance Negative Feedback Loop Involved in Homeostatic Regulation of Nodule Organ Production. Proc. Natl. Acad. Sci. USA 2014, 111, 14607–14612. [Google Scholar] [CrossRef] [Green Version]
  17. Laffont, C.; Ivanovici, A.; Gautrat, P.; Brault, M.; Djordjevic, M.A.; Frugier, F. The NIN Transcription Factor Coordinates CEP and CLE Signaling Peptides That Regulate Nodulation Antagonistically. Nat. Commun. 2020, 11, 3167. [Google Scholar] [CrossRef]
  18. Nishida, H.; Tanaka, S.; Handa, Y.; Ito, M.; Sakamoto, Y.; Matsunaga, S.; Betsuyaku, S.; Miura, K.; Soyano, T.; Kawaguchi, M.; et al. A NIN-LIKE PROTEIN Mediates Nitrate-Induced Control of Root Nodule Symbiosis in Lotus Japonicus. Nat. Commun. 2018, 9, 499. [Google Scholar] [CrossRef]
  19. Stanton-Geddes, J.; Paape, T.; Epstein, B.; Briskine, R.; Yoder, J.; Mudge, J.; Bharti, A.K.; Farmer, A.D.; Zhou, P.; Denny, R.; et al. Candidate Genes and Genetic Architecture of Symbiotic and Agronomic Traits Revealed by Whole-Genome, Sequence-Based Association Genetics in Medicago Truncatula. PLoS ONE 2013, 8, e65688. [Google Scholar] [CrossRef] [Green Version]
  20. Fahraeus, G. The Infection of Clover Root Hairs by Nodule Bacteria Studied by a Simple Glass Slide Technique. J. Gen. Microbiol. 1957, 16, 374–381. [Google Scholar] [CrossRef] [Green Version]
  21. Azarakhsh, M.; Kirienko, A.; Zhukov, V.; Lebedeva, M.; Dolgikh, E.; Lutova, L. KNOTTED1-LIKE HOMEOBOX 3: A New Regulator of Symbiotic Nodule Development. J. Exp. Bot. 2015, 66, 7181–7195. [Google Scholar] [CrossRef] [Green Version]
  22. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  23. Schindelin, J.; Rueden, C.T.; Hiner, M.C.; Eliceiri, K.W. The ImageJ Ecosystem: An Open Platform for Biomedical Image Analysis. Mol. Reprod. Dev. 2015, 82, 518–529. [Google Scholar] [CrossRef] [Green Version]
  24. Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve Years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [Google Scholar] [CrossRef]
  25. Bradbury, P.J.; Zhang, Z.; Kroon, D.E.; Casstevens, T.M.; Ramdoss, Y.; Buckler, E.S. TASSEL: Software for Association Mapping of Complex Traits in Diverse Samples. Bioinformatics 2007, 23, 2633–2635. [Google Scholar] [CrossRef]
  26. Letunic, I.; Bork, P. Interactive Tree Of Life (ITOL) v5: An Online Tool for Phylogenetic Tree Display and Annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
  27. Okonechnikov, K.; Golosova, O.; Fursov, M. UGENE team Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [Green Version]
  28. Almagro Armenteros, J.J.; Tsirigos, K.D.; Sønderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 5.0 Improves Signal Peptide Predictions Using Deep Neural Networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef]
  29. Hastwell, A.H.; de Bang, T.C.; Gresshoff, P.M.; Ferguson, B.J. CLE Peptide-Encoding Gene Families in Medicago Truncatula and Lotus Japonicus, Compared with Those of Soybean, Common Bean and Arabidopsis. Sci. Rep. 2017, 7, 9384. [Google Scholar] [CrossRef] [PubMed]
  30. Boschiero, C.; Dai, X.; Lundquist, P.K.; Roy, S.; Christian de Bang, T.; Zhang, S.; Zhuang, Z.; Torres-Jerez, I.; Udvardi, M.K.; Scheible, W.-R.; et al. MtSSPdb: The Medicago Truncatula Small Secreted Peptide Database. Plant Physiol. 2020, 183, 399–413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Pecrix, Y.; Staton, S.E.; Sallet, E.; Lelandais-Brière, C.; Moreau, S.; Carrère, S.; Blein, T.; Jardinaud, M.-F.; Latrasse, D.; Zouine, M.; et al. Whole-Genome Landscape of Medicago Truncatula Symbiotic Genes. Nat. Plants 2018, 4, 1017–1025. [Google Scholar] [CrossRef] [PubMed]
  32. Lim, C.W.; Lee, Y.W.; Lee, S.C.; Hwang, C.H. Nitrate Inhibits Soybean Nodulation by Regulating Expression of CLE Genes. Plant Sci. 2014, 229, 1–9. [Google Scholar] [CrossRef] [PubMed]
Agronomy 12 00842 g001 550
Figure 1. (A) The expression levels of the MtCLE34 gene at different timepoints after rhizobial inoculation (days post inoculation, dpi) in comparison to the non-inoculated control roots (cont) in the A17 line. Results are mean ± standard error of the mean (SEM) of three technical repeats of one biological repeat, representative for three independent experiments. (B) The expression levels of MtCLE34 in response to nitrate treatment (10 mM KNO3) in the A17 line. *** indicates statistically significant differences in MtCLE34 expression compared with control (p < 0.001).
Figure 1. (A) The expression levels of the MtCLE34 gene at different timepoints after rhizobial inoculation (days post inoculation, dpi) in comparison to the non-inoculated control roots (cont) in the A17 line. Results are mean ± standard error of the mean (SEM) of three technical repeats of one biological repeat, representative for three independent experiments. (B) The expression levels of MtCLE34 in response to nitrate treatment (10 mM KNO3) in the A17 line. *** indicates statistically significant differences in MtCLE34 expression compared with control (p < 0.001).
Agronomy 12 00842 g001
Agronomy 12 00842 g002 550
Figure 2. The sequence of the MtCLE34 gene in Jemalong A17. Stop codon is marked with a red box. CLE domain-coding region is marked with a yellow rectangle.
Figure 2. The sequence of the MtCLE34 gene in Jemalong A17. Stop codon is marked with a red box. CLE domain-coding region is marked with a yellow rectangle.
Agronomy 12 00842 g002
Agronomy 12 00842 g003 550
Figure 3. The alignment of amino acid sequences of the MtCLE34 protein product from 23 M. truncatula accessions from HAPMAP2 Medicago database. The position of the stop codon found in the A17 and HM058 lines is marked with a red arrow. Asterisk marks variable position at the 26th amino acid residue.
Figure 3. The alignment of amino acid sequences of the MtCLE34 protein product from 23 M. truncatula accessions from HAPMAP2 Medicago database. The position of the stop codon found in the A17 and HM058 lines is marked with a red arrow. Asterisk marks variable position at the 26th amino acid residue.
Agronomy 12 00842 g003
Agronomy 12 00842 g004 550
Figure 4. Overexpression of the MtCLE34 genes does not affect nodule number. (A) The expression level of the MtCLE34 gene in GFP-positive transgenic roots transformed with the 35S::GUS (GUS_OE, control) or 35S::MtCLE34 construct. *** indicate statistically significant differences p < 0.001. (B) Number of nodules on transgenic roots of the A17 line carrying the 35S:GUS (control) or 35S:MtCLE34 construct in four weeks after rhizobial inoculation. (C) Symbiotic nodules on GFP-positive transgenic roots carrying the 35S:GUS (control) or 35S:MtCLE34 construct. Bars = 1000 µm.
Figure 4. Overexpression of the MtCLE34 genes does not affect nodule number. (A) The expression level of the MtCLE34 gene in GFP-positive transgenic roots transformed with the 35S::GUS (GUS_OE, control) or 35S::MtCLE34 construct. *** indicate statistically significant differences p < 0.001. (B) Number of nodules on transgenic roots of the A17 line carrying the 35S:GUS (control) or 35S:MtCLE34 construct in four weeks after rhizobial inoculation. (C) Symbiotic nodules on GFP-positive transgenic roots carrying the 35S:GUS (control) or 35S:MtCLE34 construct. Bars = 1000 µm.
Agronomy 12 00842 g004
Agronomy 12 00842 g005 550
Figure 5. The alignment of amino acid sequences of nodulation-related CLE proteins from M.truncatula, L.japonicus, and G.max. PsCam041632 is included in the alignment as the closest homolog of MtCLE34 in pea. The group of NIC-like CLEs are enclosed by a box. N-terminal signal peptide is marked with a purple box, CLE domain is marked with a red box. Putative cleavage site is underlined and is shown with scissors symbol. Signal peptide and putative cleavage site position were determined using SignalP-5.0 [28]. Regions with sequence similarity among NIC-like CLEs are underlined. Lys residues that are conservative in the NIC-like CLE proteins are marked with asterisks. Arrow indicates non-conservative position in the MtCLE34 protein from the R108 line.
Figure 5. The alignment of amino acid sequences of nodulation-related CLE proteins from M.truncatula, L.japonicus, and G.max. PsCam041632 is included in the alignment as the closest homolog of MtCLE34 in pea. The group of NIC-like CLEs are enclosed by a box. N-terminal signal peptide is marked with a purple box, CLE domain is marked with a red box. Putative cleavage site is underlined and is shown with scissors symbol. Signal peptide and putative cleavage site position were determined using SignalP-5.0 [28]. Regions with sequence similarity among NIC-like CLEs are underlined. Lys residues that are conservative in the NIC-like CLE proteins are marked with asterisks. Arrow indicates non-conservative position in the MtCLE34 protein from the R108 line.
Agronomy 12 00842 g005
Table
Table 1. M. truncatula accessions bearing the premature stop codon in the MtCLE34 gene and the depth of coverage of SNP.
Table 1. M. truncatula accessions bearing the premature stop codon in the MtCLE34 gene and the depth of coverage of SNP.
AccessionDepth of Coverage
(Allele Depth: TAG/CAG)
SNP chr2:39237092
HM341/HM101 (=A17)26 (26/0)
HM2563 (3/0)
HM0381 (1/0)
HM0586 (4/2)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lebedeva, M.; Dvornikova, K.; Lutova, L. Nitrate-Induced MtCLE34 Gene Lacks the Ability to Reduce Symbiotic Nodule Number and Carries Nonsense Mutation in a Few Accessions of Medicago truncatula. Agronomy 2022, 12, 842. https://doi.org/10.3390/agronomy12040842

AMA Style

Lebedeva M, Dvornikova K, Lutova L. Nitrate-Induced MtCLE34 Gene Lacks the Ability to Reduce Symbiotic Nodule Number and Carries Nonsense Mutation in a Few Accessions of Medicago truncatula. Agronomy. 2022; 12(4):842. https://doi.org/10.3390/agronomy12040842

Chicago/Turabian Style

Lebedeva, Maria, Kristina Dvornikova, and Lyudmila Lutova. 2022. "Nitrate-Induced MtCLE34 Gene Lacks the Ability to Reduce Symbiotic Nodule Number and Carries Nonsense Mutation in a Few Accessions of Medicago truncatula" Agronomy 12, no. 4: 842. https://doi.org/10.3390/agronomy12040842

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop