Assessment of the Geographic Origin of Romanian Common Bean (Phaseolus vulgaris L.) Landraces Using Molecular Markers and Morphological Traits
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. DNA Extraction
2.3. Polymerase Chain Reaction (PCR) Amplification, Purification, Validation, and Sequencing
2.4. Morphological Analysis
2.5. Data Analysis
3. Results
3.1. Origin of Romanian Common Bean Landraces—Genetic Perspective
3.2. Origin of Romanian Common Bean Landraces—Morphological Perspective
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Morales, F.J. Common Bean BT—Virus and Virus-Like Diseases of Major Crops in Developing Countries; Loebenstein, G., Thottappilly, G., Eds.; Springer: Dordrecht, The Netherlands, 2003; pp. 425–445. ISBN 978-94-007-0791-7. [Google Scholar]
- Los, F.G.B.; Zielinski, A.A.F.; Wojeicchowski, J.P.; Nogueira, A.; Demiate, I.M. Beans (Phaseolus vulgaris L.): Whole Seeds with Complex Chemical Composition. Curr. Opin. Food Sci. 2018, 19, 63–71. [Google Scholar] [CrossRef]
- Broughton, W.J.; Hernández, G.; Blair, M.; Beebe, S.; Gepts, P.; Vanderleyden, J. Beans (Phaseolus spp.)—Model Food Legumes. Plant Soil 2003, 252, 55–128. [Google Scholar] [CrossRef]
- Reynoso-Camacho, R.; Ramos-Gomez, M.; Loarca-Pina, G. Bioactive Components in Common Beans (Phaseolus vulgaris L.). Adv. Agric. Food Biotechnol. 2006, 661, 217–236. [Google Scholar]
- Nadeem, M.A.; Yeken, M.Z.; Shahid, M.Q.; Habyarimana, E.; Yılmaz, H.; Alsaleh, A.; Hatipoğlu, R.; Çilesiz, Y.; Khawar, K.M.; Ludidi, N.; et al. Common Bean as a Potential Crop for Future Food Security: An Overview of Past, Current and Future Contributions in Genomics, Transcriptomics, Transgenics and Proteomics. Biotechnol. Biotechnol. Equip. 2021, 35, 758–786. [Google Scholar] [CrossRef]
- Celmeli, T.; Sari, H.; Canci, H.; Sari, D.; Adak, A.; Eker, T.; Toker, C. The Nutritional Content of Common Bean (Phaseolus vulgaris L.) Landraces in Comparison to Modern Varieties. Agronomy 2018, 8, 166. [Google Scholar] [CrossRef]
- Catarino, S.; Brilhante, M.; Essoh, A.P.; Charrua, A.B.; Rangel, J.; Roxo, G.; Varela, E.; Moldão, M.; Ribeiro-Barros, A.; Bandeira, S.; et al. Exploring Physicochemical and Cytogenomic Diversity of African Cowpea and Common Bean. Sci. Rep. 2021, 11, 12838. [Google Scholar] [CrossRef]
- Vaclav, S. Nitrogen in Crop Production: An Account of Global Flows Adds. Glob. Biogeochem. Cycles 1999, 13, 647–662. [Google Scholar]
- Gepts, P.; Debouck, D. Origin, Domestication, and Evolution of the Common Bean (Phaseolus vulgaris L.). In Common Beans: Research for Crop Improvement; CAB International: Wallingford, UK, 1991; pp. 7–53. [Google Scholar]
- Chacón, S.M.I.; Pickersgill, B.; Debouck, D.G. Domestication Patterns in Common Bean (Phaseolus vulgaris L.) and the Origin of the Mesoamerican and Andean Cultivated Races. Theor. Appl. Genet. 2005, 110, 432–444. [Google Scholar] [CrossRef]
- Papa, R.; Nanni, L.; Sicard, D.; Rau, D.; Attene, G. Evolution of Genetic Diversity in Phaseolus vulgaris L. In Darwin’s Harvest: New Approaches to the Origins, Evolution, and Conservation of Crops; Motley, T.J., Zerega, N., Cross, H., Eds.; Columbia University Press: New York, NY, USA, 2006; pp. 121–142. [Google Scholar]
- Gepts, P. A Middle American and an Andean Common Bean Gene Pool BT—Genetic Resources of Phaseolus Beans: Their Maintenance, Domestication, Evolution and Utilization; Gepts, P., Ed.; Springer: Dordrecht, The Netherlands, 1988; pp. 375–390. ISBN 978-94-009-2786-5. [Google Scholar]
- Gepts, P.; Bliss, F.A. Dissemination Pathways of Common Bean (Phaseolus vulgaris, Fabaceae) Deduced from Phaseolin Electrophoretic Variability. II. Europe and Africa. Econ. Bot. 1988, 42, 86–104. [Google Scholar] [CrossRef]
- Zeven, A.C. The Introduction of the Common Bean (Phaseolus vulgaris L.) into Western Europe and the Phenotypic Variation of Dry Beans Collected in the Netherlands in 1946. Euphytica 1997, 94, 319–328. [Google Scholar] [CrossRef]
- Gioia, T.; Logozzo, G.; Attene, G.; Bellucci, E.; Benedettelli, S.; Negri, V.; Papa, R.; Spagnoletti Zeuli, P. Evidence for Introduction Bottleneck and Extensive Inter-Gene Pool (Mesoamerica × Andes) Hybridization in the European Common Bean (Phaseolus vulgaris L.) Germplasm. PLoS ONE 2013, 8, e75974. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Blair, M.W.; Wang, S. Genetic Diversity of Chinese Common Bean (Phaseolus vulgaris L.) Landraces Assessed with Simple Sequence Repeat Markers. Theor. Appl. Genet. 2008, 117, 629–640. [Google Scholar] [CrossRef] [PubMed]
- Olaru, C. Common Bean-Biology and Agriculture Technology; Romanian Writing: Craiova, Romania, 1982. [Google Scholar]
- Rossi, M.; Bitocchi, E.; Bellucci, E.; Nanni, L.; Rau, D.; Attene, G.; Papa, R. Linkage Disequilibrium and Population Structure in Wild and Domesticated Populations of Phaseolus vulgaris L. Evol. Appl. 2009, 2, 504–522. [Google Scholar] [CrossRef] [PubMed]
- Johns, M.A.; Skroch, P.W.; Nienhuis, J.; Hinrichsen, P.; Bascur, G.; Muñoz-Schick, C. Gene Pool Classification of Common Bean Landraces from Chile Based on RAPD and Morphological Data. Crop Sci. 1997, 37, 605–613. [Google Scholar] [CrossRef]
- Carović-Stanko, K.; Liber, Z.; Vidak, M.; Barešić, A.; Grdiša, M.; Lazarević, B.; Šatović, Z. Genetic Diversity of Croatian Common Bean Landraces. Front. Plant Sci. 2017, 8, 604. [Google Scholar] [CrossRef]
- Sicard, D.; Nanni, L.; Porfiri, O.; Bulfon, D.; Papa, R. Genetic Diversity of Phaseolus vulgaris L. and P. coccineus L. Landraces in Central Italy. Plant Breed. 2005, 124, 464–472. [Google Scholar] [CrossRef]
- Bitocchi, E.; Bellucci, E.; Giardini, A.; Rau, D.; Rodriguez, M.; Biagetti, E.; Santilocchi, R.; Zeuli, P.S.; Gioia, T.; Logozzo, G.; et al. Molecular Analysis of the Parallel Domestication of the Common Bean (Phaseolus vulgaris) in Mesoamerica and the Andes. New Phytol. 2013, 197, 300–313. [Google Scholar] [CrossRef]
- Gepts, P.; Osborn, T.C.; Rashka, K.; Bliss, F.A. Phaseolin-Protein Variability in Wild Forms and Landraces of the Common Bean (Phaseolus vulgaris): Evidence for Multiple Centers of Domestication. Econ. Bot. 1986, 40, 451–468. [Google Scholar] [CrossRef]
- Vidak, M.; Šatović, Z.; Liber, Z.; Grdiša, M.; Gunjača, J.; Kilian, A.; Carović-Stanko, K. Assessment of the Origin and Diversity of Croatian Common Bean Germplasm Using Phaseolin Type, SSR and SNP Markers and Morphological Traits. Plants 2021, 10, 665. [Google Scholar] [CrossRef]
- Konzen, E.R.; Recchia, G.H.; Cassieri, F.; Gomes Caldas, D.G.; Berny Mier, Y.; Teran, J.C.; Gepts, P.; Tsai, S.M. DREB Genes from Common Bean (Phaseolus vulgaris L.) Show Broad to Specific Abiotic Stress Responses and Distinct Levels of Nucleotide Diversity. Int. J. Genomics 2019, 2019, 9520642. [Google Scholar] [CrossRef]
- Gepts, P. Phaseolin as an Evolutionary Marker. In Current Plant Science and Biotechnology in Agriculture; Springer: Dordrecht, The Netherlands, 1988; pp. 215–241. [Google Scholar] [CrossRef]
- Logozzo, G.; Donnoli, R.; Macaluso, L.; Papa, R.; Knüpffer, H.; Zeuli, P.S. Analysis of the Contribution of Mesoamerican and Andean Gene Pools to European Common Bean (Phaseolus vulgaris L.) Germplasm and Strategies to Establish a Core Collection. Genet. Resour. Crop Evol. 2007, 54, 1763–1779. [Google Scholar] [CrossRef]
- Cichy, K.A.; Porch, T.G.; Beaver, J.S.; Cregan, P.; Fourie, D.; Glahn, R.P.; Grusak, M.A.; Kamfwa, K.; Katuuramu, D.N.; McClean, P.; et al. A Phaseolus vulgaris Diversity Panel for Andean Bean Improvement. Crop Sci. 2015, 55, 2149–2160. [Google Scholar] [CrossRef]
- Raggi, L.; Tiranti, B.; Negri, V. Italian Common Bean Landraces: Diversity and Population Structure. Genet. Resour. Crop Evol. 2013, 60, 1515–1530. [Google Scholar] [CrossRef]
- Cerdà, A.; García-Fayos, P. The Influence of Seed Size and Shape on Their Removal by Water Erosion. Catena 2002, 48, 293–301. [Google Scholar] [CrossRef]
- Dwivedi, S.L.; Ceccarelli, S.; Blair, M.W.; Upadhyaya, H.D.; Are, A.K.; Ortiz, R. Landrace Germplasm for Improving Yield and Abiotic Stress Adaptation. Trends Plant Sci. 2016, 21, 31–42. [Google Scholar] [CrossRef]
- Cortés, A.J.; Blair, M.W. Genotyping by Sequencing and Genome–Environment Associations in Wild Common Bean Predict Widespread Divergent Adaptation to Drought. Front. Plant Sci. 2018, 9, 128. [Google Scholar] [CrossRef]
- Negri, V. Landraces in Central Italy: Where and Why They Are Conserved and Perspectives for Their on-Farm Conservation. Genet. Resour. Crop Evol. 2003, 50, 871–885. [Google Scholar] [CrossRef]
- Shao, J.; Hao, Y.; Wang, L.; Xie, Y.; Zhang, H.; Bai, J.; Wu, J.; Fu, J. Development of a Model for Genomic Prediction of Multiple Traits in Common Bean Germplasm, Based on Population Structure. Plants 2022, 11, 1298. [Google Scholar] [CrossRef]
- Lioi, L.; Zuluaga, D.L.; Pavan, S.; Sonnante, G. Genotyping-by-Sequencing Reveals Molecular Genetic Diversity in Italian Common Bean Landraces. Diversity 2019, 11, 154. [Google Scholar] [CrossRef]
- Suárez, J.C.; Urban, M.O.; Contreras, A.T.; Grajales, M.Á.; Cajiao, C.; Beebe, S.E.; Rao, I.M. Adaptation of Interspecific Mesoamerican Common Bean Lines to Acid Soils and High Temperature in the Amazon Region of Colombia. Plants 2021, 10, 2412. [Google Scholar] [CrossRef]
- Beebe, S. Common Bean Breeding in the Tropics. Plant Breed. Rev. 2012, 36, 357–426. [Google Scholar]
- Leitão, S.T.; Dinis, M.; Veloso, M.M.; Šatović, Z.; Vaz Patto, M.C. Establishing the Bases for Introducing the Unexplored Portuguese Common Bean Germplasm into the Breeding World. Front. Plant Sci. 2017, 8, 1296. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Nei, M.; Kumar, S. Prospects for Inferring Very Large Phylogenies by Using the Neighbor-Joining Method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef]
- Ruiz-Nieto, J.E.; Aguirre-Mancilla, C.L.; Acosta-Gallegos, J.A.; Raya-Pérez, J.C.; Piedra-Ibarra, E.; Vázquez-Medrano, J.; Montero-Tavera, V. Photosynthesis and Chloroplast Genes Are Involved in Water-Use Efficiency in Common Bean. Plant Physiol. Biochem. 2015, 86, 166–173. [Google Scholar] [CrossRef]
- Rodiño, A.P.; Santalla, M.; De Ron, A.M.; Singh, S.P. A Core Collection of Common Bean from the Iberian Peninsula. Euphytica 2003, 131, 165–175. [Google Scholar] [CrossRef]
- Maras, M.; Pipan, B.; Šuštar-Vozlič, J.; Todorović, V.; Ðurić, G.; Vasić, M.; Kratovalieva, S.; Ibusoska, A.; Agić, R.; Matotan, Z.; et al. Examination of Genetic Diversity of Common Bean from the Western Balkans. J. Am. Soc. Hortic. Sci. 2015, 140, 308–316. [Google Scholar] [CrossRef]
- Bitocchi, E.; Nanni, L.; Bellucci, E.; Rossi, M.; Giardini, A.; Zeuli, P.S.; Logozzo, G.; Stougaard, J.; McClean, P.; Attene, G.; et al. Mesoamerican Origin of the Common Bean (Phaseolus vulgaris L.) Is Revealed by Sequence Data. Proc. Natl. Acad. Sci. USA 2012, 109, E788–E796. [Google Scholar] [CrossRef]
- Liu, S.; Feuerstein, U.; Luesink, W.; Schulze, S.; Asp, T.; Studer, B.; Becker, H.C.; Dehmer, K.J. DArT, SNP, and SSR Analyses of Genetic Diversity in Lolium perenne L. Using Bulk Sampling. BMC Genet. 2018, 19, 10. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a Genetic Linkage Map in Man Using Restriction Fragment Length Polymorphisms. Am. J. Hum. Gen. 1980, 32, 314–331. [Google Scholar]
- Serrote, C.M.L.; Reiniger, L.R.S.; Silva, K.B.; dos Santos Rabaiolli, S.M.; Stefanel, C.M. Determining the Polymorphism Information Content of a Molecular Marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000; ISBN 0-19-513584-9. [Google Scholar]
- Blair, M.W.; Giraldo, M.C.; Buendía, H.F.; Tovar, E.; Duque, M.C.; Beebe, S.E. Microsatellite Marker Diversity in Common Bean (Phaseolus vulgaris L.). Theor. Appl. Genet. 2006, 113, 100–109. [Google Scholar] [CrossRef] [PubMed]
- Polania, J.; Rao, I.M.; Cajiao, C.; Rivera, M.; Raatz, B.; Beebe, S. Physiological Traits Associated with Drought Resistance in Andean and Mesoamerican Genotypes of Common Bean (Phaseolus vulgaris L.). Euphytica 2016, 210, 17–29. [Google Scholar] [CrossRef]
- Zeven, A.C.; Waninge, J.; van Hintum, T.; Singh, S.P. Phenotypic Variation in a Core Collection of Common Bean (Phaseolus vulgaris L.) in the Netherlands. Euphytica 1999, 109, 93–106. [Google Scholar] [CrossRef]
- Rodiño, A.P.; Santalla, M.; González, A.M.; De Ron, A.M.; Singh, S.P. Novel Genetic Variation in Common Bean from the Iberian Peninsula. Crop Sci. 2006, 46, 2540–2546. [Google Scholar] [CrossRef]
- Gil, J.; Ron, A. De Variation in Phaseolus vulgaris in the Northwest of the Iberian Peninsula. Plant Breed. 1992, 109, 313–319. [Google Scholar] [CrossRef]
- Freitas, G.; Ganança, J.F.T.; Nóbrega, H.; Nunes, É.; Costa, G.; Slaski, J.J.; de Carvalho, M.Â.A.P. Morphological Evaluation of Common Bean Diversity on the Island of Madeira. Genet. Resour. Crop Evol. 2011, 58, 861–874. [Google Scholar] [CrossRef]
- Angioi, S.A.; Rau, D.; Nanni, L.; Bellucci, E.; Papa, R.; Attene, G. The Genetic Make-up of the European Landraces of the Common Bean. Plant Genet. Resour. 2011, 9, 197–201. [Google Scholar] [CrossRef]
- Bitocchi, E.; Rau, D.; Bellucci, E.; Rodriguez, M.; Murgia, M.L.; Gioia, T.; Santo, D.; Nanni, L.; Attene, G.; Papa, R. Beans (Phaseolus ssp.) as a Model for Understanding Crop Evolution. Front. Plant Sci. 2017, 8, 722. [Google Scholar] [CrossRef]
- Bellucci, E.; Bitocchi, E.; Rau, D.; Rodriguez, M.; Biagetti, E.; Giardini, A.; Attene, G.; Nanni, L.; Papa, R. Genomics of Origin, Domestication and Evolution of Phaseolus vulgaris. In Genomics of Plant Genetic Resources; Springer: Dordrecht, The Netherlands, 2014; pp. 483–507. ISBN 978-94-007-7571-8. [Google Scholar]
Gene | Primers (5′-3′) | Primer Direction | Annealing Temperature (°C) | Expected Size of the Gene (bp) | Reference |
---|---|---|---|---|---|
PvDREB5A | ATGGAAGGAGAAGGTTTAGGAG | Forward | 50 °C | 483 †/474 ‡ bp | [25] |
CTAGTCTTCGGGTTTAGGA | Reverse | ||||
PvRPS4 | CGAACTTAGAAATCAATTGCGCTT | Forward | 54 °C | 395 bp | Generated by PrimerBLAST online |
TTGGCAATTTATCACGGGGG | Reverse | ||||
PvDREB6B | ATGGGAACCGCTATAGATATGT | Forward | 50 °C | 957 bp | [25] |
TCATATAGCCGCCCAATC | Reverse |
Sequence Characteristics | Andean Gene Pool | Mesoamerican Gene Pool | ||||
---|---|---|---|---|---|---|
PvDREB5A | PvDREB6B | PvRPS4 | PvDREB5A | PvDREB6B | PvRPS4 | |
Conserved nucleotides | 474/474 | 945/95 | 398/398 | 483/483 | 946/957 | 398/398 |
Variable nucleotides | 0/474 | 12/957 | 0/398 | 0/4483 | 11/957 | 0/398 |
Nucleotides parsimony info | 0/474 | 11/957 | 0/398 | 0/483 | 0/957 | 0/398 |
Nucleotides-0 fold degenerate sites | 306/474 | 633/957 | 267/398 | 312/483 | 631/957 | 266/398 |
Nucleotides-2 fold degenerate sites | 95/474 | 171/957 | 80/398 | 98/483 | 172/957 | 81/398 |
Nucleotides-4 fold degenerate sites | 73/474 | 148/957 | 49/398 | 73/483 | 150/957 | 49/398 |
Conserved amino acids | 157/158 | 312/319 | 122/132 | 163/163 | 313/319 | 122/132 |
Variable amino acids | 0/158 | 6/319 | 0/132 | 0/163 | 5/319 | 0/132 |
Amino acid parsimony info | 0/158 | 5/319 | 0/132 | 0/163 | 0/319 | 0/132 |
Amino acid- Singleton sites | 0/158 | 1/319 | 0/132 | 0/163 | 5/319 | 0/132 |
Gene | Scope of Analysis | Values |
---|---|---|
PvDREB5A | Within Mean Group Distance | 0 |
Between Group Mean Distance | Andean/Mesoamerica: 0.00211 | |
Mesoamerica/Andean: 0.00217 | ||
Mean Interpopulation Diversity | 0 | |
Coefficient of Differentiation, with standard error | D: 1; S.E.: 0.47 | |
PvDREB6B | Within Mean Group Distance | 0.01 (Andean population) |
Between Group Mean Distance | Andean/Mesoamerica: 0.0028 | |
Mesoamerica/Andean: 0.0107 | ||
Mean Interpopulation Diversity | 0 | |
Coefficient of Differentiation, with standard error | D: −0.09; S.E.: 0.17 | |
PvRPS4 | Within Mean Group Distance | 0 |
Between Group Mean Distance | Andean/Mesoamerica: 0.00243 | |
Mesoamerica/Andean: 0.00252 | ||
Mean Interpopulation Diversity | 0 | |
Coefficient of Differentiation, with standard error | D: 1; S.E.: 0.49 |
Characteristics | Average (Min–Max) | Mean ± SD | Std. Error of Mean | Coefficient of Variation |
---|---|---|---|---|
Andean gene pool | ||||
Length (mm) | 14.04 (11.61–16.8) | 14.04 ± 2.25 | 1.01 | 16.09% |
Width (mm) | 5.09 (4.55–5.51) | 509 ± 0.36 | 0.16 | 7.25% |
Height (mm) | 7.09 (5.66–8.23) | 7.09 ± 1.2 | 0.54 | 17.03% |
Weight (mm) | 0.38 (0.23–0.56) | 0.38 ± 0.14 | 0.06 | 36.53% |
Flatness index | 1.36 (1.26–1.45) | 1.36 ± 0.06 | 0.03 | 5.01% |
Excentricity index | 2.58 (1.84–3.17) | 2.58 ± 0.53 | 0.23 | 20.60% |
100 seed weight (g) | 37.74 (22.95–50.48) | 37.74 ± 10.32 | 4.61 | 27.35% |
Mesoamerican gene pool | ||||
Length (mm) | 12.42 (9.86–15.8) | 12.42 ± 1.9 | 0.4 | 15.29% |
Width (mm) | 5.26 (4.39–6.54) | 5.26 ± 0.61 | 0.13 | 11.61% |
Height (mm) | 7.84 (6.56–10.72) | 7.83 ± 1 | 0.21 | 12.81% |
Weight (mm) | 0.44 (0.24–1.95) | 0.43 ± 0.35 | 0.07 | 80.09% |
Flatness index | 1.15 (1.05–1.29) | 1.15 ± 0.06 | 0.01 | 5.49% |
Excentricity index | 2.30 (1.27–3.39) | 2.3 ± 0.61 | 0.13 | 26.73% |
100 seed weight (g) | 34.44 (24.21–61) | 34.44 ± 9.19 | 1.96 | 26.69% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galan, P.-M.; Leti, L.-I.; Strajeru, S.; Petrescu, D.-E.; Cimpeanu, M.-M.; Tanasa, A.-C.; Sandru, D.-M.; Gorgan, D.-L. Assessment of the Geographic Origin of Romanian Common Bean (Phaseolus vulgaris L.) Landraces Using Molecular Markers and Morphological Traits. Agronomy 2023, 13, 2820. https://doi.org/10.3390/agronomy13112820
Galan P-M, Leti L-I, Strajeru S, Petrescu D-E, Cimpeanu M-M, Tanasa A-C, Sandru D-M, Gorgan D-L. Assessment of the Geographic Origin of Romanian Common Bean (Phaseolus vulgaris L.) Landraces Using Molecular Markers and Morphological Traits. Agronomy. 2023; 13(11):2820. https://doi.org/10.3390/agronomy13112820
Chicago/Turabian StyleGalan, Paula-Maria, Livia-Ioana Leti, Silvia Strajeru, Denisa-Elena Petrescu, Mirela-Mihaela Cimpeanu, Alina-Carmen Tanasa, Dan-Marius Sandru, and Dragos-Lucian Gorgan. 2023. "Assessment of the Geographic Origin of Romanian Common Bean (Phaseolus vulgaris L.) Landraces Using Molecular Markers and Morphological Traits" Agronomy 13, no. 11: 2820. https://doi.org/10.3390/agronomy13112820
APA StyleGalan, P.-M., Leti, L.-I., Strajeru, S., Petrescu, D.-E., Cimpeanu, M.-M., Tanasa, A.-C., Sandru, D.-M., & Gorgan, D.-L. (2023). Assessment of the Geographic Origin of Romanian Common Bean (Phaseolus vulgaris L.) Landraces Using Molecular Markers and Morphological Traits. Agronomy, 13(11), 2820. https://doi.org/10.3390/agronomy13112820