Effect of Rice-Straw Biochar Application on the Acquisition of Rhizosphere Phosphorus in Acidified Paddy Soil

Abstract

A serious acidification trend currently affects paddy soil and soil phosphorus (P) availability has declined in rice production. This study investigated the effect of rice-straw biochar on P availability and the adaptability of rice roots in acidified soil. Rice was grown in rhizoboxes, allowing for the precise sampling of rhizosphere and bulk soil for the sequential extraction of P fractions. Biochar may provide a liming effect and strong nutrient adsorption, leading to soil improvement. The results confirmed that biochar application significantly improved plant growth and P accumulation in shoots by 29% and 75%, respectively. However, the application of washed biochar and equivalent lime only increased shoot biomass and P accumulation by 13.4% and 11.2%, and by 42% and 38%, respectively. Compared with the control, applying biochar increased the plant-available P component contents in rhizosphere and bulk soil. Biochar affected the chemical balance among the different P fractions, increased aluminum-bound phosphate (Al-P) pool, calcium-bound phosphate (Ca-P) pool and decreased the occluded phosphate pool in acidic paddy soil. Biochar amendment significantly improved root growth of and increased the citrate exudation from roots under low P supply, accompanied by the enhanced expression of the anion-transporter-related OsFRDL4 gene and the OsPT1 phosphate transporter. The results showed that biochar application in degraded acidic soils could improve rice potential for P acquisition to increase available P component and maintain high citrate exudation.

1. Introduction

Acid deposition has posed serious challenges to agricultural sustainability in China over the past few decades [1]. Soil acidified slowly in natural conditions, which was mainly through the weathering of minerals and rainfall that resulted in the loss of basic cations. The acidification of soil may be accelerated by high levels of nitrogen fertilizer application to soil, atmospheric acid deposition and industrial climatic conditions [2]. When paddy soil pH is <5.0, the availability of phosphorus (P) decreases and rice yield drops sharply. Soil P availability declined due, primarily to factors, such as low pH, high level of active iron (Fe) and aluminum (Al) in acid soils, and phosphate anions reacting with Fe and Al oxides to form insoluble phosphates in certain forms, such as iron-bound phosphate (Fe-P), aluminum-bound phosphate (Al-P) and occluded-phosphate (O-P). Phosphate anion is precipitated by calcium (Ca) to form calcium-bound phosphate (Ca-P) in alkaline soils [3]. Pi components combined with Fe, Al and Ca are not easily used by plants. However, soil Al-P, Fe-P and some Ca-P can be converted into free phosphate, which provides an important P pool for plant growth [4]. The solubility of the gel film on the surface of O-P molecules is extremely low, resulting in insufficient utilization of O-P by plants.

Roots exhibit adaptive strategies under low P availability by changing root morphology and physiology. Changes in root morphology can promote root–soil contact, which is particularly significant in P acquisition from soils [5]. In addition, roots secreted organic acids and P-solubilizing enzymes and increased the expression of high-affinity P transporters in order to cope with P deficiency, as well as Al toxicity [6]. The root system of rice triggers the secretions of organic anions in response to P deficiency in acidic soils [7,8]. However, adequate research on the effects of this process on the acquisition of P is still lacking. The organic acid anions secreted by rice roots are mediated by transporters that are the part of the multidrug and toxic compound extrusion protein family. OsFRDL4 is capable of transporting citrate and was activated in the presence of Al³⁺ [9]. After mobilization at the rhizosphere, P is absorbed by roots as Pi (H₂PO₄⁻), which is regulated by membrane-spanning phosphate transporter proteins [10]. Pi anions across the membrane are driven by plasma membrane H⁺-ATPase by consuming ATP. High-affinity Pi transporters (the Pht1 family) are induced under phosphate deficiency, particularly in the roots [11].

Biochar is produced by the pyrolysis of biomass residue in anoxic and high-temperature environments, which was found to be a better soil improvement material than other amendments [12,13]. Rice-residue biochar has been reported to improve the P availability and P use efficiency of applied or reserve P to meet current P needs [14]. Biochar increases the available Pi component in the soil and maintains high soil P content for at least 2 years after application [15]. The positive effect of biochar on soil fertility is related to its high surface area and cation exchange capacity. These properties mean that biochar increases the water-holding capacity of soil and prevent N and P from being leached from soil [16,17]. Biochar changes the physicochemical properties of soil (such as the pH, porosity and redox state) and improves nutrient mobilization [18,19]. Biochar is alkaline, and it can improve soil fertility by maintaining or increasing soil pH. Biochar can be used as an alternative to lime to amend acidic soil. Meta-analyses have shown that the increase in productivity of biochar-amended acidified soil is mainly caused by the “liming effect” [20]. Increasing the soil pH can decrease Al bioavailability and the fixation of P by Fe and Al cations (Fe³⁺ and Al³⁺) [21,22]. The surface P adsorption and the adsorption rate of ferrihydrite were decreased in the presence of biochar [23]; however, the desorption performance was improved when the ferrihydrite was combined with biochar. Therefore, biochar can reduce the adsorption of P by metallic oxides and enhance the availability of P in acidic soils.

Previous studies have shown that biochar has significant indigenous effects on soil properties and crop yields [24]. However, few studies have analyzed the effect of common acidic soil amendments (biochar and P fertilization) on the adaptive response of rice at the rhizosphere level. The present study focused on (a) the effects of adding biochar on soil P fraction and (b) the subsequent effect of rhizosphere changes induced by the amendments on adaptive responses, such as the changes in citric acid exudation and the expression levels of related efflux transporters. In addition, this study examined the phosphate transporter-mediating effect of rice roots on Pi uptake.

2. Materials and Methods

2.1. Plant Culture and Experimental Design

Soil samples were collected from an acidic paddy field in Langya Town, Jinhua City, Zhejiang Province, China (N 29°00′17.37″, E 119°29′54.84″). Soil from 0 to 20 cm deep soil layer was collected. The basic chemical characteristics of acidified paddy soil were as follows: pH 4.87, organic matter 21.32 g kg⁻¹, total N 1.03 g kg⁻¹, Olsen-P 8.32 mg kg⁻¹ and available K 55.54 mg kg⁻¹.

Rice-straw biochar was prepared by baking rice-straw at 500 °C for 2 h in a muffle furnace with an anaerobic atmosphere [25,26]. The properties of biochar were as follows: pH 11.03, total carbon (C) 629 g kg⁻¹, total N 10.17 g kg⁻¹, total P 3.6 g kg⁻¹ and cation exchange capacity 26.4 cmol kg⁻¹. Acid-washed biochar was prepared by rinsing raw biochar with 0.1 M H₂SO₄ (analytical reagent) until the pH of washed biochar was the same as the pH of the acidic soil. This step was followed by thoroughly rinsing the biochar with deionized water. Applying acid-washed biochar to the soil decreased the liming effect. The treated biochar was dried at 80 °C before use.

The experiments were conducted at the experimental base of the China National Rice Research Institute in Fuyang District, China. Rice plants (Oryza sativa L., cv. Zhongzheyou 1) grown from seeds supplied by the Zhejiang Wuwangnong Seed Company were used in the experiments. The seeds were disinfected with 30% hydrogen peroxide for 15 min and then washed multiple times with distilled water. After soaking for 24 h, the seeds were incubated in an incubator at 37 °C for germination. The germinated seeds were placed in a nursery bed and the seedlings were transplanted into the root compartments of a rhizopot system. Two seedlings were planted in each pot.

The rhizopot system consisted of a 22 cm diameter soil column in a nylon mesh bag with 25 μm holes as described by Niu et al. [27]. The rice seedlings grew in the mesh bag, but the roots could not penetrate the mesh. The rhizopot system was irrigated daily to maintain approximately 2–3 cm water layer during the growth period. The experiment was carried out in a mesh chamber under natural conditions. Each treatment was performed four times.

P fertilizer (as KH₂PO₄) was applied at a rate of 80 mg kg⁻¹ P (high-P treatment) or was not added (low-P treatment). The high- and low-phosphate treatment soil samples were each subjected to four tests: using soil without biochar (the control treatment, CK); using soil amended with lime equivalent to a biochar application rate of 20 g kg⁻¹ (LM); using soil amended with biochar at an application rate of 20 g kg⁻¹ (BC); and using soil amended with washed biochar at an application rate of 20 g kg⁻¹ (WBC). The lime, biochar, washed biochar, fertilizer and soil were thoroughly mixed. Other elements were added at the following proportions: 200 mg kg⁻¹ N (as urea), 20 mg kg⁻¹ magnesium (Mg; as MgSO₄) and 50 mg kg⁻¹ Ca (as CaCl₂). The K level in the soil was modified to 250 mg kg⁻¹ by adding KCl.

The rice plants were harvested 35 days after transplanting (at the active tillering stage). The nylon mesh bag was removed from the rhizopot system after the harvest. The rhizosphere soil was sampled according to the procedure described by Niu et al. [27]. The soil adjacent to rice roots in the root bag was classed as the rhizosphere soil, and the bulk soil outside the root bag was classed as the non-rhizosphere soil.

2.2. Soil Analyses

Each rhizosphere or bulk soil sample was allowed to dry in air and then ground and passed through a 1 mm sieve. The available P (Olsen-P) in a soil sample was extracted with 0.5 M sodium bicarbonate (NaHCO₃). As described by Chang and Jackson, the soil P forms were separated using a four-phase extraction method [28]. The extraction method used was as follows: the soil was extracted with 0.5 M NH₄F at pH 8.2 to extract Al-P, 0.1 M NaOH to extract Fe-P, 0.3 M sodium citrate (Na₃C₆H₅O₇) and Na₂S₂O₄ to extract occluded P and 0.5 M H₂SO₄ to extract Ca-P. The extracted samples were determined with a colorimetric method using a wavelength of 880 nm [29]. All chemical reagents used in the experiment were of analytical purity. Exchangeable Al in the soil was extracted using 0.1 M barium chloride (BaCl₂). The concentration of Al in the extracted solution was determined by inductively coupled plasma optical emission spectroscopy (ICP-AES, OPTIMA8000, PerkinElmer, Waltham, MA, USA).

2.3. Plant Analyses

Shoot and root samples were collected when each seedling was harvested. Each plant was dried to a constant weight at 80 °C. The sample was placed in a crucible and ashed in the muffle furnace at 495 °C for 4 h. The ashed samples were dissolved by adding 5 mL of 6 M HCl, and then shaken well and allowed to stand for 12 h. The P concentration was analyzed at 440 nm by a spectrophotometer (Beckman DU-800, Brea, CA, USA) [30]. An image of each root sample was acquired using an Epson V700 photo scanner (Beijing, China). To acquire an image, a root sample was placed in a 20 cm × 15 cm root box containing water 5 cm deep. The images acquired were analyzed using WinRHIZO 5.0 software (Quebec, QC, Canada). The total root length and other parameters were determined for each sample. Each root sample was then dried and weighed.

2.4. Collecting Root Exudates and Measuring Organic Acids

Root exudates were collected using the method described by Neumann and Römheld [31]. A root system was removed from the rhizopot system and washed with deionized water four times. The root system was then transferred to a container containing an exudate collection solution (containing CaCl₂, H₃BO₃, KCl, and MgCl₂ at concentrations of 600, 5, 100, and 200 μM, respectively, at pH 5.6) and left for 2 h. The exudate solution was then transferred to a centrifuge tube, and 85% phosphoric acid was added. The solution was frozen in liquid N₂ and then stored at −20 °C. Later, the solution was thawed and passed through a 0.45 μm filter. The analysis of root exudates was conducted by high-performance liquid chromatography using an LC-10A instrument (Shimadzu, Kyoto, Japan). The mobile phase was 25 mM KH₂PO₄ at pH 2.25, and the flow rate was 1 mL min⁻¹ at 30 °C. The analyses were conducted using ultraviolet spectrophotometry at a wavelength of 214 nm.

2.5. Gene Expression Analysis by Real-Time Quantitative PCR (RT-qPCR)

Root samples to be used for RNA extraction were frozen quickly with liquid N₂ and stored in an ultra-low temperature freezer at −80 °C. The extraction of total RNA was conducted using an RNeasy^® Mini kit (Qiagen, Hilden, Germany) following the RNeasy^® Mini handbook. The degree to which the Pi transporters OsPT1, OsPT2 and OsPT6 and the OsFRDL4 genes were expressed in the roots was determined by qPCR. The primer pairs used for qPCR (AY569607.1 for OsPT1, AY569608 for OsPT2, AF536966.1 for OsPT6 and AB608020.1 for OsFRDL4) were selected from available cDNA sequences from the National Center for Biotechnology Information (NCBI). The primer pairs used to determine the expression of the specific genes that code for Pi and citrate transporters are listed in

Table 1. Candidate reference rice (Oryza sativa L.) genes and primers derived from RT-qPCR analysis.

Gene Name	GenBank Accession Number	Primer Sequence (5′-3′) (Forward/Reverse)
OsPT1	AY569607.1	5′tttcacgctgattctgatgg3′
		5′tcctcttgttcgcgtactcc3′
OsPT2	AY569608	5′cacctactactggcgcatga3′
		5′catgaactgccgtgagaaga3′
OsPT6	AF536966.1	5′cttcttcttcgccaacttcg3′
		5′ggtacaggaacccgaaggat3′
OsFRDL4	AB608020.1	5′gtcatcagcaccatccacag3′
		5′gcgacgagagaagaaccaag3′

. RT-qPCR was carried out using an ABI 7500 Sequence Detection System (Applied Biosystems, Waltham, MA, USA) and an SYBR^® Premix Ex Taq™ kit (Toyobo, Osaka, Japan). Rice actin gene NM 197297 was used as a housekeeping gene. PCR reactions were performed as described by Zhang et al. [32]. Each sample was analyzed four times and the data were analyzed as described by Pfaffl [33].

2.6. Statistics

The data were analyzed by performing one-way analyses of variance using a general linear model with SAS version 9.2 software (SAS Institute, Cary, NC, USA). Data are presented as means, with standard errors below. The least significant difference (LSD) multiple comparisons were performed at 5% significance level. Graphs were drawn using SigmaPlot 10.0 software.

3. Results

3.1. Soil Properties

Biochar or the equivalent lime markedly increased the pH (by about pH 0.3) of the bulk and rhizosphere soil, while washed biochar had little effect on soil pH, as shown in

Table 2. Effect of biochar and P supply on major soil constraints (pH, exchangeable Al and available P) in the rhizosphere and bulk soil.

		pH		Available P (mg kg−1)		Exchangeable Al (mg kg−1)
	Treatment	Rhizosphere	Bulk	Rhizosphere	Bulk	Rhizosphere	Bulk
	CK	4.18 ± 0.01 b	4.59 ± 0.01 bc	8.35 ± 0.17 c	8.43 ± 0.28 c	171 ± 5.88 a	118±11.36 a
−P	LM	4.34 ± 0.06 a	4.72 ± 0.03 a	8.98 ± 0.12 c	9.55 ± 0.03 b	92 ± 4.18 b	53 ± 6.18 b
	BC	4.38 ± 0.01 a	4.61 ± 0.02 b	11.86 ± 0.31 a	13.37 ± 0.37 a	80 ± 4.13 b	51 ± 2.82 b
	WB	4.16 ± 0.02 b	4.52 ± 0.01 c	10.58 ± 0.26 b	10.37 ± 0.06 b	168 ± 10.53 a	121 ± 4.05 a
	CK	4.29 ± 0.04 b	4.55 ± 0.04 b	27.54 ± 1.39 b	31.87 ± 0.42 b	156 ± 3.42 a	120 ± 5.68 a
+P	LM	4.60 ± 0.02 a	4.85 ± 0.01 a	28.22 ± 1.95 b	32.39 ± 1.71 b	59 ± 5.26 c	53 ± 5.59 b
	BC	4.58 ± 0.09 a	4.80 ± 0.11 a	33.49 ± 1.39 a	41.99 ± 2.25 a	84 ± 7.27 b	61 ± 7.04 b
	WB	4.27 ± 0.05 b	4.55 ± 0.01 b	33.49 ± 1.40 ab	36.17 ± 0.83 b	149 ± 7.62 a	124 ± 2.05 a

Note: Each value is the mean ± standard error of four replicates. Different letters indicate means that differ significantly (p < 0.05). The treatments were: CK: the control treatment; LM: lime equivalent to a biochar application rate of 20 g kg⁻¹; BC: biochar at an application rate of 20 g kg⁻¹; WBC: washed biochar at an application rate of 20 g kg⁻¹.

. Applying biochar or the equivalent lime markedly decreased the exchangeable Al content of the soil and decreased stress on the rice roots. In the low-P experiments, the content of available P was increased by 42% and 24% by applying biochar and washed biochar, respectively, and by 7.5% due to applying equivalent lime. In the high-P experiments, applying biochar and washed biochar increased the content of available P by 22% and 21%, respectively, and applying the equivalent lime increased the content of available P by only 2.5%.

Applying biochar or the equivalent lime caused the P components in the rhizosphere soil and bulk soil to change. Fe-P contributed 41% of the total P content in the control soil. The Fe-P contribution was only slightly affected by the application of amendments, and the Fe-P contents in the bulk soil and rhizosphere soil were not significantly different. The non-available P fraction (occluded P) contributed 48% of the total P content in the control rhizosphere soil, and applying biochar or lime decreased the contribution, as shown in

Table 3. Effect of biochar and P supply on phosphorus fractions relative share of total P in the rhizosphere and bulk soil.

		Al-P % of Total P		Fe-P % of Total P		Ca-P % of Total P		Occluded P % of Total P
	Treatment	Rhizosphere	Bulk	Rhizosphere	Bulk	Rhizosphere	Bulk	Rhizosphere	Bulk
	CK	3.50 ± 1.3	6.64 ± 4.3	42.79 ± 13.9	40.15 ± 11.6	5.01 ± 2.6	4.26 ± 1.6	48.69 ± 25.3	48.93 ± 22.9
−P	LM	4.71 ± 2.8	9.62 ± 3.3	47.43 ± 15.6	46.91 ± 22.1	7.13 ± 3.4	6.64 ± 3.1	40.71 ± 15.8	36.82 ± 25.5
	BC	7.71 ± 4.3	13.25 ± 6.4	43.57 ± 11.4	42.66 ± 21.9	7.27 ± 4.8	7.13 ± 2.6	41.43 ± 15.3	36.95 ± 14.8
	WB	7.27 ± 2.5	10.62 ± 4.1	47.58 ± 15.11	46.04 ± 1.5	6.74 ± 2.5	7.01 ± 1.8	38.39 ± 14.4	36.32 ± 16.1
	CK	7.72 ± 4.3	12.11 ± 5.1	49.05 ± 12.25	45.26 ± 18.9	5.02 ± 3.4	4.96 ± 1.2	38.21 ± 17.2	37.66 ± 16.9
+P	LM	7.95 ± 3.2	13.12 ± 7.9	49.27 ± 23.8	45.16 ± 22.7	6.34 ± 2.3	5.67 ± 3.1	36.42 ± 13.5	36.03 ± 13.6
	BC	9.56 ± 4.3	16.52 ± 7.5	47.28 ± 13.7	42.33 ± 13.8	6.99 ± 2.8	6.96 ± 2.5	36.14 ± 14.2	34.19 ± 12.6
	WB	7.85 ± 3.1	14.09 ± 4.1	48.65 ± 24.1	44.24 ± 17.1	6.06 ± 3.4	6.08 ± 2.3	37.43 ± 14.0	35.57 ± 10.8

Note: Each value is the mean ± standard error of four replicates. The treatments were: CK: the control treatment; LM: lime equivalent to a biochar application rate of 20 g kg⁻¹; BC: biochar at an application rate of 20 g kg⁻¹; WBC: washed biochar at an application rate of 20 g kg⁻¹.

. The addition of P had a stronger effect on the increase in Al-P fraction concentrations than biochar and equivalent liming amendments. The application of biochar alone induced a greater increase in the Al-P concentration than the application of equivalent lime and washed biochar alone (

Table 4. Effect of biochar and P supply on phosphorus fractions in the rhizosphere and bulk soil.

		Al-P (mg kg−1)		Fe-P (mg kg−1)		Ca-P (mg kg−1)		Occluded P (mg kg−1)
	Treatment	Rhizosphere	Bulk	Rhizosphere	Bulk	Rhizosphere	Bulk	Rhizosphere	Bulk
	CK	15 ± 0.61 b	29 ± 4.58 d	180 ± 8.89 a	176 ± 1.24 a	21 ± 1.36 b	18 ± 1.69 b	204 ± 12.01 a	215 ± 3.11 a
−P	LM	18 ± 1.21 b	36 ± 5.27 c	181 ± 0.30 a	175 ± 0.33 a	27 ± 0.74 a	24 ± 1.67 a	155 ± 3.09 b	137 ± 8.81 b
	BC	32 ± 2.47 a	53 ± 5.50 a	183 ± 1.57 a	170 ± 0.24 b	30 ± 2.41 a	28 ± 0.74 a	174 ± 7.28 ab	147 ± 6.05 b
	WB	28 ± 0.18 a	41 ± 4.39 b	184 ± 13.73 a	177 ± 0.07 a	26 ± 1.17 a	26 ± 1.17 a	149 ± 11.78 b	139 ± 8.51 b
	CK	35 ± 0.41 b	56 ± 3.73 b	224 ± 3.45 a	207 ± 1.59 a	23 ± 0.54 c	22 ± 0.30 c	175 ± 10.94 a	172 ± 12.03 a
+P	LM	36 ± 1.67 b	60 ± 0.37 b	223 ± 0.81 a	207 ± 1.83 a	28 ± 1.34 ab	26 ± 0.44 bc	165 ± 2.03 a	165 ± 1.43 a
	BC	44 ± 2.10 a	79 ± 5.42 a	215 ± 5.95 a	203 ± 1.66 a	31 ± 1.19 a	33 ± 1.76 a	164 ± 6.71 a	164 ± 3.13 a
	WB	36 ± 3.28 b	65 ± 4.22 b	223 ± 8.59 a	204 ± 2.85 a	27 ± 0.74 b	28 ± 1.36 b	171 ± 8.37 a	164 ± 1.82 a

Note: Each value is the mean ± standard error of four replicates. Different letters indicate means that differ significantly (p < 0.05). Different letters indicate means that differ significantly (p < 0.05). The treatments were: CK: the control treatment; LM: lime equivalent to a biochar application rate of 20 g kg⁻¹; BC: biochar at an application rate of 20 g kg⁻¹; WBC: washed biochar at an application rate of 20 g kg⁻¹.

). The proportion of Al-P in the total P in biochar amendments was the same as that under P addition. However, equivalent lime application weakly influenced the Al-P concentration in the rhizosphere under P addition. All the treatments induced a greater increase in Ca-P concentration in bulk and rhizosphere soils compared to the control. The application of biochar and washed biochar could increase the concentration of the available P components in the soil (NaHCO₃ extractable P, Al-P and Ca-P), while applying the equivalent lime only increased Al-P and Ca-P contents.

3.2. Plant Growth and P Uptake

Applying biochar to soil markedly affected the growth of rice plants (

Table 5. Effect of biochar and P supply on the growth and root morphology of rice (Oryza sativa L.) seedlings.

	Treatment	Shoot Dry Weight (g pot−1)	Root Dry Weight (g pot−1)	Root Length (m)	Root Surface Area (cm−2)
	CK	12.34 ± 0.44 b	2.74 ± 0.13 b	352 ± 21 b	3419 ± 58 b
−P	LM	13.24 ± 0.49 b	2.62 ± 0.11 b	368 ± 20 b	3537 ± 128 b
	BC	16.84 ± 0.95 a	3.86 ± 0.24 a	514 ± 55 a	4837 ± 295 a
	WB	13.64 ± 0.56 b	2.97 ± 0.17 b	366 ± 40 b	3734 ± 226 b
	CK	16.91 ± 0.33 b	3.21 ± 0.15 c	361 ± 30 b	3546 ± 106 b
+P	LM	19.48 ± 0.74 ab	4.03 ± 0.32 b	404 ± 46 b	4222 ± 346 b
	B	20.76 ± 1.62 a	4.65 ± 0.21 ab	555 ± 57 a	5358 ± 318 a
	WB	20.26 ± 0.58 a	4.73 ± 0.12 a	544 ± 49 a	5318 ± 138 a

Note: Each value is the mean ± standard error of four replicates. Different letters indicate means that differ significantly (p < 0.05). The treatments were: CK: the control treatment; LM: lime equivalent to a biochar application rate of 20 g kg⁻¹; BC: biochar at an application rate of 20 g kg⁻¹; WBC: washed biochar at an application rate of 20 g kg⁻¹.

). Under low P supply, applying biochar and washed biochar increased the shoot dry weight by 36% and 9.8%, respectively, and applying the equivalent lime increased the shoot dry weight by 7.3%. Under high P supply, applying biochar and washed biochar increased the shoot dry weight by 22% and 17%, respectively, and applying the equivalent lime increased the shoot dry weight by 15%. Rice plants had significantly higher root biomasses when biochar was applied than in the controls, regardless of whether P was applied. The total root length and root surface area per plant were significantly higher when biochar was applied than in the controls. P uptake was markedly increased by 75% and 42% due to the application of biochar or washed biochar when P was added (Figure 1), and applying the equivalent lime also promoted P accumulation in shoots by 39%.

3.3. Root Exudation of Organic Acids

As shown in Figure 2, adding P decreased the rate at which citric acid was exuded to a remarkable degree. Adding biochar or the equivalent lime increased the citrate exudation rate relative to the control when the P supply was low. Increasing the rate of citrate exudation from the roots is an important strategy for adapting to low soil P availability.

3.4. Expression of the Related Transporter Genes

Under low-P stress, applying biochar or the equivalent lime upregulated the expression of the phosphate transporter gene OsPT1, and applying biochar downregulated the expression of OsPT2 and OsPT6. Applying the equivalent lime upregulated the expression of OsPT2 and OsPT6 (Figure 3). However, its expression decreased significantly under P fertilizer treatment. The expression of OsFRDL4 in rice roots increased significantly after the low-P treatment, and its highest expression level was recorded under the combination of Al concentration and P deficiency. This was consistent with the expected relationship between the expression of OsFRDL4 and the organic acid exudation rate.

4. Discussion

Biochar has been found to play an important role in improving the availability of P in soil [34,35]. Studies have shown that biochar application increases soil pH and decreases the exchangeable acidity and exchangeable Al content [36,37,38]. The results of the present study indicated that applying biochar markedly affected the growth of rice plants (Table 5). Applying biochar and washed biochar increased the rice plant biomass by 36% and 9.8%, respectively, and applying the equivalent lime increased the biomass by 7.3%. A close relationship was found between promoting rice growth and improving soil characteristics. Adding biochar to soil increased the content of available P in the soil. Biochar provided liming and nutrient adsorption effects due to larger quantities of ash and surface area [39]. Then, biochar relieved other plausible constraints of this severely acidified paddy soil (low pH and highly exchangeable Al), as shown in Table 2, and, therefore, increased the overall vigor of the rice plants and the physiological responses of the plants to the lack of P (Table 4 and Figure 2). The increase in the pH caused by the liming effect of applying biochar may have promoted proton extrusion from the roots, which is the key process involved in P acquisition and the adaptive release of organic anions [40].

Rice-straw biochar contains P, which could directly affect the Pi fractions in the soil [35]. However, incorporation of biochar into soil also alters soil pH, the physical and chemical properties of soil, thus, indirectly affecting the soil P concentration. Rice residual biochar directly increases soil P availability by releasing P from biochar itself, or indirectly increases soil P availability by reducing P adsorption [14]. Orthophosphate and pyrophosphate are the main forms of P in the biochar, such as manure, which can directly increase soil P content [39]. In the present study, biochar application resulted in an increase in pH, from 4.29 to 4.60, which contributed to P desorption and increased P solubility in the soils (Table 2). The application of biochar could change the form of P fixation/adsorption agents, such as Fe, Al and Ca, and had a significant effect on the transformation of P in soil [41]. Applying phosphate fertilizer mainly increased the content of the Fe-P component in the soil (Table 4). In acidic soils, most added mineral P is easily combined with Fe [42]. Adding biochar containing relatively large amounts of Ca²⁺ and Mg²⁺ to soil can cause the formation of phosphate precipitates and increase P adsorption [43]. The results of the present study indicated that applying biochar increased the Ca-P fraction, which might improve the availability and plant uptake of P in soil (Figure 1). The washed biochar contained less Ca²⁺ than the biochar and was less alkaline. Applying washed biochar decreased the contribution of Ca-P to the total P content in the soil. Mukherjee et al. showed that Ca-P content increased significantly with biochar application rate [14]. The result of the present study was consistent with that of Ch’ng et al., who also observed that the soil Ca-P fraction increased in biochar-improved soil [44]. The increase in the Ca-P fraction may be related to the chemistry and retention of Ca [39]. Occluded P (the surfaces of Fe phosphate particles covered with an Fe³⁺ oxide film) is not available to plants. The results indicated that applying biochar decreased the occluded P content when the P content was low (Table 4). Chathurika et al. reported that biochar addition did not affect the occluded P content in two different soils [45], while other studies indicated that biochar significantly reduced the occluded P content [4]. The decrease in occluded P in the present study was accompanied by the marked responses of the roots to a lack of P, including the increase in the citrate exudation rate and the upregulation of the phosphorous transporter gene OsPT1 (Figure 2 and Figure 3).

Depletion of the P content in rhizosphere soil generally indicates the uptake of P [46]. A significant decrease in the rhizosphere NaHCO₃-P and Al-P fractions was observed in acidic soil, and no changes were observed for rhizosphere Fe-P and Ca-P fractions in comparison with bulk soil (Table 2 and Table 4). Biochar application increased the concentration of Al-P component and had no effect on the content of the Fe-P fraction, in both rhizosphere and bulk soil. Bornø et al. found that three different types of biochar had no effect on the content of NaOH-extractable Pi (Fe-P and Al-P) in bulk soils [47]. However, the NaOH-Pi fraction in rhizosphere soil increased significantly after biochar treatment without P supply. Mukherjee et al. reported that the content of Al-P and Fe-P increased significantly with an increase in biochar application, regardless of the initial total P state of the test soil [14], while Hong et al., showed that biochar could significantly increase Al-P content and decrease Fe-P content [48]. These studies demonstrated that the effects of biochar on P fractions in soil depended on the type and quantity of biochar, as well as the soil type. Sparingly soluble inorganic P is not readily accessible to some species (such as grasses) but is available to some legumes [49]. However, rice has been found to grow well when inorganic P is supplied as AlPO₄ rather than FePO₄, indicating that Al-P is very available to rice [50]. Root exudates are very important for the activation of sparingly soluble phosphates in soil [51].

Applying biochar improved rice root growth in the acidified paddy soil, significantly increasing the total root length and root surface area (Table 5). Biochar amendment resulted in more extensive root systems and improved P uptake in acidic paddy soil [52]. It has been reported that the whole rice genome contains 13 members of the Pht1 family [10], among which OsPT1, OsPT2 and OsPT6 are primarily expressed in the roots of rice and are related to Pi absorption and transportation [53,54]. OsPT1, a member of the Pht1 family, was enhanced and played an important role in P uptake under P deficiency [55]. The expression level of the phosphate transporter gene OsPT1 was upregulated in rice roots by the application of biochar under low-P stress. However, the expressions of OsPT2 and OsPT6 were downregulated in the roots under biochar amendment, suggesting that the Pi uptake through these phosphate transporters was downregulated by plant P status (Figure 3). The release of P was extremely dependent on high concentrations of organic acids. Among them, citrate is very effective in the mobilization of inorganic P, followed by malate, oxalate and tartrate [56]. The results showed that the root efflux of the citrate anion was enhanced by the application of biochar in the P-deficient rice plants, along with the increased expression of OsFRDL4 under low-P and acidic soil conditions (Figure 2 and Figure 3). The protein encoded by OsFRDL4 is closely related to citric acid transport, and the amount of organic acid secreted is proportional to the OsFRDL4 expression [9]. The over-expression of enzymes responsible for producing organic acids in roots increases Pi uptake from soil with a high Al content or a P deficiency [57,58].

5. Conclusions

Biochar provided both sorption and liming effects, thereby alleviating soil acidity and improving the available P content in acidified paddy soil. Biochar amendment affected the contributions of the different P fractions to the total P content, increasing the Al-P and Ca-P contributions and decreasing the occluded P contribution. Biochar application with P supply increased the concentration of plant-available P components in the rhizosphere soil and bulk soil. The application of biochar amendment strongly affected rice plant growth and the accumulation of P in the shoots. Biochar amendments enhanced root growth in acidified paddy soils, caused a high citrate exudation rate to be maintained by unfertilized plants and strongly upregulated the expressions of the anion-transporter-related OsFRDL4 gene and the OsPT1 phosphate transporter. The potential for P acquisition of rice was ameliorated with the application of biochar to degraded acidic soils.